| Literature DB >> 20831802 |
Jae In Lee1, Gyu-Cheol Lee, Young Hee Oh, Young Ki Lee, Min Young Kim, Chan Hee Lee.
Abstract
Human astroviruses (HAstVs) are among the major causes of gastroenteritis in South Korea. In this study, the partial regions of the open reading frame (ORF) 1a and ORF2 genes of HAstVs from gastroenteritis patients in nine hospitals were sequenced, and the molecular characterization of the viruses was revealed. 89 partial nucleotide sequences of ORF1a and 88 partial nucleotide sequences of ORF2 were amplified from 120 stool specimens. Phylogenetic analysis showed that most of the nucleotide sequences of ORF1a and ORF2 were grouped with HAstV type 1 but had evolutionary genetic distance compared with the reference sequences, such as the HAstV-1 prototype, Dresden strain, and Oxford strain. According to the phylogenetic analysis, some nucleotide sequences including SE0506041, SE0506043, and SE0506058, showed the discrepancy of the genotypes, but there was no proof of recombination among the HAstV types. In conclusion, this study showed that the dominant HAstV isolated from the Seoul metropolitan area in 2004-2005 was HAstV type 1, and that Korean HAstV-1 had the genetic distance in evolution compared with the reference sequences of HAstVs. Lots of nucleotide sequences of the ORF1a and ORF2 genes of HAstV will be useful for studying for the control and prevention of HAstV gastroenteritis in South Korea.Entities:
Mesh:
Substances:
Year: 2010 PMID: 20831802 PMCID: PMC2944169 DOI: 10.1186/1743-422X-7-221
Source DB: PubMed Journal: Virol J ISSN: 1743-422X Impact factor: 4.099
Primers used for the detection of human astroviruses
| Primers | Position* | Sequence (5'→3') | Size | References |
|---|---|---|---|---|
| Mon340 | 1182-1203 | CGTCATTATTTGTTGTCATACT | 289 | [ |
| Mon348 | 1450-1470 | ACATGTGCTGCTGTTACTATG | ||
| Mon269 | 4526-4545 | CAACTCAGGAAACAGGGTGT | 449 | [ |
| Mon270 | 4955-4974 | TCAGATGCATTGTCATTGGT | ||
The nucleotide numbering is based on the sequences of human astrovirus type 1 (GenBank accession number: Z25771).
Figure 1Phylogenetic tree based on the partial sequences of open reading frame 1a amplified by the Mon340/348 primer pair. The outgroup, the partial-open reading frame 1a nucleotide sequence of the sheep astrovirus, was selected from the nucleotide sequence of sheep astrovirus (GenBank accession number, Y15937).
Figure 2Phylogenetic tree based on the partial sequences of open reading frame 2 amplified by the Mon269/270 primer pair. The outgroup, the partial-open reading frame 2 nucleotide sequence of the sheep astrovirus, was selected from the nucleotide sequence of sheep astrovirus (GenBank accession number, Y15937).