Literature DB >> 20831802

Molecular characterization of partial-open reading frames 1a and 2 of the human astroviruses in South Korea.

Jae In Lee1, Gyu-Cheol Lee, Young Hee Oh, Young Ki Lee, Min Young Kim, Chan Hee Lee.   

Abstract

Human astroviruses (HAstVs) are among the major causes of gastroenteritis in South Korea. In this study, the partial regions of the open reading frame (ORF) 1a and ORF2 genes of HAstVs from gastroenteritis patients in nine hospitals were sequenced, and the molecular characterization of the viruses was revealed. 89 partial nucleotide sequences of ORF1a and 88 partial nucleotide sequences of ORF2 were amplified from 120 stool specimens. Phylogenetic analysis showed that most of the nucleotide sequences of ORF1a and ORF2 were grouped with HAstV type 1 but had evolutionary genetic distance compared with the reference sequences, such as the HAstV-1 prototype, Dresden strain, and Oxford strain. According to the phylogenetic analysis, some nucleotide sequences including SE0506041, SE0506043, and SE0506058, showed the discrepancy of the genotypes, but there was no proof of recombination among the HAstV types. In conclusion, this study showed that the dominant HAstV isolated from the Seoul metropolitan area in 2004-2005 was HAstV type 1, and that Korean HAstV-1 had the genetic distance in evolution compared with the reference sequences of HAstVs. Lots of nucleotide sequences of the ORF1a and ORF2 genes of HAstV will be useful for studying for the control and prevention of HAstV gastroenteritis in South Korea.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20831802      PMCID: PMC2944169          DOI: 10.1186/1743-422X-7-221

Source DB:  PubMed          Journal:  Virol J        ISSN: 1743-422X            Impact factor:   4.099


Findings

Astroviruses (AstVs), belong to the Astroviridae family, are non-enveloped, single-stranded, and positive-sense RNA viruses [1]. Their genomes have both 5' and 3' non-translated regions, and contain three open reading frames (ORFs), denoted as ORF1a, ORF1b, and ORF2, which encode a serine protease, an RNA-dependent RNA polymerase, and a structural protein, respectively [1,2]. AstVs are known to infect humans as well as a variety of mammalian and avian species [3-5]. In humans, eight serotypes have been described, which have been associated with up to ~10% sporadic cases of nonbacterial diarrhea in children [6-10] and 0.5-15% outbreaks [11-13]. Walter et al. (2001) analyzed the gene of AstVs and found that the ORF2 region belonged to human AstV (HAstv)-5 whereas the ORF1b region belonged to HAstV-3, and that recombination occurred between the HAstV types [14]. Besides, in some other studies, recombination was found to occur between mamastroviruses and HAstV [15]. Such recombination may result in a new epidemic HAstV because it is similar to antigen drift of influenza viruses [16-19]. Therefore, characterization of HAstVs genome is important to understand the recombination between human and mammalian AstVs, the origin of the viruses, and their molecular evolution, as well as the phylogenetic relationship among the HAstV genotypes. For this purpose, there is a need to obtain more complete genome sequences of HAstV. The complete genome sequences of seven genotypes (HAstV-1, 2, 3, 4, 5, 6, and 8) and the HAstV-7 ORF2 sequence are available [18,20-23]. In this study, the partial nucleotide sequences of ORF1a and ORF2 of HAstVs, responsible for sporadic gastroenteritis in South Korea, were obtained, and their molecular characteristics were investigated. From 2004 to 2005, stool specimens of patients suspected to have acute gastroenteritis were provided by nine hospitals located in the Seoul metropolitan area. 1 g of a stool specimen was added into 9 mL phosphate-buffered saline solution, and three or four 3-mm glass beads were added. The mixture was vigorously shaken via vortexing and was centrifuged at 4°C and 3000 rpm for 30 min. The 200 μL of 10% stool suspension was used for extracting RNA via the Tri-reagent method [24] and the extracted viral RNA was used for RT-PCR. The Mon340 and Mon348 primers were used for the amplification of the ORF1a region, and the Mon269 and Mon270 primers for the amplification of ORF2 (Table 1). For the synthesis of cDNA, 8 μL dNTP, 5 μL 5X buffer, 2.5 μL 10 pmole Mon348 or Mon270, 0.5 μL RNase inhibitor (Promega, Madison, WI), 0.5 μL MMLV reverse transcriptase (Promega), and 3.5 μL diethyl pyrocarbonate (DEPC) treated water and 5 μL RNA extract were added. The reaction conditions for the synthesis of cDNA were 42°C/60 min, 95°C/5 min, and 4°C soaking. For PCR, synthesized 5 μL cDNA was added to 6 μL dNTP, 5 μL 10× PCR buffer, each of the 2.5 μL 10 pmole primers, 0.5 μL exTaq polymerase (TaKaRa, Otsu, Shiga, Japan), and 28.5 μL DEPC treated water. The PCR conditions for ORF1a were 94°C/3 min, 94°C/30 sec, 50°C/20 sec, and 72°C/30 sec, 30 cycles, 72°C/5 min, and for ORF2, 94°C/3 min, 94°C/30 sec, 50°C/30 sec, and 72°C/1 min, 35 cycles, and 72°C/5 min. The amplified gene products were observed in 1.2% agarose gel. The PCR products were purified using a PCR purification kit (SolGent Co., Daejeon, South Korea) and were sequenced using ABI 3730XL DNA Analyzer (Applied Biosystems, Carlsbad, CA).
Table 1

Primers used for the detection of human astroviruses

PrimersPosition*Sequence (5'→3')Size(bp)References
Mon3401182-1203CGTCATTATTTGTTGTCATACT289[26]
Mon3481450-1470ACATGTGCTGCTGTTACTATG

Mon2694526-4545CAACTCAGGAAACAGGGTGT449[24]
Mon2704955-4974TCAGATGCATTGTCATTGGT

The nucleotide numbering is based on the sequences of human astrovirus type 1 (GenBank accession number: Z25771).

Primers used for the detection of human astroviruses The nucleotide numbering is based on the sequences of human astrovirus type 1 (GenBank accession number: Z25771). Multiple alignment and phylogenetic analysis were conducted using the ClustalX program and the PHYLIP package. For the distance matrix between the DNA sequences, the Dnadist program was used, and a phylogenetic tree was constructed using the neighbor-joining (NJ) method in the Neighbor program. In 89 of the 120 AstV specimens isolated from 2004 to 2005, the nucleotide sequence of the partial ORF1a amplicon amplified. The phylogenetic analysis results showed the nucleotide sequence of most of the partial ORF1as to be HAstV-1, and three isolates (SE0512016, SE0410092, and SE0512003) were grouped with the HAStV-1 Dresden strain (Fig. 1). The 73 HAstV-1 isolates were diverged earlier from sheep AstV, an outgroup, and were distant from the group to which the HAstV-1 prototype belonged, whereas the HAstV-1 prototype and the Oxford and KS106211 strains that were isolated in South Korea were grouped together (AF361036) [25] (Fig. 1). SE0506043 was placed between HAstV-1 and HAstV-5, and the phylogenetic branch diverged from HAstV-5 to the phylogenies of HAstV-2,4 (Goiania strain) and 3,1 (Dresden strain) and to the phylogeny of HAstV-8,4 (Guangzhou strain). SE0406224, SE0501018, SE0501089, SE0405158, and SE0506064 isolates diverged earlier and grouped together, keeping a distance from all the ten references. SE0412021 and SE0504004 were distant from all the references for which the nucleotide sequence of ORF1a was available (Fig. 1). SE0406038, SE0406213, SE0409205, SE0506041, and SE0506058 grouped with the HAstV-4 Guangzhou strain (Fig. 1). In case of ORF2, the 88 nucleotide sequences were analyzed and the phylogenetic tree was constructed. The HAstV-1 prototype, the Oxford strain, and the Dresden strain clustered, unlike in the case of ORF1, and the HAstV-4 Goiania, Dresden, and Guangzhou strains clustered in the same group (Fig. 2). In the nucleotide sequence of the ORF2 of the sheep AstV, which was closest to HAstV among the animal AstVs, HAstV-4 and 8 diverged earliest, followed by HAstV-3, 5, 7, 2, and 6 (Fig. 2). 75 partial ORF2 sequences were grouped in the place that diverged earlier than the HAstV-1 prototype, and the SE0405158 and SE0506064 isolates were in between the HAstV-1 Dresden isolates and the Oxford isolate whereas SE0512003, SE0512016, and SE0410092 belonged to the HAstV-1 Dresden isolate (Fig. 2). SE0501018, SE0501089, and SE0406224 grouped in the HAstV-8 reference, and SE0406038 and SE0406213 grouped in the HAstV-4 Guangzhou strain (Fig. 2). The SE0504004, SE0412021, and SE0501110 isolates grouped in HAstV-6, and no isolates grouped in HAstV-2, 3, 5, and 7.
Figure 1

Phylogenetic tree based on the partial sequences of open reading frame 1a amplified by the Mon340/348 primer pair. The outgroup, the partial-open reading frame 1a nucleotide sequence of the sheep astrovirus, was selected from the nucleotide sequence of sheep astrovirus (GenBank accession number, Y15937).

Figure 2

Phylogenetic tree based on the partial sequences of open reading frame 2 amplified by the Mon269/270 primer pair. The outgroup, the partial-open reading frame 2 nucleotide sequence of the sheep astrovirus, was selected from the nucleotide sequence of sheep astrovirus (GenBank accession number, Y15937).

Phylogenetic tree based on the partial sequences of open reading frame 1a amplified by the Mon340/348 primer pair. The outgroup, the partial-open reading frame 1a nucleotide sequence of the sheep astrovirus, was selected from the nucleotide sequence of sheep astrovirus (GenBank accession number, Y15937). Phylogenetic tree based on the partial sequences of open reading frame 2 amplified by the Mon269/270 primer pair. The outgroup, the partial-open reading frame 2 nucleotide sequence of the sheep astrovirus, was selected from the nucleotide sequence of sheep astrovirus (GenBank accession number, Y15937). For most of the isolates, all the nucleotide sequences of ORF1a and ORF2 belonged to HAstV-1 and were slightly distant from the references (the prototype and the Dresden and Oxford strains). The isolates, however, grouped together, with a high similarity between them. This indicates that the AstVs circulating in the Seoul metropolitan area were HAstV-1 and had the difference evolutionary course from the HAstV-1 circulating abroad. In several isolates, the genotypes of ORF1a and ORF2 did not coincide with each other. SE0506041 and SE0506058, however, which grouped in the HAstV-4 Guangzhou isolates in the analysis of the partial ORF1a, grouped in HAstV-1 in the analysis of the partial ORF2. In addition, SE0506043, which was in between HAstV-1 and HAstV-5 in the analysis of ORF1a, was closer to the prototype than HAstV-1 was. SE0406224, SE050018, and SE0501089, which were in between HAstV-8 and HAstV-1 in the analysis of ORF1a, grouped in places closer to HAstV-8 in the analysis of ORF2, and SE0405158 and SE0506064 were found to be HAstV-1, which was in between the HAstV-1 prototype and the Dresden strain. Studies on the relation between the serotypes of HAstVs based on the base sequence of 300 nucleotides showed that there was a difference in genotypes between three ORFs [26]. Belliot et al. (1997) suggested that HAstV can be grouped into two genogroups, HAstV-1~-5 and HAstV-6~-7, based on ORF1a [25] and this was later supported by other studies [27,28]. In this study, all the references and isolates, excluding SE0504004, SE0510110, and SE0412021, also formed a large genogroup in the analysis of the partial ORF1a (Fig. 1). In contrast, Belliot et al. (1997) reported that such genotype was not found in their analysis of ORF1b and ORF2, and that HAstV could be classified into four clusters (HAstV-1; HAstV-6 and 2; HAstV-3, 4, and 8; and HAstV-5 and 7) in the analysis of the ORF2 partial sequence [26]. It has been reported, however, that in the analysis of a phylogenetic tree based on the full ORF2 amino acid sequence, three clusters (HastV-1, 7, and 3; HAstV-5 and 6; and HAstV-4 and 8) were found, and HAstV-2 was closer to the third cluster than to the other clusters [29]. In the analysis of the ORF2 partial sequences in this study, HAstV was classified into four clusters, as in the study by Belliot (1997) [26]. In the analysis of a phylogenetic tree based on the whole ORF2 sequence, however, HAstV could be classified into only three clusters, as in the study by Wang et al. (2001) [29]. Even if the genotype is well related with the serotype according to the partial sequence, a phylogenetic tree based on such relation may reflect a wrong phylogeny. Thus, it is considered that the evolutionary phylogeny of an AstV can be more accurately identified by a phylogenetic tree based on the whole base sequence of each gene. Although some studies asserted that the genotype discrepancy between the HAstV genes that occurred in their studies was due to the genetic recombinations between different serotypes [14,26], no proof of such recombination was found in any isolate that showed a discrepancy in genotypes. Although the mechanism of HAstVs' variations is not yet clear, the genetic variations by recombinations among HAsVs' types may evoke the appearance of new epidemic HAstVs, such as the influenza viruses, by antigenic drift.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

JIL, MYK and CHL conceived this study. JIL, YHO and YKL designed and conducted the experiments. JIL and GCL analyzed the sequence data and carried out the molecular phylogenetic analysis. JIL, GCL and CHL wrote the manuscript. All authors read and approved the final manuscript.
  28 in total

1.  Diarrhea etiology in a Children's Hospital Emergency Department: a prospective cohort study.

Authors:  Eileen J Klein; Daniel R Boster; Jennifer R Stapp; Joy G Wells; Xuan Qin; Carla R Clausen; David L Swerdlow; Christopher R Braden; Phillip I Tarr
Journal:  Clin Infect Dis       Date:  2006-08-22       Impact factor: 9.079

2.  Detection of sporadic cases of Norovirus infection in hospitalized children in Italy.

Authors:  Sonia Caracciolo; Chiara Minini; Domenico Colombrita; Ida Foresti; Manuela Avolio; Giorgio Tosti; Simona Fiorentini; Arnaldo Caruso
Journal:  New Microbiol       Date:  2007-01       Impact factor: 2.479

Review 3.  The changing epidemiology of astrovirus-associated gastroenteritis: a review.

Authors:  R I Glass; J Noel; D Mitchell; J E Herrmann; N R Blacklow; L K Pickering; P Dennehy; G Ruiz-Palacios; M L de Guerrero; S S Monroe
Journal:  Arch Virol Suppl       Date:  1996

4.  Typing of human astroviruses from clinical isolates by enzyme immunoassay and nucleotide sequencing.

Authors:  J S Noel; T W Lee; J B Kurtz; R I Glass; S S Monroe
Journal:  J Clin Microbiol       Date:  1995-04       Impact factor: 5.948

5.  Existence of multiple outbreaks of viral gastroenteritis among infants in a day care center in Japan.

Authors:  S Akihara; T G Phan; T A Nguyen; G Hansman; S Okitsu; H Ushijima
Journal:  Arch Virol       Date:  2005-04-21       Impact factor: 2.574

6.  Molecular characterization of human astroviruses isolated in Brazil, including the complete sequences of astrovirus genotypes 4 and 5.

Authors:  P A Silva; D D P Cardoso; E Schreier
Journal:  Arch Virol       Date:  2006-01-19       Impact factor: 2.574

7.  Prevalence of human astrovirus genotypes associated with acute gastroenteritis among children in Belém, Brazil.

Authors:  Yvone B Gabbay; Alexandre C Linhares; Elielma L Cavalcante-Pepino; Liliany S Nakamura; Darleise S Oliveira; Luciana Damascena da Silva; Joana D'Arc P Mascarenhas; Consuelo S Oliveira; Talita Antônia F Monteiro; José Paulo G Leite
Journal:  J Med Virol       Date:  2007-05       Impact factor: 2.327

8.  Detection and genetic differentiation of human astroviruses: phylogenetic grouping varies by coding region.

Authors:  G Belliot; H Laveran; S S Monroe
Journal:  Arch Virol       Date:  1997       Impact factor: 2.574

9.  A 5-year study of the prevalence and genetic diversity of human caliciviruses associated with sporadic cases of acute gastroenteritis in young children admitted to hospital in Melbourne, Australia (1998-2002).

Authors:  Carl D Kirkwood; Ruth Clark; Nada Bogdanovic-Sakran; Ruth F Bishop
Journal:  J Med Virol       Date:  2005-09       Impact factor: 2.327

10.  Etiological role of viruses in outbreaks of acute gastroenteritis in The Netherlands from 1994 through 2005.

Authors:  Sanela Svraka; Erwin Duizer; Harry Vennema; Erwin de Bruin; Bas van der Veer; Bram Dorresteijn; Marion Koopmans
Journal:  J Clin Microbiol       Date:  2007-03-14       Impact factor: 5.948

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.