Literature DB >> 20870970

Targeted inactivation of kinesin-1 in pancreatic β-cells in vivo leads to insulin secretory deficiency.

Ju Cui1, Zai Wang, Qianni Cheng, Raozhou Lin, Xin-Mei Zhang, Po Sing Leung, Neal G Copeland, Nancy A Jenkins, Kwok-Ming Yao, Jian-Dong Huang.   

Abstract

OBJECTIVE: Suppression of Kinesin-1 by antisense oligonucleotides, or overexpression of dominant-negative acting kinesin heavy chain, has been reported to affect the sustained phase of glucose-stimulated insulin secretion in β-cells in vitro. In this study, we examined the in vivo physiological role of Kinesin-1 in β-cell development and function. RESEARCH DESIGN AND METHODS: A Cre-LoxP strategy was used to generate conditional knockout mice in which the Kif5b gene is specifically inactivated in pancreatic β-cells. Physiological and histological analyses were carried out in Kif5b knockout mice as well as littermate controls.
RESULTS: Mice with β-cell specific deletion of Kif5b (Kif5b(fl/)⁻:RIP2-Cre) displayed significantly retarded growth as well as slight hyperglycemia in both nonfasting and 16-h fasting conditions compared with control littermates. In addition, Kif5b(fl/)⁻:RIP2-Cre mice displayed significant glucose intolerance, which was not due to insulin resistance but was related to an insulin secretory defect in response to glucose challenge. These defects of β-cell function in mutant mice were not coupled with observable changes in islet morphology, islet cell composition, or β-cell size. However, compared with controls, pancreas of Kif5b(fl/)⁻:RIP2-Cre mice exhibited both reduced islet size and increased islet number, concomitant with an increased insulin vesicle density in β-cells.
CONCLUSIONS: In addition to being essential for maintaining glucose homeostasis and regulating β-cell function, Kif5b may be involved in β-cell development by regulating β-cell proliferation and insulin vesicle synthesis.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20870970      PMCID: PMC3012189          DOI: 10.2337/db09-1078

Source DB:  PubMed          Journal:  Diabetes        ISSN: 0012-1797            Impact factor:   9.461


Insulin is exclusively produced and secreted from pancreatic β-cells in two distinct phases in response to elevated blood glucose levels. The first phase of insulin release is triggered by a rapid increase of intracellular calcium level leading to fusion of predocked insulin granules at the plasma membrane (1). The second phase of insulin release requires the mobilization of insulin-containing granules from the storage pool to the β-cell periphery to sustain insulin release (2). The molecular mechanism for the first phase of insulin release has been extensively investigated (1,3–5); however, little is known regarding the second phase of insulin secretion (6). Pharmacological and cytological observations suggest that dynamic turnover of tubulin and microtubules is important for regulation of intracellular transportation of insulin granules and their subsequent release from β-cells (7). Boyd et al. (8) observed a proportion of insulin-containing vesicles attached along the microtubules by double-immunostaining of primary cultured pancreatic β-cells. Furthermore, colchicine treatment does not affect the immediate release of insulin but significantly attenuates the following sustained phase of response. In addition, Suprenant and Dentler (9) demonstrated direct binding of insulin-containing granules to microtubules in vitro, and that insulin granule movement along microtubules is dependent on microtubule-associated proteins in the presence of ATP. Therefore, it was suggested that microtubules within the β-cell serve as supporting structures (railways) upon which insulin granules travel from the β-cell interior to the plasma membrane. Kinesin and dynein are two motor proteins that have been identified to translocate cargos along microtubules to opposite directions for fast transportation. Conventional kinesin (Kinesin-1) is a heterotetramer of two heavy chains (KHCs) and two light chains (KLCs). The head domain of KHC contains the ATP binding domain for generating motile force as well as a motif for interaction with microtubules, whereas the tail domain and KLC are responsible for cargo binding (10–12). In mice, three conventional kinesin heavy chain genes have been identified, including Kif5a, Kif5b, and Kif5c. Kif5b is the mouse homologue of the human ubiquitous KHC (13) and was first identified and characterized in pancreatic β-cells (14). The functions and molecular mechanism of kinesin transportation have been extensively studied in neuronal cells and tissues. However, only a few reports are related to the role of this motor protein during cargo transportation in nonneuronal mammalian cell types (15–19). Meng et al. (20) reported that suppression of Kif5b by antisense oligonucleotides inhibits both basal- and glucose-stimulated insulin secretion (GSIS) in primary mouse pancreatic β-cells. Immunocytochemistry study showed that Kif5b is colocalized with some insulin-containing vesicles in β-cell lines (MIN6 & INS-1) (18). Moreover, expression of a dominant-negative KHC motor domain (KHCmut) strongly inhibited the sustained, but not acute, insulin secretion in response to glucose challenge (18). Besides Kif5b, other motor proteins such as myosin Va and dynein are also involved in insulin secretion (21,22). All the above studies were carried out in an in vitro model, and the physiological role of Kif5b in pancreatic β-cells has not been elucidated in vivo. Therefore, to directly explore the role of Kif5b in β-cells, we generated a conditional knockout mouse under the control of RIP2-Cre by using a Cre-LoxP recombination system.

RESEARCH DESIGN AND METHODS

Generation of Kif5b as well as Kif5b+/− mice by gene targeting.

A bacterial artificial chromosome DNA containing the Kif5b gene (bacterial artificial chromosome clone 307D12) was partially digested with XbaI and subcloned into a pBluescript II-KS plasmid. A plasmid containing a 14.5-kb DNA insert, pBS-Kif5b, was identified by Southern blotting using a labeled probe containing exon 2, where the ATP-GTP-A site is located (data not shown). The TK4 gene from pBS-304 was cloned into the SalI site of pBS-Kif5b. The first loxP site was introduced into the first intron of Kif5b gene by the recombinogenic targeting of a loxp-Pgk-Tn5-Neo-loxp cassette (PCR amplified from the modified pGK-loxP plasmid with primer: TCTTGTGACTTAGAGTTTATAAAATAGAGTAATTTTGAAAACACATAGATATCTGCAAACCCTATGCTACTCCGTCG and CGCTCTCCTGAGTAGGACAAATCCGCCGGGACTATAGGTTGTGTAATGTGTATTTCAAGTCAAAAAATGAATTGAAAAAAA) into pBS-Kif5b, followed by removal of the fragment between the two loxP sites via Cre-mediated recombination. The second loxP site accompanying the frt-Pgk-Tn5-Neo-frt cassette was introduced into the second intron of Kif5b gene by targeting a frt-Pgk-Tn5-Neo-frt-loxP cassette (PCR amplified from the modified PBS-246-FRT plasmid by PCR primers primer: GGATGCACGGCTGTGAGCACAGGACTTTCCTGTGTTTGGAGT and primer: AGTTGGATTTAAGGAAGTACTACTAAAACTTCAATTAGTCTTACTAAAAA) into the pBS-Kif5b-loxP to form the final Kif5b knockout construct. The Kif5b-knockout construct, containing 14.5 kb of the Kif5b gene, was linearized by NotI and was introduced into CJ7 mouse embryonic cells in Drs. Jenkins and Copeland's lab in National Cancer Institute (NCI), USA, by electroporation and screened by genomic Southern blotting. The neo of Kif5b targeted allele was removed by crossing the mice with a Fple deleter strain TgN(ACTFLPe)9205Dym/J (23). Kif5b+/− mice were generated by crossing Kif5b+ mice with actin-Cre mice. Mice with Kif5b and Kif5b+/− genotypes were maintained by backcrossing to C57BL/6N females under a specific pathogen-free environment.

Generation of Kif5b conditional knockout mice and genotyping.

RIP2-Cre transgenic mice (24) (from Jackson Laboratory) were first crossed with Kif5b+/− to generate Kif5b+/−; RIP2-Cre mice. Then Kif5b+/−; RIP2-Cre mice were bred with Kif5b mice to generate the final mutant mice (Kif5b:RIP2-Cre) as well as their littermates (Kif5b+, Kif5b−, and Kif5b+:RIP2-Cre). Genotyping was performed by PCR using corresponding primers. To avoid hormonal effects in physiological assays, only male animals were used in all experiments.

Islet isolation and insulin content measurement.

Islet isolation and insulin extraction were carried out as previously described (25). Insulin contents in the islet extracts were analyzed by using the insulin ELISA kit (LINCO Research) and normalized to total protein concentrations determined by Bradford method (Bio-Rad).

Western blot and immunostaining.

Protein levels were determined by blotting with anti-Kif5b primary antibody (1:2,000, against synthesized peptide FDKEKANLEAFTADKDIA), anti-Kif5a (1:1,000, against synthesized peptide NGNATDINDNRSDLPC), anti-Kif5c (1:1,000, against synthesized peptide SAKDQKSLEPC), and anti-actin primary antibody (1:3,000, Sigma). Enhanced chemiluminescence kit (Pierce) was used for detection of the immunoreactive bands. Paraffin sections were immunostained by primary antibodies against Kif5b (1:400), glucagon (1:1,000, Dako), and insulin (1:2,000, Sigma). Visualization of these proteins was realized by incubating with FITC/Cy3 or HRP-conjugated secondary antibodies.

Blood glucose and plasma insulin measurement.

Blood was obtained from the tail vein of mice. Blood glucose concentration was determined by Glucometer Elite (Bayor Inc.). Blood samples were collected by Microvette CB300 (Sarstedt) and centrifuged at 5,000 rpm for 5 min at room temperature. After centrifugation, supernatant was collected for determining plasma insulin levels by using insulin ELISA kit (LINCO Research).

Morphometric analysis.

Paraffin sections of pancreata were processed for hematoxylin and eosin staining and observed by a light microscope (Carl Zeiss). For transmission electron microscopy (TEM) study, isolated islets were fixed by 2.5% glutaraldehyde in carcodylate buffer and embedded in 2% soft agar, followed by further embedding in fresh epoxy resin. Ultrathin sections were examined on a Philips EM208s transmission electron microscope operated at 80 kV. All photos were analyzed by using Image-Pro Plus software.

Quantitation of β-cell proliferation rates.

β-cell division was determined by 5-bromo-2′-deoxyuridine (BrdU) incorporation in 1-month-old mice using BrdU staining kit (ZYMED Laboratory). Pancreatic paraffin sections were further counterstained by hematoxylin and imaged with a Zeiss Axioskop microscope to count BrdU+ β-cells and total nuclei within islets.

Statistical analysis.

SigmaStat (Systat Software) was used to analyze all data, which were expressed as mean ± SE. The data were analyzed by one-way ANOVA followed by Tukey test or unpaired two-tailed Student t test.

RESULTS

Generation of Kif5b:RIP2-Cre mice.

The ability of RIP2-Cre to induce pancreatic β-cell specific ablation has previously been reported when these founder mice were crossed with mice carrying various floxed genes including glucokinase (26), insulin receptor (27), mitochondrial transcription factor A (28), and hepatocyte growth factor (25). Although RIP2-Cre displays a low level of expression in the hypothalamus, it exhibits high expression level in β-cells within the pancreatic islet (24). Therefore, conditional knockout of Kif5b mainly occurred in pancreatic β-cells. Figure 1A shows the strategy to generate Kif5b and Kif5b+/− mice. Ablation of one Kif5b allele was confirmed by Southern blot as well as Western blot analyses (Fig. 1B and C). Figure 2A shows the genomic organization of different Kif5b alleles. P1 and P2 primers were used to differentiate the wild-type and knockout alleles. The distance between P1 and P2 was 6.6 kb in length, which was too long to be amplified by PCR genotyping. Because of the deletion of exon 2, a 219-bp PCR product could be amplified from the Kif5b knockout allele accordingly (Fig. 2B). P1 and P3 primers, used to differentiate the floxed and wild-type Kif5b alleles, result in two bands of 275 and 215 bp, respectively (Fig. 2B). The RIP-2 Cre transgene was detected using Cre primers (Fig. 2B).
FIG. 1.

Targeted disruption of the mouse Kif5b gene in ES cells. A: Targeting strategy with positive–negative selection. Strategy of genomic Southern blot for screening for the homologous recombinant embryonic stem (ES) cell clones is also included. E1, E2, E3, E4, and E5 represent exon 1, exon 2, exon 3, exon 4, and exon 5 of the Kif5b gene, respectively. EI and EV represent EcoRI and EcoRV cut sites, respectively. The solid square with bars on each side (the bar representing an frt site) represents the 1.7-kb frt-NeoR-frt cassette. The triangles represent the LoxP sites (drawing not to scale). Frt: Flippase recognition target; TK: Thymidine Kinase. B: Southern blotting analysis of targeted ES clones. Restriction enzyme used for screening 5′ end recombination events was EcoRV. A 15.5-kb fragment in wild-type and a 7.9-kb fragment after homologous recombination were expected by the 5′ external probe. Restriction enzyme used for screening 3′ end recombination events was EcoRI. A 6.2-kb fragment in wild-type and a 7.6-kb fragment in targeted cells were expected by using the 3′ external probe. These probes are indicated in panel (A). C: Western blot analysis of Kif5b protein expression in different tissues in homozygous as well as heterozygous mice for the targeted Kif5b mutation. Actin was used as internal control.

FIG. 2.

Assessment of conditional Kif5b inactivation in pancreatic β-cells of Kif5b:RIP2-Cre mice. A: Schematic illustration of Cre-mediated deletion of exon 2 from the Kif5b allele. B: Representative pictures show PCR analysis of the offspring genomic DNA from ear. To detect the presence of the floxed Kif5b allele, we used primer P1 5′-TGAAGGCTAAGTCAGATATGGATGC-3′ located upstream of loxP site and P3 5′-TTACTAACTGAACCTGGCTTCCTAG-3′ located downstream of loxP site. The presence of Kif5b knockout allele was detected by primer P1 5′-TGAAGGCTAAGTCAGATATGGATGC-3′ located in intron 1 and P2 5′-GGATTGGCACCTTTACCTAGAAGG-3′ located in intron 2 of the Kif5b gene. The RIP-Cre transgenic mice were identified by amplification of Cre allele using primer 5′-GGACATGTTCAGGGATCGCCAGGCG-3′ and 5′-GGCATGTTCAGGGATCGCCAGGCG-3′. The PCR bands of wild-type (215 bp), floxed (275 bp), null allele (219 bp), and Cre (250 bp) are indicated. Genotypes of representative litters are indicated.

Targeted disruption of the mouse Kif5b gene in ES cells. A: Targeting strategy with positive–negative selection. Strategy of genomic Southern blot for screening for the homologous recombinant embryonic stem (ES) cell clones is also included. E1, E2, E3, E4, and E5 represent exon 1, exon 2, exon 3, exon 4, and exon 5 of the Kif5b gene, respectively. EI and EV represent EcoRI and EcoRV cut sites, respectively. The solid square with bars on each side (the bar representing an frt site) represents the 1.7-kb frt-NeoR-frt cassette. The triangles represent the LoxP sites (drawing not to scale). Frt: Flippase recognition target; TK: Thymidine Kinase. B: Southern blotting analysis of targeted ES clones. Restriction enzyme used for screening 5′ end recombination events was EcoRV. A 15.5-kb fragment in wild-type and a 7.9-kb fragment after homologous recombination were expected by the 5′ external probe. Restriction enzyme used for screening 3′ end recombination events was EcoRI. A 6.2-kb fragment in wild-type and a 7.6-kb fragment in targeted cells were expected by using the 3′ external probe. These probes are indicated in panel (A). C: Western blot analysis of Kif5b protein expression in different tissues in homozygous as well as heterozygous mice for the targeted Kif5b mutation. Actin was used as internal control. Assessment of conditional Kif5b inactivation in pancreatic β-cells of Kif5b:RIP2-Cre mice. A: Schematic illustration of Cre-mediated deletion of exon 2 from the Kif5b allele. B: Representative pictures show PCR analysis of the offspring genomic DNA from ear. To detect the presence of the floxed Kif5b allele, we used primer P1 5′-TGAAGGCTAAGTCAGATATGGATGC-3′ located upstream of loxP site and P3 5′-TTACTAACTGAACCTGGCTTCCTAG-3′ located downstream of loxP site. The presence of Kif5b knockout allele was detected by primer P1 5′-TGAAGGCTAAGTCAGATATGGATGC-3′ located in intron 1 and P2 5′-GGATTGGCACCTTTACCTAGAAGG-3′ located in intron 2 of the Kif5b gene. The RIP-Cre transgenic mice were identified by amplification of Cre allele using primer 5′-GGACATGTTCAGGGATCGCCAGGCG-3′ and 5′-GGCATGTTCAGGGATCGCCAGGCG-3′. The PCR bands of wild-type (215 bp), floxed (275 bp), null allele (219 bp), and Cre (250 bp) are indicated. Genotypes of representative litters are indicated. Kif5b was mainly expressed in pancreatic islets (endocrine portion) with little expression in exocrine acinar glands (Fig. 3A, left). The positive staining was absent after preincubating the anti-Kif5b antibody with the 18-aa synthesized peptides (Fig. 3A, right). To test the efficiency of RIP-2-Cre mediated pancreatic β-cell specific deletion of exon 2 of Kif5b allele, we examined the protein expression levels of Kif5a, Kif5b, and Kif5c in hypothalamus and isolated islets from both mutant and wild-type mice (Fig. 3B). Inactivation of Kif5b by Cre-induced ablation resulted in a reduction of Kif5b protein level in islets, whereas both Kif5a and Kif5c were not detectable in islets although they are highly expressed in hypothalamus, consistent with an earlier finding that their expression is neuronal specific (29). Although RIP2-Cre displayed a low level of expression in the hypothalamus (24), we could not detect significantly decreased Kif5b expression in the hypothalamus due to Cre expression. In contrast, Western blot results showed that Kif5b level in the isolated islets was reduced by at least 80% in mutant mice, compared with the wild-type. Considering the fact that RIP-2 Cre is only expressed in ∼80–90% of β-cells and that β-cells account for 75% of islet cells, the Western blot result indicated that Kif5b was absent in most β-cells in the mutant mice islets. The knockout efficiency was further demonstrated by immunohistochemistry analysis of Kif5b expression in pancreatic sections under identical conditions. A significant decrease of Kif5b expression was observed in the islets from mutant mice compared with those in wild-type mice (Fig. 3C). Taken together, these results suggested that RIP-2 Cre mediated ablation of exon 2 in Kif5b allele had efficiently occurred, leading to significantly reduced Kif5b expression in the islets of mutant mice.
FIG. 3.

A: Immunohistochemistry analysis of Kif5b expression in wild-type mice pancreas sections (left) and antibody specificity test (right). B: Western blot analysis of Kif5a/Kif5b/Kif5c expression in hypothalamus and isolated islets from mutant and control mice. C: Immunohistochemistry analysis of Kif5b expression level in islets from control (upper) and mutant mouse (lower). (A high-quality color representation of this figure is available in the online issue.)

A: Immunohistochemistry analysis of Kif5b expression in wild-type mice pancreas sections (left) and antibody specificity test (right). B: Western blot analysis of Kif5a/Kif5b/Kif5c expression in hypothalamus and isolated islets from mutant and control mice. C: Immunohistochemistry analysis of Kif5b expression level in islets from control (upper) and mutant mouse (lower). (A high-quality color representation of this figure is available in the online issue.)

Kif5b:RIP2-Cre mice have postnatal growth retardation.

Although there was no significant difference in body weight among newborn mice of different genotypes, the mutant mice had progressively reduced growth comparing to littermate controls after 3 weeks (Fig. 4A). Comparing the mice growth curves, the body weight differences between mutant and control littermates were significant (as shown in the representative photo in Fig. 4B) and there was no significant difference among wild-type and heterozygous controls (Fig. 4A).
FIG. 4.

Physiological features of Kif5b:RIP2-Cre mice. A: Growth curves of male mice, wild-type (triangle), heterozygous (square), and mutant (circle) mice (n = 6–12). B: Photograph of 8-week-old control (left) and mutant (right) male mice. C and D: Blood glucose concentrations of male mice with different ages in nonfasting (C) and 16-h fasted (D) wild-type, heterozygous, and mutant mice (n = 8–22). There is no significant difference of the body weight or blood glucose level between wild-type and heterozygous mice, but these values of mutant mice are significantly different from that of wild-type mice with the same ages. *P < 0.05, **P < 0.01. E and F: Plasma insulin levels in nonfasting (E) and 16-h fasted (F) wild-type (black bar), heterozygous (white bar), and mutant mice (striped bar) (n = 6 mice, 2- to 3-month-old). Different letters indicate statistical difference (P < 0.05). The plasma insulin levels in wild-type and heterozygous mice are not different from each other while they are statistically different from that of the mutant mice.

Physiological features of Kif5b:RIP2-Cre mice. A: Growth curves of male mice, wild-type (triangle), heterozygous (square), and mutant (circle) mice (n = 6–12). B: Photograph of 8-week-old control (left) and mutant (right) male mice. C and D: Blood glucose concentrations of male mice with different ages in nonfasting (C) and 16-h fasted (D) wild-type, heterozygous, and mutant mice (n = 8–22). There is no significant difference of the body weight or blood glucose level between wild-type and heterozygous mice, but these values of mutant mice are significantly different from that of wild-type mice with the same ages. *P < 0.05, **P < 0.01. E and F: Plasma insulin levels in nonfasting (E) and 16-h fasted (F) wild-type (black bar), heterozygous (white bar), and mutant mice (striped bar) (n = 6 mice, 2- to 3-month-old). Different letters indicate statistical difference (P < 0.05). The plasma insulin levels in wild-type and heterozygous mice are not different from each other while they are statistically different from that of the mutant mice.

Kif5b:RIP2-Cre mice develop diabetes due to insulin secretion defect.

To test the effect of Kif5b conditional knockout on glucose homeostasis, we first analyzed the blood glucose level as well as plasma insulin level in both mutant mice and littermate controls. Mutant mice had progressively increased hyperglycemia compared with control littermates in both random (Fig. 4C) and 16-h fasting conditions (Fig. 4D) within the investigated ages. Therefore, 2- to 3-month-old mice were selected for further study. Consistent with an elevated glucose level, mutant mice had lower plasma insulin concentrations in fasting conditions (Fig. 4F) but not in a random fed state (Fig. 4E). There were no significant differences in the blood glucose levels as well as plasma insulin concentrations between wild-type and heterozygous controls. We next assessed the impact of inactivation of Kif5b on glucose-regulated insulin secretion in vivo (Fig. 5A). The responses of 2- to 3-month-old mutant mice and control littermates to glucose challenge were examined by performing an intraperitoneal glucose tolerance test (GTT) after 16-h overnight fast. Kif5b:Cre mice showed slight glucose intolerance compared with wild-type mice, which may be due to Cre expression in β-cells (30) in addition to the ablation of one Kif5b allele. Comparison of the GTT responses between mutant mice and Kif5b:Cre mice showed that Kif5b conditional knockout mice had markedly impaired glucose tolerance and this intolerance was not a result of Cre expression. Although the mutant mice had hyperglycemia and glucose intolerance compared with wild-type and Kif5b:Cre mice, the blood glucose levels dropped to a similar level as control mice at 15 min after insulin injection (Fig. 5B).
FIG. 5.

Effect of Kif5b deletion on glucose metabolism. A: Intraperitoneal (i.p.) GTTs were performed on overnight-fasted wild-type (triangle), heterozygous (square), and mutant mice (circle). After overnight fasting, mice were injected with glucose (2 g/kg body wt i.p.) and blood glucose levels were monitored immediately before and 15, 30, 60, and 120 min after glucose injection (n = 5–6 mice per group, 2- to 3-month-old). Mutant mice exhibited reduced glucose tolerance compared with wild-type control, as revealed by significantly increased blood glucose concentrations at corresponding time points (*P < 0.05, **P < 0.01). The glucose tolerance ability was not significantly affected by half reduction of Kif5b expression, because there is no difference for the blood glucose level between control and heterozygous mice. B: Insulin sensitivity test was performed on random-fed mice (n = 5–8 mice per group, 2- to 3-month-old). Blood glucose level was measured at the time points indicated before and after intraperitoneal injection of human regular insulin (0.75 units/kg body wt). Although the blood glucose level is high in mutant mice before insulin administration, there is no difference of the glucose level after insulin intraperitoneal injection among the three genotype mice. C: GSIS was carried out on overnight-fasted mice as well as isolated islets. Glucose (3 g/kg) was administrated intraperitoneally to overnight (16-h) fasted mice (n = 5 mice per group, 2- to 3-month-old). Plasma insulin levels were measured at indicated time points. GSIS was significantly diminished by Kif5b knockout. D: In vitro GSIS was carried out on groups of 10 islets of similar sizes obtained from wild-type (black bar), heterozygous (white bar), and mutant (striped bar) mice and incubated in Krebs-Ringer bicarbonate buffer, supplemented with 10% FBS for 30 min with different glucose concentrations. Experiments were performed in duplicate, and insulin levels were determined by ELISA (n = 4–5 groups for each genotype). Significant decreases in GSIS were observed in mutant mice islets incubated at 5, 10, and 20 mmol/l glucose compared with wild-type mice at the same glucose concentration, and there was no difference between wild-type and heterozygous mice under any glucose concentration. E: Insulin release response to indicated concentrations of KCl treatment (n = 3–4 groups for each genotype). Mutant islets exhibit reduced insulin secretion under the stimulation of high concentration of K+. F: Islet insulin content from control (black bar) and mutant islets (white bar) (n = 5 mice per group). P values are indicated in the figure. *P < 0.05, **P < 0.01.

Effect of Kif5b deletion on glucose metabolism. A: Intraperitoneal (i.p.) GTTs were performed on overnight-fasted wild-type (triangle), heterozygous (square), and mutant mice (circle). After overnight fasting, mice were injected with glucose (2 g/kg body wt i.p.) and blood glucose levels were monitored immediately before and 15, 30, 60, and 120 min after glucose injection (n = 5–6 mice per group, 2- to 3-month-old). Mutant mice exhibited reduced glucose tolerance compared with wild-type control, as revealed by significantly increased blood glucose concentrations at corresponding time points (*P < 0.05, **P < 0.01). The glucose tolerance ability was not significantly affected by half reduction of Kif5b expression, because there is no difference for the blood glucose level between control and heterozygous mice. B: Insulin sensitivity test was performed on random-fed mice (n = 5–8 mice per group, 2- to 3-month-old). Blood glucose level was measured at the time points indicated before and after intraperitoneal injection of human regular insulin (0.75 units/kg body wt). Although the blood glucose level is high in mutant mice before insulin administration, there is no difference of the glucose level after insulin intraperitoneal injection among the three genotype mice. C: GSIS was carried out on overnight-fasted mice as well as isolated islets. Glucose (3 g/kg) was administrated intraperitoneally to overnight (16-h) fasted mice (n = 5 mice per group, 2- to 3-month-old). Plasma insulin levels were measured at indicated time points. GSIS was significantly diminished by Kif5b knockout. D: In vitro GSIS was carried out on groups of 10 islets of similar sizes obtained from wild-type (black bar), heterozygous (white bar), and mutant (striped bar) mice and incubated in Krebs-Ringer bicarbonate buffer, supplemented with 10% FBS for 30 min with different glucose concentrations. Experiments were performed in duplicate, and insulin levels were determined by ELISA (n = 4–5 groups for each genotype). Significant decreases in GSIS were observed in mutant mice islets incubated at 5, 10, and 20 mmol/l glucose compared with wild-type mice at the same glucose concentration, and there was no difference between wild-type and heterozygous mice under any glucose concentration. E: Insulin release response to indicated concentrations of KCl treatment (n = 3–4 groups for each genotype). Mutant islets exhibit reduced insulin secretion under the stimulation of high concentration of K+. F: Islet insulin content from control (black bar) and mutant islets (white bar) (n = 5 mice per group). P values are indicated in the figure. *P < 0.05, **P < 0.01. To evaluate the effect of Kif5b deletion on β-cell function, insulin secretion in response to high glucose challenge was examined in 2- to 3-month old mice (Fig. 5C). In wild-type mice, insulin secretion was increased by about twofold at 2.5 min after intraperitoneal injection of glucose, reaching a peak at about 5 min, and remained higher than base level for at least 1 h. Glucose tolerance and insulin release were slightly impaired in Kif5b:Cre mice compared with wild-type mice in the first 30 min after glucose injection, but the glucose and insulin levels were similar in both genotype mice by 60 min. However, both the early and slow phase of insulin secretion were impaired in Kif5b:Cre mice. These results indicated that glucose intolerance in Kif5b conditional knockout mice was not associated with insulin resistance (Fig. 5B) but was related to an insulin secretory defect in response to glucose challenge (Fig. 5C). It is possible that impaired insulin secretion could be secondary, particularly when considering the expression of Cre in hypothalamic or pituitary cells. To address this possibility, we studied GSIS in isolated islets from mice with different genotypes (Fig. 5D). As expected, mutant islets secreted significantly less insulin than control islets under glucose-stimulated conditions. No significant difference in insulin secretion was observed in the absence of glucose. Furthermore, the insulin-secretion defect was progressively enhanced in mutant islets with an increase in glucose concentration. A high level of KCl is known to trigger insulin secretion by inducing plasma membrane depolarization followed by Ca2+ influx (1). To further investigate the effect of Kif5b knockout on insulin secretion, KCl-stimulated insulin release from islets was analyzed by 30 mmol/l KCl treatment (Fig. 5E). The wild-type islets exhibited stronger secretory responses than mutant islets. To rule out the possibility that insulin is produced at a lower level in the mutant islet than in the wild-type, an immunostaining assay was carried out. The result demonstrated that the insulin level in mutant mouse was not less than that of wild-type control (Fig. 6A). A quantitative analysis of islet insulin content was carried out by ELISA to confirm the result. Results indicated that more insulin accumulated in mutant islets compared with wild-type, although the difference was not statistically significant (Fig. 5F). Taken together, it is most likely that the impaired insulin secretion in mutant mice is due to a primary defect in β-cell function.
FIG. 6.

Kif5b:RIP2-Cre mice had normal islet morphology, islet cell composition, and β-cell size. A slight increase in islet insulin content was observed. A: Immunofluorescence staining for insulin (green) and glucagon (red) in control (upper) and mutant mice (lower) (2- to 3-month-old). B: Statistical analysis of α- and β-cell ratio in control (black bar) and mutant (white bar) mice (n = 3 mice per group); immunofluorescent staining was carried out on two sections (>300 μm apart) for α-cell (red) and β-cell (green), and all islets on the sections were imaged. (A high-quality color representation of this figure is available in the online issue.)

Kif5b:RIP2-Cre mice had normal islet morphology, islet cell composition, and β-cell size. A slight increase in islet insulin content was observed. A: Immunofluorescence staining for insulin (green) and glucagon (red) in control (upper) and mutant mice (lower) (2- to 3-month-old). B: Statistical analysis of α- and β-cell ratio in control (black bar) and mutant (white bar) mice (n = 3 mice per group); immunofluorescent staining was carried out on two sections (>300 μm apart) for α-cell (red) and β-cell (green), and all islets on the sections were imaged. (A high-quality color representation of this figure is available in the online issue.)

Pancreas of Kif5b:RIP2-Cre mice display decreased islet size.

Islets from mutant mice showed similar cellular arrangements and compositions as wild-type mice, with the majority of cells being β-cells and with glucagon-positive α-cells in the periphery region (Fig. 6A). There were no significant differences of α- and β-cell ratio between mutant and wild-type islets (Fig. 6B). Because Kif5b has been reported to transport insulin vesicles in β-cell lines (MIN6 & INS-1) (18) and mitochondria in neurons (31), we further analyzed the distribution of these vesicles/organelles in mutant and wild-type β-cells by TEM studies (Fig. 7). Compared with the control, mitochondria in mutant β-cells were found to be more likely to cluster in the perinuclear region (Fig. 7A). Further quantitative analysis of the distribution of mitochondria in β-cells confirmed that 70% of mitochondria were closer to the nuclear membrane than to the plasma membrane after Kif5b knockout whereas mitochondria in wild-type β-cells were evenly distributed in the cells (Fig. 7B). This is consistent with earlier findings that Kif5b is involved in mitochondria translocation (32).
FIG. 7.

Ultrastructural insights in pancreatic β-cell based on TEM study. A: Representative TEM photos of β-cell from control (left) and mutant (right) mice. Nuclei (N) were located centrally in both cells. More mitochondria (arrows) were located near the nucleus in mutant β-cells. Insulin vesicles (arrowheads) were distributed evenly in both mutant and control cells. Scale bar = 2 μm. B: Statistical analysis of the distribution of mitochondria in β-cell. The x-axis represents the ratio of distances from mitochondria to nucleus and to cell membrane. A ratio <1 indicates that mitochondria are closer to the nucleus, whereas a ratio >1 indicates that mitochondria are closer to the plasma membrane. The y-axis represents the percentage of mitochondria in the indicated area. All mitochondria in β-cells are recorded. C: Number of insulin vesicles per 1 μm2 in β-cells. (Fifteen and 26 β-cells are randomly photographed for wild-type and mutant mice, respectively.) *P < 0.05, **P < 0.01.

Ultrastructural insights in pancreatic β-cell based on TEM study. A: Representative TEM photos of β-cell from control (left) and mutant (right) mice. Nuclei (N) were located centrally in both cells. More mitochondria (arrows) were located near the nucleus in mutant β-cells. Insulin vesicles (arrowheads) were distributed evenly in both mutant and control cells. Scale bar = 2 μm. B: Statistical analysis of the distribution of mitochondria in β-cell. The x-axis represents the ratio of distances from mitochondria to nucleus and to cell membrane. A ratio <1 indicates that mitochondria are closer to the nucleus, whereas a ratio >1 indicates that mitochondria are closer to the plasma membrane. The y-axis represents the percentage of mitochondria in the indicated area. All mitochondria in β-cells are recorded. C: Number of insulin vesicles per 1 μm2 in β-cells. (Fifteen and 26 β-cells are randomly photographed for wild-type and mutant mice, respectively.) *P < 0.05, **P < 0.01. The subcellular localization of insulin vesicles was then analyzed and found to not be affected significantly by the decreased Kif5b level. The cytoplasm of both wild-type and mutant β-cells were filled with insulin vesicles. Insulin vesicle numbers per square μm were determined by counting all insulin vesicles in randomly photographed β-cells (Fig. 7C). More insulin granules were found in Kif5b knockout β-cells compared with control cells. This phenomenon is consistent with the observation that insulin secretion by β-cells is affected. Interestingly, a number of small islets were observed in mutant mice as shown in the representative microphotographs in Figure 8A. Quantitation of the islet number and size confirmed that the average size of the islet in mutants was smaller than that of the wild-type mice (Fig. 8B). However, the total islet mass was not decreased in Kif5b deficient mice (Fig. 8C), concomitant with an increase of islet number (Fig. 8D). Histomorphometric analysis of the size and number of islets in these pancreatic specimens showed that the number of islets <4,000 μm2 was significantly increased in Kif5b conditional knockout mice. However, the number of islets >4,000 μm2 in mutant mice was comparable to that of wild-type control (Fig. 8E). No reduction of islet cell size was observed in Kif5b deficient mice (Fig. 8F); therefore, the major factor accounting for reduced islet size was reduced cell number in an islet. We analyzed islet cell proliferation rates in pancreatic sections obtained from 1-month-old mice by BrdU+ labeling. As shown in Figure 8G, islet cell proliferation was reduced by ∼50% relative to the wild-type control. There was no detectable increase in islet β-cell apoptotic rate based on TUNEL+ analysis (supplementary Fig. 1, available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-1078/DC1).
FIG. 8.

Kif5b:RIP2-Cre mice exhibited reduced islet size in pancreas. A: Representative microphotographs of pancreatic sections from a control (left) and a mutant mouse (right) stained by insulin antibody showed the presence of multiples of small islets. B: Statistical analysis of the average size of islets in pancreatic samples from control (black bar) and mutant mice (white bar) (all islets in ten whole sections [>300 μm apart] from three wild-type mice and mutant mice were photographed and analyzed). C: Total islet area expressed as the percentage of total pancreas area. D: Number of islets per 10 mm2 of total pancreatic area. E: Histomorphometric analysis of the size and number of islets in these pancreatic samples from control and mutant mice. F: Mean islet cell size in control and mutant mice. G: Frequency of BrdU+ staining nuclei in islets as the percentage of total islet nuclei (59 and 62 islets corresponding to three wild-type and three mutant mice, respectively, were imaged and counted). Scale bar = 200 μm. *P < 0.05. (A high-quality color representation of this figure is available in the online issue.)

Kif5b:RIP2-Cre mice exhibited reduced islet size in pancreas. A: Representative microphotographs of pancreatic sections from a control (left) and a mutant mouse (right) stained by insulin antibody showed the presence of multiples of small islets. B: Statistical analysis of the average size of islets in pancreatic samples from control (black bar) and mutant mice (white bar) (all islets in ten whole sections [>300 μm apart] from three wild-type mice and mutant mice were photographed and analyzed). C: Total islet area expressed as the percentage of total pancreas area. D: Number of islets per 10 mm2 of total pancreatic area. E: Histomorphometric analysis of the size and number of islets in these pancreatic samples from control and mutant mice. F: Mean islet cell size in control and mutant mice. G: Frequency of BrdU+ staining nuclei in islets as the percentage of total islet nuclei (59 and 62 islets corresponding to three wild-type and three mutant mice, respectively, were imaged and counted). Scale bar = 200 μm. *P < 0.05. (A high-quality color representation of this figure is available in the online issue.)

DISCUSSION

To study the role of Kinesin-1 in pancreatic β-cells in vivo, we have generated cell-specific Kif5b-insKO mice (Kif5b:RIP2-Cre) by crossing Kif5b mice with Kif5b+/−:RIP-Cre mice, in which Cre recombinase is expressed under the control of rat insulin gene promoter (RIP2). Although RIP2-Cre in pancreatic β-cells may have some effect on glucose tolerance in mice (30), this molecular genetic approach allows in vivo studies of specific gene function and could exclude possible side effects of in vitro introduction of anti-kinesin antibodies (33) and overexpression of dominant-negative-acting kinesin (18), which may interfere with biological processes such as endoplasmic reticulum stress. This in vivo study reveals that Kif5b plays an important role for β-cell function and development. Kif5b-insKO mice displayed significant glucose intolerance and insulin secretory defects. Change in β-cell function was not coupled with changes in islet cell size, islet morphology, and islet cell composition but was associated with a reduced islet size as a consequence of decreased β-cell proliferation rate. Kif5b-insKO mice exhibited growth retardation within the indicated period. Physiological examination found that Kif5b-insKO mice displayed hyperglycemia and decreased plasma insulin levels, together with significantly diminished glucose tolerance and defective insulin secretion, suggesting a role of Kif5b in β-cell function. Our results confirm that Kif5b is required for normal GSIS in an in vivo model. Hypoinsulinemia may account for the poor growth of Kif5b-insKO mice. However, RIP2-Cre expression in hypothalamus and pituitary (24,34) may also lead to the knockout of Kif5b in insulin-positive cells, although no significant reduction of Kif5b level due to Cre expression was observed in hypothalamic lysates of Kif5b-insKO mice. The functions of Kif5b in hypothalamic and pituitary endocrine hormone secretion are unknown at the current stage. Therefore, we cannot rule out the possibility that the observed poor growth is also related to reduced growth hormone and/or insulin-like growth factor secretion. In vitro studies showed that suppression of Kif5b by overexpression of dominant-negative-acting Kif5b inhibited only the sustained phase of GSIS in clonal β-cells (18). Interestingly, our in vivo GTT results (Fig. 5A and C) indicated that the defective insulin response to glucose in a Kif5b-insKO mouse occurred in both the early phase and the slow phase. The early phase of insulin secretion is accompanied by Ca2+ influx induced exocytosis (1), which requires the metabolism of glucose to create ATP in mitochondria, leading to depolarization of the cell due to the closing of ATP-gated potassium channels. Kif5b and Kif5c have been reported to bind to RanBP2 to determine mitochondria localization and function in neurons (31). In the current study, we found that mitochondria significantly accumulate at the perinuclear region in the β-cell of Kif5b-insKO mice. Although disruption of Kif5b in extraembryonic cells upregulated the mRNA expression level of Kif5a and Kif5c (32), there is no apparent upregulation of Kif5a/Kif5c at the protein level in mutant β-cells, indicating that Kif5b is the major motor responsible for the dispersion of mitochondria in pancreatic β-cells. The deficiency of mitochondria at the cell peripheral regions may attenuate glucose-to-ATP conversion and partially account for the defect in the early phase of GSIS in response to glucose challenge. To examine whether blocked Kif5b-mediated insulin vesicle transportation in Kif5b-insKO mice may lead to a decrease in predocked vesicles ready for exocytosis, we also performed TEM studies. However, we observed no significant differences in the number and size of predocked insulin vesicles in Kif5b-insKO mice compared with control mice at the resolution used. Bi et al. (33) observed that KHC (or Kif5b) antibody SUK4 as well as the stalk-tail fragment of KHC specifically inhibited Ca2+-regulated exocytosis in Lytechinus pictus sea urchins. Therefore, exocytosis of insulin vesicles could also be affected in the Kif5b knockout islet. In neurons, it was demonstrated that Kif5b can directly bind to syntabulin and SNAP25 to mediate transportation of syntaxin containing vesicles and synaptosome (35,36). Syntaxin and SNAP25 constitute the t-SNAREs at the plasma membrane and are functionally required for Ca2+-triggered insulin exocytosis in β-cells (37). Snap25 mutant mice had impaired insulin granule priming, exocytosis, and recycling in pancreatic β-cells (38). It is possible that knockout of Kif5b in pancreatic β-cells affects the normal distribution and function of the SNARE complex, thereby leading to defects in insulin granule exocytosis. Furthermore, Kif5b functions in several cellular processes including lysosomal distribution and stability in cancer cells and extraembryonic cells (32,39), endoplasmic reticulum to Golgi transportation in Hela cells (40), transportation and axonal targeting of Kv1 channels (41), axonal transport of tubulin heterodimer for microtubule polymerization (42) as well as ribosome translocation (43), etc. Similar cellular functions of Kif5b could occur in pancreatic β-cells. It is tempting to speculate that weakening of both the early and slow phases of insulin response to glucose in Kif5b-insKO mice results from defects in a series of cellular functions after knockout of Kif5b in pancreatic β-cells. Taken together, Kif5b probably exerts a modulatory effect in regulating insulin granule priming and exocytosis in addition to mechanically transporting insulin vesicles. Furthermore, impaired early insulin response is consistent with a defect in glucose tolerance, because the early response is more important for glucose disposal (44). Insulin secretion defects result in a positive feedback for the synthesis of insulin in β-cells, thereby leading to accumulation of insulin in Kif5b-insKO mice islets. Donelan et al. (45) reported that increased [Ca2+] can activate calcineurin in β-granules leading to dephosphorylation of KHC, which is required for transport of β-granules from the storage pool to replenish the readily releasable pool of β-granules. Rab3A is mainly located on the cytosolic face of β-granule membranes. The Rab3A–calmodulin interaction on β-granules is required for activation of calcineurin and dephosphorylation of KHC (46). Yaekura et al. (47) found that knockout of Rab3A in pancreatic β-cells leads to blunted first-phase glucose induced insulin release in vitro and in vivo. Our results together with these studies indicate that any defect of synthesis or dephosphorylation process of KHC can lead to impaired insulin exocytosis. On the basis of histomorphological investigations, we found a notable increase in the number of small islets in Kif5b-insKO mice (Fig. 8A and E). BrdU+ staining of 1-month-old mice confirmed that the decreased islet size in Kif5b-inskO mice was due to a defect in islet cell proliferation (Fig. 8G). Furthermore, decreased cell proliferation rate was also observed in Kif5b deficient Madin-Darby canine kidney cells (supplementary Fig. 2, available in an online appendix), suggesting that Kif5b plays a conventional role during cell division. Zhu et al. (48) systematically analyzed the functions of all human kinesin/dynein microtubule motor proteins by RNA interference and identified at least 12 human kinesins involved in HeLa cell division. Recently, Haraguchi et al. (49) found that the kinesin-2 complex (KIF3A/3B) is localized with components of the mitotic apparatus such as spindle microtubules and centrosomes and plays an important role not only in interphase but also in mitosis. Both Kif5b and KIF3A/B are microtubule plus end-directed motors for membrane organelle transportation. Therefore, it is of considerable interest to determine whether Kif5b has a similar function or another unique function during cell division. One seemingly contradictory result found in this study was that islet mass was not affected (Fig. 8C) even though β-cell proliferation was inhibited in the Kif5b deficiency mice. Further analysis of the pancreatic sections found that islet number was significantly increased (Fig. 8D). Therefore, it is possible that the impaired β-cell function in Kif5b-insKO mice induce β-cell neogenesis to provide a compensatory effect, a process difficult to be defined and more difficult to be quantified at the molecular level (25,50). In summary, by using Kif5b conditional knockout mice, we have demonstrated that Kif5b is essential in the maintenance of normal β-cell function. Kif5b ablation leads to decreased insulin secretion and diminished glucose tolerance with decreased islet size in the pancreas. Our results indicate that genetic or epigenetic alteration in Kinesin-1 or other related motor proteins may inherit a predisposition to develop diabetes.
  49 in total

Review 1.  Beta-granule transport and exocytosis.

Authors:  R A Easom
Journal:  Semin Cell Dev Biol       Date:  2000-08       Impact factor: 7.727

2.  A low-affinity Ca2+-dependent association of calmodulin with the Rab3A effector domain inversely correlates with insulin exocytosis.

Authors:  H Kajio; S Olszewski; P J Rosner; M J Donelan; K F Geoghegan; C J Rhodes
Journal:  Diabetes       Date:  2001-09       Impact factor: 9.461

3.  The identification, purification, and characterization of a pancreatic beta-cell form of the microtubule adenosine triphosphatase kinesin.

Authors:  R Balczon; K A Overstreet; R P Zinkowski; A Haynes; M Appel
Journal:  Endocrinology       Date:  1992-07       Impact factor: 4.736

Review 4.  The importance of first-phase insulin secretion: implications for the therapy of type 2 diabetes mellitus.

Authors:  S Del Prato; A Tiengo
Journal:  Diabetes Metab Res Rev       Date:  2001 May-Jun       Impact factor: 4.876

5.  KIF5C, a novel neuronal kinesin enriched in motor neurons.

Authors:  Y Kanai; Y Okada; Y Tanaka; A Harada; S Terada; N Hirokawa
Journal:  J Neurosci       Date:  2000-09-01       Impact factor: 6.167

6.  Targeted inactivation of hepatocyte growth factor receptor c-met in beta-cells leads to defective insulin secretion and GLUT-2 downregulation without alteration of beta-cell mass.

Authors:  Jennifer Roccisana; Vasumathi Reddy; Rupangi C Vasavada; Jose A Gonzalez-Pertusa; Mark A Magnuson; Adolfo Garcia-Ocaña
Journal:  Diabetes       Date:  2005-07       Impact factor: 9.461

7.  Evidence that the head of kinesin is sufficient for force generation and motility in vitro.

Authors:  J T Yang; W M Saxton; R J Stewart; E C Raff; L S Goldstein
Journal:  Science       Date:  1990-07-06       Impact factor: 47.728

8.  Role of kinesin light chain-2 of kinesin-1 in the traffic of Na,K-ATPase-containing vesicles in alveolar epithelial cells.

Authors:  Humberto E Trejo; Emilia Lecuona; Doris Grillo; Igal Szleifer; Oksana E Nekrasova; Vladimir I Gelfand; Jacob I Sznajder
Journal:  FASEB J       Date:  2009-09-22       Impact factor: 5.191

9.  The ribosome receptor, p180, interacts with kinesin heavy chain, KIF5B.

Authors:  Russell J Diefenbach; Eve Diefenbach; Mark W Douglas; Anthony L Cunningham
Journal:  Biochem Biophys Res Commun       Date:  2004-07-02       Impact factor: 3.575

10.  Kinesin-1 (uKHC/KIF5B) is required for bidirectional motility of ER exit sites and efficient ER-to-Golgi transport.

Authors:  Vijay Gupta; Krysten J Palmer; Peter Spence; Andrew Hudson; David J Stephens
Journal:  Traffic       Date:  2008-08-09       Impact factor: 6.215

View more
  25 in total

1.  Microtubule motor transport in the delivery of melanosomes to the actin-rich apical domain of the retinal pigment epithelium.

Authors:  Mei Jiang; Antonio E Paniagua; Stefanie Volland; Hongxing Wang; Adarsh Balaji; David G Li; Vanda S Lopes; Barry L Burgess; David S Williams
Journal:  J Cell Sci       Date:  2020-08-04       Impact factor: 5.285

2.  Multimodal nonlinear optical microscopy reveals critical role of kinesin-1 in cartilage development.

Authors:  Sicong He; Wenqian Xue; Zhigang Duan; Qiqi Sun; Xuesong Li; Huiyan Gan; Jiandong Huang; Jianan Y Qu
Journal:  Biomed Opt Express       Date:  2017-02-23       Impact factor: 3.732

3.  Specific depletion of the motor protein KIF5B leads to deficits in dendritic transport, synaptic plasticity and memory.

Authors:  Junjun Zhao; Albert Hiu Ka Fok; Ruolin Fan; Pui-Yi Kwan; Hei-Lok Chan; Louisa Hoi-Ying Lo; Ying-Shing Chan; Wing-Ho Yung; Jiandong Huang; Cora Sau Wan Lai; Kwok-On Lai
Journal:  Elife       Date:  2020-01-21       Impact factor: 8.140

4.  Stable kinesin and dynein assemblies drive the axonal transport of mammalian prion protein vesicles.

Authors:  Sandra E Encalada; Lukasz Szpankowski; Chun-hong Xia; Lawrence S B Goldstein
Journal:  Cell       Date:  2011-02-18       Impact factor: 41.582

5.  Microtubules Negatively Regulate Insulin Secretion in Pancreatic β Cells.

Authors:  Xiaodong Zhu; Ruiying Hu; Marcela Brissova; Roland W Stein; Alvin C Powers; Guoqiang Gu; Irina Kaverina
Journal:  Dev Cell       Date:  2015-09-28       Impact factor: 12.270

6.  Dynamin 2 regulates biphasic insulin secretion and plasma glucose homeostasis.

Authors:  Fan Fan; Chen Ji; Yumei Wu; Shawn M Ferguson; Natalia Tamarina; Louis H Philipson; Xuelin Lou
Journal:  J Clin Invest       Date:  2015-09-28       Impact factor: 14.808

7.  Glucose Regulates Microtubule Disassembly and the Dose of Insulin Secretion via Tau Phosphorylation.

Authors:  Kung-Hsien Ho; Xiaodun Yang; Anna B Osipovich; Over Cabrera; Mansuo L Hayashi; Mark A Magnuson; Guoqiang Gu; Irina Kaverina
Journal:  Diabetes       Date:  2020-06-15       Impact factor: 9.461

Review 8.  Alzheimer's Disease and Diabetes: Insulin Signaling as the Bridge Linking Two Pathologies.

Authors:  Jonathan Chang-Cheng Shieh; Pai-Tsang Huang; Yung-Feng Lin
Journal:  Mol Neurobiol       Date:  2020-01-03       Impact factor: 5.590

9.  Terminal transport of lytic granules to the immune synapse is mediated by the kinesin-1/Slp3/Rab27a complex.

Authors:  Geneviève de Saint Basile; Gaël Ménasché; Mathieu Kurowska; Nicolas Goudin; Nadine T Nehme; Magali Court; Jérôme Garin; Alain Fischer
Journal:  Blood       Date:  2012-02-03       Impact factor: 22.113

10.  Microtubules and Gαo-signaling modulate the preferential secretion of young insulin secretory granules in islet β cells via independent pathways.

Authors:  Ruiying Hu; Xiaodong Zhu; Mingyang Yuan; Kung-Hsien Ho; Irina Kaverina; Guoqiang Gu
Journal:  PLoS One       Date:  2021-07-22       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.