The role of signaling pathways in the expansion of corneal epithelial cells in serum-free B27 supplemented medium.

PURPOSE: To study the influence of serum-free B27 supplemented culture medium on corneal epithelial cells from limbal explants.
METHODS: Human limbal tissues obtained from cadaveric donor eyes were used in this study. The morphological characteristics of cultivated epithelial cells were analyzed by phase contrast microscopy. Growth kinetics, bromodeoxyuridine (BrdU) labeling cell proliferation assay, and reverse transcriptase PCR (RT-PCR) for limbus and corneal markers were studied in serum-dependent and serum-free B27 supplemented corneal epithelial culture. The signaling pathway genes were analyzed by RT(2) qPCR profiler array.
RESULTS: The corneal epithelial cells morphology and mRNA expression of markers were similar in both the serum-dependent and serum-free B27 supplemented culture. The growth and proliferation of the serum-free B27 supplemented culture was significantly higher than that of the serum-dependent culture. The wnt, hedgehog, survival, NFkB, Jak-Stat, and calcium protein kinase C pathways were highly expressed in the serum-free B27 supplemented corneal epithelial culture.
CONCLUSIONS: Most signaling pathway genes are upfolded by B27 supplementation in the corneal epithelial cell culture; it could be an efficient replacement for serum.

Introduction

Limbal deficiency or loss of corneal stem cells is associated with ocular surface disease, which is otherwise known as limbal stem cell deficiency (LSCD). The management of the ocular surface using cultured corneal epithelial cells on a human amniotic membrane is preferred. The ex vivo expansion of limbus culture requires unknown factors, such as fetal bovine serum (FBS), autologous serum, feeder layers or bovine pituitary extracts (BPE), as growth factors for the growth of corneal epithelial cells. The usage of these substances raises concern about infection with recognized or unknown-agents [1]. Although there have been successful reports that support the proliferation of corneal epithelial cells using autologous human serum [2], which effectively eliminates the risk of xenogenic contamination during transplantation to LSCD patients, there has been no data supporting the use of corneal epithelial cultures in a serum-free medium condition or showing the important signaling pathways involved.

B27 was originally optimized for culture of hippocampal neurons and used for the growth of neurons from embryonic rat striatum, the substantia nigra, the subiculum, the cerebral cortex, the postnatal dentate granule, the cerebellum, and the dentate gyrus in a serum-free condition [3]. B27 contains vitamins like biotin, DL-alpha-tocopherol, and DL-alpha-tocopherol acetate. It also contains catalase, human recombinant insulin, superoxide dismutase proteins, and other components such as corticosterone, D-galactose, ethanolamine hydrochloride, reduced glutathione, linoleic acid, linolenic acid, triiodo-L-thyronine, etc. It has been reported that corneal endothelial precursors proliferate actively in B27-containing medium with no FBS or feeder cells [4]. Yakoo et al. [1] established a culture technique for human corneal epithelial equivalents with B27 as an alternative for FBS and studied the pututative markers for corneal epithelial cells. However, the signaling pathway that helps to replace serum components and maintain stemness in the corneal culture has not yet been reported in the literature.

Therefore, we have tried to avoid serum, feeder layers, and/or bovine pituitary extract (BPE) in the culturing of corneal limbal stem cells. Instead, we used a serum-free medium supplemented with the growth factor B27 and analyzed the genes involved in the signal transduction pathway by RT2 qPCR profiler array.

Methods

Grading donor eyes

Human cadaveric eyeballs were obtained from the C.U. Shah eye bank of the Medical Research Foundation, Sankara Nethralaya, Chennai, India with the consent of the donor or donor family to be used for medical research in accordance with the principles outlined in the Declaration of Helsinki. In this study, we collected limbus tissues from donors (n=12) aged between 67and 82 years. Corneal limbal tissues of 2 mm in length were collected in Dulbecco’s Modified Eagle Medium (DMEM; Sigma Chemicals, St. Louis, MO) with antibiotics (Sigma Chemicals) and transported to the cell biology laboratory for further processing. The donor blood samples were screened for human immunodeficiency virus (HIV) type 1 and 2, hepatitis B virus (HBV), hepatitis C virus (HCV), and Treponema pallidum infections. Data on age, sex, cause of death, time of death, time of eye donation, and time of biopsy collection were also collected.

Human limbal explant culture

The collected limbal tissue was washed thrice with Hanks balanced salt solution buffer (Sigma Chemicals). After careful removal of excessive sclera and conjunctiva, the tissue was cut into multiple bits using a sharp, sterile Bard-Parker blade (Niraj Industries, Faridabad, India). The tissue bits were placed on a culture plate (BD biosciences, San Jose, CA) using a sterile needle. The plate was incubated at 37 °C and 5% CO2 for 5 min for adhesion. The explants were covered with culture medium containing equal volumes of DMEM and F12 (Sigma Chemicals) containing 5 ng/ml of epidermal growth factor (EGF), 5 μg/ml of insulin, 5 μg/ml of transferrin, 5 ng/ml of sodium selenite, 0.5 mg/ml of hydrocortisone, and 1% antibiotic solution (Sigma Chemicals). Ten percent FBS (Sigma Chemicals) was added to five cultures (serum-dependent culture; n=5) and 1% B27 supplement (Sigma Chemicals) was added to the other five cultures (serum-free B27 supplemented culture; n=5). The control samples were cultured without serum and/or any other supplement replacing serum (control culture; n=2). The plates were incubated at 37 °C and 5% CO2 with 95% humidity. The medium was changed once every two days and growth was monitored daily with an inverted phase contrast microscope (Nikon, Tokyo, Japan). Confluent cells were harvested for further molecular characterization.

Growth kinetics

The outgrowth of all the cultures was photographed every second day; images were transferred to a computer and analyzed using quantity G area measurement software [5]. The mean radius of all the cultures was plotted against each day until they reached confluence.

Cell proliferation assay

Cell proliferation was assessed by measuring 5-bromo-2-deoxyuridine (Qiagen, Santa Clara, CA) incorporation during DNA synthesis in proliferating cells. The detection of BrdU was performed according to the manufacturer’s instruction and chased for 1–21 days. The BrdU labeling indices were assessed by counting the nuclei through a microscope using a 40× objective. The labeling index was expressed as the number of positively labeled nuclei/total number of nuclei×100%.

RNA isolation

The cultures were trypsinised on the 8th day (limbal stem cells) and the 21st day (differentiated corneal cells) from both serum-dependent and serum-free B27 supplemented cultures. The RNA was isolated using the Rneasy (Qiagen) kit according to the manufacturer’s instructions. For RT2 qPCR array, the integrity and purity of the RNA were verified using a bioanalyzer chip (Agilent Technologies Genotypic, Bangalore, India).

Reverse transcriptase PCR

The expression of marker genes (Bangalore Genei, Bangalore, India; Table 1) specific for limbal stem cells and corneal cells was studied by RT–PCR with the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control.

Table 1

Primer sequence and reaction condition for RT–PCR.

Gene	Primer sequence (3′-5′)	Annealing temperature (°C)	PCR product size (bp)
ABCG2	FP:AGTTCCATGGCACTGGCCATA	62	379
	RP:TCAGGTAGGCAATTGTGAAGG
ΔNp63	FP:CAGACTCAATTTAGTGAG	54	440
	RP:AGCTCATGGTTGGGGCAC
Connexin 43	FP:CCTTCTTGCTGATCCAGTGGTAC	66	154
	RP:ACCAAGGACACCACCAGCAT
Keratin3	FP: GGCAGAGATCGAGGGTGTC	64	145
	RP: GTCATCCTTCGCCTGCTGTAG
Keratin12	FP:CATGAAGAAGAACCACGAGGATG	63	150
	RP:TCTGCTCAGCGATGGTTTCA
GAPDH	FP:GCCAAGGTCATCCATGACAAC	63	498
	RP:GTCCACCACCCTGTTGCTGTA

FP: Forward Primer; RP: Reverse Primer; bp: Base Pair.

Signal transduction pathway analysis

The RT2 qPCR profiler Human Signal Transduction Pathway array (catalog number PAHS-014; SABiosciences, Frederick, MD), representing 84 genes involved in signal transduction pathways, plus five housekeeping genes and three controls, was used to analyze the effect of serum on signaling-related gene expression in human limbal and corneal epithelial cells. The total RNA was isolated from the limbus and corneal cells (serum-dependent and serum-free B27 supplemented culture) using the Rneasy Mini Kit (Qiagen). cDNA was generated from 1 µg total RNA using the RT2 qPCR Array First Strand Kit in accordance with the manual. The template was combined with RT2 SYBR Green/Fluorescein PCR master mix. Equal amounts of this mixture (25 μl) were added to each well of the RT2 qPCR profiler plate containing the predispensed gene-specific primer sets, and the reaction was performed using a sequence detector (ABI 7500; Applied Biosystems, LabIndia, Chennai, India) according to the manufacturer’s protocols. Data analysis was based on the ∆∆Ct method with the aid of an Excel (Microsoft Excel; Microsoft, Redmond, WA) spreadsheet containing algorithms provided by the manufacturer. The expression levels of the mRNA of each gene were normalized using the expression of the housekeeping gene GAPDH. A positive value indicates that the gene was upregulated and a negative value indicates that the gene was downregulated.

Statistical analysis

All experiments were performed in triplicate. The summary data were reported as the mean±standard deviation (SD), and were compiled and analyzed on a computer (Microsoft Excel; Microsoft). The mean and SD were calculated for each group using the Student’s t-test. Results were considered to be statistically significant when p<0.01. The results of RT2 qPCR are indicated as “fold increase” (mRNA concentrations of serum-free B27 supplemented cultures divided by mRNA concentrations of serum-dependent controls).

Results

Under microscopic observation, we noted epithelial migration from limbal explants at the end of 48 h in both serum-dependent and serum-free B27 supplemented cultures (Figure 1). By the end of the 15th day, 90%–100% confluent growth was seen. There was no growth in the control samples cultured without serum and/or any other supplement.

Figure 1

Epithelial cell migration from limbal explants. Epithelial cell migration from limbal explants in serum-free B27 supplemented at the end of 48 h (A); serum-dependent culture at the end of 48 h (B); confluent culture of corneal epithelial cells in serum-free B27 supplemented at the end of the 15th day (C); confluent culture of corneal epithelial cells in serum-dependent culture at the end of the 15th day (D).

The cells cultured in serum-free B27 supplemented medium showed significantly higher growth after 12 days (Figure 2). The growth rate was faster on cells cultured in a serum-free B27 supplemented culture when compared to a serum-dependent medium (p<0.005).

Figure 2

Growth kinetics of corneal epithelial cultures plotted with area of growth in mm2 (x-axis), against serum-free B27 supplemented and serum-dependent cultures (y-axis).

Cell proliferation

The labeling index was high in serum-free B27 supplemented culture when compared to serum-dependent culture after 24 h. The cultures were reviewed continuously for 7, 14, and 21 days and the labeling indices were 50±7.76, 42±2.24, 20±2.0, and 12±0.2%, respectively, in serum-free B27 supplemented culture. Similarly, in the serum-dependent culture, the labeling indices were 48±3.2, 35±0.33, 17±1.7, and 9±1.1% for 7, 14, and 21 days, respectively (Figure 3).

Figure 3

Cell proliferation index plotted with BrdU labeling indices (x-axis), against serum-free B27 supplemented and serum-dependent cultures (y-axis).

RT–PCR

Semiquantitative RT–PCR results showed similar expressions (Table 2) of various markers such as transformation-related protein 63 - p63, ATP-binding cassette sub-family G member 2 - ABCG2, connexin 43, and Keratin 3/Keratin 12 – K3/K12 of differentiated corneal epithelial cells (21st day) grown in the serum-dependent and serum-free B27 supplemented medium (Figure 4).

Table 2

mRNA expression of cultured corneal cells grown in serum-dependent and serum-free B27 supplemented medium.

Markers	Serum-dependent	B27-dependent
ABCG2	-	-
P63	+	+
Connexin 43	+	+
Keratin 3	+	+
Keratin 12	+	+

GAPDH is an internal control; + positive marker; - negative marker.

Figure 4

RT–PCR for mRNA expression of putative limbal/corneal stem cell markers. Lane 1: Negative control; Lane 2: Positive control; Lane 3: serum-free B27 supplemented corneal cells; Lane 4: serum-dependent corneal cells; Lane 5: 100 bp DNA ladder.

Comparison of signal transduction pathway genes supporting the expansion of serum-dependent and serum-free B27 supplemented culture

The array experiment was performed in duplicate. A simple comparison was performed on data to assess the gene expression of a serum-free B27 supplemented culture in relation a serum-dependent culture as a control for limbal stem cells and differentiated corneal epithelial cells (Table 3). The differences in gene expression between the serum-free B27 supplemented culture and the serum-dependent profile of limbal and corneal cells were studied (a more than twofold difference was considered significant). The raw data, i.e., the mean ∆∆Ct values of the genes, were normalized to the housekeeping gene GAPDH. All 84 genes were analyzed thoroughly based on their role in both the serum and serum-free conditions. Among these pathways, the most interesting and highly expressed were wnt, hedgehog, survival, NFkB, Jak-Stat, and the calcium protein kinase C pathways that have been discussed in this study (Figure 5).

Table 3

Signal transduction pathway gene profile supporting the expansion of serum-free B27 supplemented limbus/corneal culture (serum-dependent culture as control).

Symbol	Limbus	Cornea	Description	Gene Name
Mitogenic Pathway
EGR1	12.06	1.16	Early growth response 1	AT225/G0S30
FOS	67.78	1.6	V-fos FBJ murine osteosarcoma viral oncogene homolog	AP-1/C-FOS
JUN	8.51	1.64	Jun oncogene	AP-1/AP1
Wnt Pathway
CCND1	4.28	−1.72	Cyclin D1	BCL1/D11S287E
JUN	8.51	1.64	Jun oncogene	AP-1/AP1
LEF1	12.06	1.13	Lymphoid enhancer-binding factor 1	DKFZp586H0919/TCF1ALPHA
MYC	4.28	−3.56	V-myc myelocytomatosis viral oncogene homolog (avian)	MRTL/bHLHe39
PPARG	2.14	−1.33	Peroxisome proliferator-activated receptor gamma	CIMT1/NR1C3
TCF7	12.06	1.13	Transcription factor 7 (T-cell specific, HMG-box)	TCF-1
VEGFA	1.07	−1.74	Vascular endothelial growth factor A	MVCD1/VEGF
WISP1	11.65	1.13	WNT1 inducible signaling pathway protein 1	CCN4/WISP1c
Hedgehog Pathway
BMP2	8.52	−3.57	Bone morphogenetic protein 2	BMP2A
BMP4	4.32	−2.46	Bone morphogenetic protein 4	BMP2B/BMP2B1
EN1	11.76	1.13	Engrailed homeobox 1	Engrailed 1
FOXA2	12.06	1.13	Forkhead box A2	HNF3B/TCF3B
PTCH1	2.01	−2.46	Patched homolog 1 (Drosophila)	BCNS/HPE7
WNT1	12.06	1.13	Wingless-type MMTV integration site family, member 1	INT1
WNT2	12.06	1.17	Wingless-type MMTV integration site family member 2	INT1L1/IRP
TGF-Beta Pathway
CDKN1A	3.00	−2.47	Cyclin-dependent kinase inhibitor 1A (p21, Cip1)	CAP20/CDKN1
CDKN1B	5.99	1.65	Cyclin-dependent kinase inhibitor 1B (p27, Kip1)	CDKN4/KIP1
CDKN2A	−1.34	−6.95	Cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)	ARF/CDK4I
CDKN2B	2.12	−1.75	Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)	CDK4I/INK4B
Survival Pathway
PI3 Kinase/AKT Pathway
BCL2	12.06	1.13	B-cell CLL/lymphoma 2	Bcl-2
CCND1	4.28	−1.72	Cyclin D1	BCL1/D11S287E
JUN	8.51	1.64	Jun oncogene	AP-1/AP1
MYC	4.28	−3.56	V-myc myelocytomatosis viral oncogene homolog (avian)	MRTL/bHLHe39
Jak/Src Pathway
BCL2	12.06	1.13	B-cell CLL/lymphoma 2	Bcl-2
BCL2L1	6.03	−7.04	BCL2-like 1	BCL-XL/S
NFkB Pathway
BCL2A1	1.50	2.33	BCL2-related protein A1	ACC-1/ACC-2
BIRC2	2.13	3.24	Baculoviral IAP repeat-containing 2	API1/HIAP2
BIRC3	1.06	−2.48	Baculoviral IAP repeat-containing 3	AIP1/API2
NAIP (BIRC1)	2.13	1.14	NLR family, apoptosis inhibitory protein	BIRC1/NLRB1
TERT	12.06	1.13	Telomerase reverse transcriptase	EST2/TCS1
P53 Pathway
BAX	3.01	−14.1	BCL2-associated X protein	BCL2L4
CDKN1A	3.00	−2.47	Cyclin-dependent kinase inhibitor 1A (p21, Cip1)	CAP20/CDKN1
Fas	−1.33	−1.25	Fas (TNF receptor superfamily, member 6)	ALPS1A/APO-1
GADD45A	5.99	2.26	Growth arrest and DNA-damage-inducible, alpha	DDIT1/GADD45
IGFBP3	−14.95	−40	Insulin-like growth factor binding protein 3	BP-53/IBP3
MDM2	1.06	−4.93	Mdm2 p53 binding protein homolog (mouse)	HDMX/hdm2
TP5313	4.28	−1.22	Tumor protein p53 inducible protein 3	PIG3
Stress Pathway
ATF2	3.01	−2.48	Activating transcription factor 2	CRE-BP1/CREB2
FOS	67.78	1.6	V-fos FBJ murine osteosarcoma viral oncogene homolog	AP-1/C-FOS
HSF1 (tcf5)	4.25	1.15	Heat shock transcription factor 1	HSTF1
HSPB1 (hsp27)	4.27	−1.25	Heat shock 27 kDa protein 1	CMT2F/DKFZp586P1322
HSPCA (hsp90)	1.50	−3.48	Heat shock protein 90 kDa alpha (cytosolic), class A member 2	HSP90ALPHA/HSPCA
MYC	4.28	−3.56	V-myc myelocytomatosis viral oncogene homolog (avian)	MRTL/bHLHe39
TP53	1.07	−1.75	Tumor protein p53	LFS1/TRP53
NFkB Pathway
IKBKB	2.11	−2.53	Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	IKK-beta/IKK2
IL1A	8.48	3.27	Interleukin 1, alpha	IL-1A/IL1
IL2	11.72	1.17	Interleukin 2	IL-2/TCGF
IL8	1.53	−9.92	Interleukin 8	CXCL8/GCP-1
LTA (TNF beta)	11.75	1.13	Lymphotoxin alpha (TNF superfamily, member 1)	LT/TNFB
NOS2A (iNOS)	1.42	−3.52	Nitric oxide synthase 2, inducible	HEP-NOS/INOS
PECAM1	8.03	1.09	Platelet/endothelial cell adhesion molecule	CD31/PECAM-1
TANK	5.70	−3.63	TRAF family member-associated NFKB activator	I-TRAF/TRAF2
TNF	7.99	−1.75	Tumor necrosis factor (TNF superfamily, member 2)	DIF/TNF-alpha
VCAM1	12.06	1.13	Vascular cell adhesion molecule 1	CD106/DKFZp779 G2333
NFAT Pathway
CD5	11.65	1.13	CD5 molecule	LEU1/T1
FASLG (TNFSF6)	11.69	1.16	Fas ligand (TNF superfamily, member 6)	APT1LG1/CD178
IL2	11.72	1.17	Interleukin 2	IL-2/TCGF
CREB Pathway
CYP19A1	11.27	1.13	Cytochrome P450, family 19, subfamily A, polypeptide 1	ARO/ARO1
EGR1	12.06	1.16	Early growth response 1	AT225/G0S30
FOS	67.78	1.6	V-fos FBJ murine osteosarcoma viral oncogene homolog	AP-1/C-FOS
Jak-Stat pathway
CXCL9	11.14	1.13	Chemokine (C-X-C motif) ligand 9	CMK/Humig
IL4	11.33	1.13	Interleukin 4	BCGF-1/BCGF1
IL4R	1.51	−3.52	Interleukin 4 receptor	CD124/IL4RA
MMP10	3.02	−1.76	Matrix metallopeptidase 10 (stromelysin 2)	SL-2/STMY2
NOS2A (iNOS)	1.42	−3.52	Nitric oxide synthase 2, inducible	HEP-NOS/INOS
Estrogen Pathway
BCL2	12.06	1.13	B-cell CLL/lymphoma 2	Bcl-2
BRCA1	8.50	1.1	Breast cancer 1, early onset	BRCAI/BRCC1
GREB1	11.72	1.16	GREB1 protein	KIAA0575
NRIP1	−1.32	−3.51	Nuclear receptor interacting protein 1	RIP140
Androgen Pathway
CDK2	8.55	−1.75	Cyclin-dependent kinase 2	p33(CDK2)
CDKN1A	3.00	−2.47	Cyclin-dependent kinase inhibitor 1A (p21, Cip1)	CAP20/CDKN1
KLK2	11.41	1.16	Kallikrein-related peptidase 2	KLK2A2/hK2
TMEPAI	−1.87	−1.74	Prostate transmembrane protein, androgen induced 1	STAG1/TMEPAI
Calcium and protein kinase C Pathway
CSF2	11.42	−1.84	Colony stimulating factor 2 (granulocyte-macrophage)	GMCSF
FOS	67.78	1.6	V-fos FBJ murine osteosarcoma viral oncogene homolog	AP-1/C-FOS
IL2	11.72	1.17	Interleukin 2	IL-2/TCGF
JUN	8.51	1.64	Jun oncogene	AP-1/AP1
MYC	4.28	−3.56	V-myc myelocytomatosis viral oncogene homolog (avian)	MRTL/bHLHe39
ODC1	8.54	1.65	Ornithine decarboxylase 1	ODC
PRKCA	5.62	1.13	Protein kinase C, alpha	AAG6/PKC-alpha
PRKCE	2.92	−2.48	Protein kinase C, epsilon	PKCE/nPKC-epsilon
TFRC	−1.30	−1.74	Transferrin receptor (p90, CD71)	CD71/TFR
Phospholipase C Pathway
BCL2	12.06	1.13	B-cell CLL/lymphoma 2	Bcl-2
EGR1	12.06	1.16	Early growth response 1	AT225/G0S30
FOS	67.78	1.6	V-fos FBJ murine osteosarcoma viral oncogene homolog	AP-1/C-FOS
ICAM1	−2.68	−20.07	Intercellular adhesion molecule 1	BB2/CD54
JUN	8.51	1.64	Jun oncogene	AP-1/AP1
NOS2A	1.42	−3.52	Nitric oxide synthase 2, inducible	HEP-NOS/INOS
PTGS2	23.98	4.57	Prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	COX-2/COX2
VCAM1	12.06	1.13	Vascular cell adhesion molecule 1	CD106/DKFZp779G2333
Insulin Pathway
CEBPB	2.90	3.3	CCAAT/enhancer binding protein (C/EBP), beta	C/EBP-beta
FASN	4.26	1.14	Fatty acid synthase	FAS/OA-519
GYS1	3.03	3.29	Glycogen synthase 1 (muscle)	GSY/GYS
HK2	2.99	1.69	Hexokinase 2	DKFZp686M1669/HKII
LEP	12.06	1.13	Leptin	OB/OBS
LDL Pathway
CCL2	8.79	1.13	Chemokine (C-C motif) ligand 2	GDCF-2/HC11
CSF2	11.42	−1.84	Colony stimulating factor 2 (granulocyte-macrophage)	GMCSF
SELE	11.70	1.13	Selectin E	CD62E/ELAM
SELPLG	12.06	1.13	Selectin P ligand	CD162/CLA
VCAM1	12.06	1.13	Vascular cell adhesion molecule 1	CD106/DKFZp779 G2333
Retinoic acid Pathway
EN1	11.76	1.13	Engrailed homeobox1	Engrailed 1
HOXA1	12.06	1.13	Homeobox A1	BSAS/HOX1
RBP1 (CRBP1)	1.06	−1.74	Retinol binding protein 1, cellular	CRABP-I/CRBP

Figure 5

Six Pathways with relatively high expressions representing corresponding genes by RT2 qPCR profiler array of serum-free B27 supplemented limbus and corneal epithelial cells. Serum-dependent cultured limbus and corneal epithelial cells are the respective controls.

Discussion

We have demonstrated the use of serum-free B27 supplemented medium for the growth of corneal epithelial cells. This serum-free medium supported the proliferation and viability of the cells. The cells expressed presumed limbal stem cell association markers and the cornea phenotype, suggesting that the serum-free B27 supplemented medium retained the stemness of cultured cells. The confluent culture was collected and RNA was isolated to analyze the signaling pathway genes involved in both serum-dependent and serum-free B27 supplemented cultures.

The signal transduction pathway genes involved in the growth of corneal epithelial cells help to determine their role in both serum-dependent and serum-free B27 supplemented corneal epithelial cultures. Among the 17 pathways, six pathways involved in the serum-free B27 supplemented culture were discussed, along with their roles in serum-free limbal stem cell and differentiated corneal epithelial cell cultures.

In the serum-free condition of the corneal epithelial cells, the activation of wnt pathway plays a vital role by activating genes like Homo sapiens jun oncogene (JUN), which codes for a transcription factor called activator protein-1 (AP1) and helps in the differentiation, proliferation, and apoptosis of epithelial cells [6]. Corneal epithelial stem cell proliferation depends on the upregulation of paired box gene 6 (pax6) and downregulation of beta-catenin and lymphoid enhancer-binding factor 1 (Lef-1) [7]. The hedgehog pathway genes were 2 to 8 times upregulated in serum-free B27 supplemented limbal stem cells when compared with differentiated corneal epithelial cells of the same culture. Sonic hedgehog (Shh) is secreted by stem cells, inducing bone morphogenetic protein 4 (BMP4), and is involved in the self-renewal and development of the epithelium [8]. The wingless-type MMTV integration site family, member 1 (wnt1) and Wingless-type MMTV integration site family, member 21 (wnt2) genes of this pathway were found to play an equal role (12 times upregulated in relation to the serum-dependent culture) in the maintenance of stemness in limbal epithelial cells of the serum-free B27 supplemented culture. The cellular survival pathway consists of phosphoinositide 3-kinase/v-akt murine thymoma viral oncogene homolog 1 (PI3K/Akt), Janus kinase/sarcoma proto oncogene (Jak/Src), and nuclear factor kappa-light-chain-enhancer of activated B (NFkB) as three major groups of genes. The cyclin D1 (CCND1) gene is required for cell cycle G1/S transition [9]. Baculoviral Inhibitor of Apoptosis repeat proteins (Birc1) proteins contain BIR domains that can directly bind to active caspases and help in protein–protein interaction [10]. In the stem cell and progenitor cell compartments, the telomerase reverse transcriptase (TERT) gene prevents the adverse consequences of dysfunctional telomeres on cell viability and chromosomal stability [11], and enhances the cell cycle entry of quiescent epidermal stem cells [12]. The NFkB pathway genes in serum-free B27 supplemented cells had a distinct fold increase when compared with the control, and a few genes like interleukin 1 alpha (IL1A), interleukin 2 (IL2), lymphotoxin alpha (LTA), platelet/endothelial cell adhesion molecule 1 (PECAM1), and vascular cell adhesion molecule 1 (VCAM1) exhibited upfolded expression in both limbus and corneal cells. The inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta (IKBKB) gene produced an enzyme, IKK2 - inhibitor of nuclear factor kappa-B kinase subunit and activated a transcription factor called NFkB. Interleukin genes like IL1A, interleukin 8 (IL8), and tumor necrosis factor alpha (TNFα) present in the NFkB pathway encode for cytokines and chemokines involved in inflammatory processes [13,14]. They also help in the migration of progenitor and pluripotent stem cells [15]. The chemokine (C-X-C motif) ligand 9 (CXCL9) and interleukin 4 (IL4) genes of the Jak-Stat pathway played an important role in the development and organization of cells, which were upregulated by 12 times in serum-free B27 supplemented limbus culture [16]. Among the other five pathways, the calcium and protein kinase C pathway genes were highly expressed in serum free-B27 supplemented culture when compared to serum-dependent culture. The Homo sapiens V-fos FBJ murine osteosarcoma viral oncogene homolog (FOS) gene of the calcium and protein kinase C pathway belonged to the transcription factor family [17], which is highly upregulated in serum-free B27 supplemented limbal stem cell cultures.

In conclusion, the B27 supplement activated more signaling pathway genes, helping to provide a higher cell number, good capacity for proliferation, better quality, and more functional pieces of engineered corneal equivalents without the support of serum, a feeder layer, and/or BPE.