| Literature DB >> 20811907 |
Gursah Kats-Ugurlu1, Marije Hogeveen, Ann Driessen, Ans M W van den Ouweland, Christina Hulsbergen-van de Kaa.
Abstract
Alpha-1-antitrypsin (AAT) deficiency is a rare genetic disorder characterized by hepatitis in neonates, childhood and adulthood (protease inhibitor (PI)*ZZ) and emphysema with or without hepatitis (PI*ZZ)/(PI*SS,SZ or null) in adulthood. We report the case of a female neonate born at 40 weeks of gestation who presented with vitamin K deficiency-related intracranial bleeding and cholestasis of which she died at 28 days of age. At autopsy, the infant was found to have intracranial bleeding, hepatomegaly, and cholestasis with paucity of bile ducts in the liver. Small periodic acid-Schiff diastase positive intrahepatic granules and positive staining with antibodies against AAT protein suggested an AAT deficiency. AAT is a glycoprotein that has a protease inhibitor function. Its deficiency can be the result of various point mutations in Serpin 1 located on chromosome 14. The diagnosis AAT deficiency was confirmed by mutation analysis showing the PI*ZZ genotype in the neonate. In conclusion, AAT deficiency is a rare genetic disorder that can lead to a serious bleeding disorder in the neonatal period if not recognised on time. Pathological diagnosis together with verifying molecular analysis can be used to identify index patients.Entities:
Mesh:
Year: 2010 PMID: 20811907 PMCID: PMC3016164 DOI: 10.1007/s00431-010-1280-x
Source DB: PubMed Journal: Eur J Pediatr ISSN: 0340-6199 Impact factor: 3.183
Fig. 1PAS diastase positive granules in the hepatocytes. H & E, ×400
Fig. 2Immunohistochemical staining showing AAT protein deposition in the hepatocyte (×200)
| Exon 2-1 | Forward: 5′ cacttccacgtggtgtcaat |
| Reverse: 5′ ggttgagggtacggaggagt | |
| Exon 2-2 | Forward: 5′ ttcttctccccagtgagcat |
| Reverse: 5′ gaatccacgctgaaaagcat | |
| Exon 3 | Forward: 5′ ggaggggactcatggtttct |
| Reverse: 5′ tagcagtgacccagggatgt | |
| Exon 4 | Forward: 5′ tagtgtgggtggaggacaca |
| Reverse: 5′ cagcctgggtcttcatttgt | |
| Exon 5 | Forward: 5′ gtccacgtgagccttgct |
| Reverse: 5′ ggaccagctcaacccttctt |