Literature DB >> 20589194

A novel frameshift mutation in exon 12 of the adenomatous polyposis coli gene in an Italian family with familial adenomatous polyposis and desmoid tumour.

Maria Teresa Vietri1, Vietri Maria Teresa, Francesco Selvaggi, Selvaggi Francesco, Maria Laura De Paola, De Paola Maria Laura, Guido Sciaudone, Sciaudone Guido, Ilaria Guadagni, Guadagni Ilaria, Mariarita Parisi, Parisi Mariarita, Gianluca Pellino, Pellino Gianluca, Anna Maria Molinari, Molinari Anna Maria, Michele Cioffi, Cioffi Michele.   

Abstract

Entities:  

Year:  2010        PMID: 20589194      PMCID: PMC2957623     

Source DB:  PubMed          Journal:  J Mol Genet Med        ISSN: 1747-0862


× No keyword cloud information.
The adenomatous polyposis coli (APC) gene, localized on chromosome 5, consists of 15 exons. The largest is the exon 15, which comprises more than 75% of the coding sequence of the gene and is the most common target for both germline and somatic mutations (Groden et al, 1993). The germline mutations in the APC gene are in charge of the familial adenomatous polyposis (FAP), a rare autosomal inherited disease (Hegde and Roa, 2006). These mutations predispose to develop colonic polyps and other extraintestinal neoplasms, including desmoid tumour in subjects between 15 and 60 years. The estimated risk of developing a desmoid tumour in patients with FAP is between 4 and 20 percent. This risk increases about 2 years after colectomy (Groen et al, 2008). We studied a woman (56 years old) affected with FAP and desmoid tumour and her three children (two daughters and one son). This study was carried out in accordance with the World Medical Association Helsinki Declaration, adopted in 1964 and amended in 1975, 1983, 1989, 1996 and 2000 (World Medical Association, 1998). Informed consents were obtained from all subjects, and the study was approved and conducted according to the ethical guidelines of the Second School of Naples. The pedigree was generated by the genetic counsellor and the case-histories of the subjects were collected. The pedigree and the main clinical data are summarised in Figure 1. The family originated from the Campania, a region of southern Italy. The proband affected with FAP had surgical treatment with restorative proctocolectomy and ileal J-pouch at the age of 54 years. Two years after the pouch procedure the proband developed desmoid tumour, consistent with previous reports (for example, Groen et al, 2008).
Figure 1.

Pedigree of family with APC mutation identified. The arrow indicates the proband. Open symbols, clinically unaffected subjects; right inferior quadrate blackened symbols, patients affected with FAP; left superior quadrate blackened symbols, patients affected with desmoid tumours.

Pedigree of family with APC mutation identified. The arrow indicates the proband. Open symbols, clinically unaffected subjects; right inferior quadrate blackened symbols, patients affected with FAP; left superior quadrate blackened symbols, patients affected with desmoid tumours. Out of three children of proband, a daughter and a son were affected with FAP, diagnosed at the ages of 28 year and 18 year, respectively. Both siblings received ileal J-pouch procedure. The eldest daughter (33 years old) did not display the disease phenotype. Peripheral blood from subjects was collected using standard procedures and all 15 exons of the APC gene and the flanking splice site regions were amplified using a set of 28 primer pairs (Table 1). One set of primers was used to amplify each exon and the adjacent intronic region except for exon 15, which was amplified as 14 separate PCR fragments due to it large size.
Table 1.

APC Primer sequences (Amplification conditions: : 94°C for 30sec, 62°C for 60sec, 72°C for 60sec, 35 cycles).

NamePrimer sequence (5′ to 3′)Product size
1-fGCATATTAACACAATTCTTCTTAAACGTC327
1-rGAATACTGAATAAAAATGGATAAACTACAATTAAA
2-fGTCAAGAAATACAGAATCATGTCTTGAA223
2-rTCTACACACCTAAAGATGACAATTTGAG
3-fGACCCAAGTGGACTTTTCAGG423
3-rACAATAAACTGGAGTACACAAGGCA
4-fTGCTCTTCTGCAGTCTTTATTAGCA255
4-rCCTGAATTTTAATGGATTACCTAGGTACT
5-fGCTTTTTTGCTTTTACTGATTAACGT248
5-rGAGCTGTAATTCATTTTATTCCTAATAGCTC
6-fTGATTTGACATAACCCTGAGCTTT235
6-rAACTACCTATTTTTATACCCACAAACAAGA
7-fAAGAAAGCCTACACCATTTTTGC251
7-rGGTAAGATTTATAGATCATTCTTAGAACCAT
8-fACCTATAGTCTAAATTATACCATCTATAATGTGCT184
8-rGTCATGGCATTAGTGACCAGG
9-fAGTCGTAATTTTGTTTCTAAACTCATTTG458
9-rGCTTTGAAACATGCACTACGATG
10-fAAACATCATTGCTCTTCAAATAACAA217
10-rCTACCATGATTTAAAAATCCACCAGT
11-fTTAGATGATTGTCTTTTTCCTCTTGC217
11-rTGAGCTATCTTAAGAAATACATGTTATAAAAACA
12-fGGCTTCAAGTTGTCTTTTTAATGATC186
12-rAGACCCTGCCTCAAAGAAAAAG
13-fTTTCTATTCTTACTGCTAGCATTAAAAACA307
13-rAATACACAGGTAAGAAATTAGGAAATCTCAT
14-fACTCTAATTAGATGACCCATATTCTGTTTC316
14-rCAATTAGGTCTTTTTGAGAGTATGAATTCT
15a-fGTTACTGCATACACATTGTGACCTTAATTT453
15a-rCGATGAGATGCCTTGGGACTT
15b-fGCGAAGTACAAGGATGCCAATATT449
15b-rGCAGTGGTGGAGATCTGCAAA
15c-fCAACTACCATCCAGCAACAGAAAAT491
15c-rTTGGTGTATCTAGTTCTCCATCATTATCAT
15d-fTCAATACCCAGCCGACCTAGC527
15d-rCCACATGACGTTTCTCTTCATTATATTTT
15e-fGTAAGCCAGTCTTTGTGTCAAGAAGAT478
15e-rCAGCTGATGACAAAGATGATAATGAAC
15f-fCTTGCAAAGTTTCTTCTATTAACCAAGA454
15f-rCGACTCTCAAAACTATCAAGTGAACTG
15g-fACCTGAACACTATGTTCAGGAGACC524
15g-rCATTTGATTCTTTAGGCTGCTCTGATT
15h-fACAGAAAGATGTGGAATTAAGAATAATGC476
15h-rCTCCTTCTCCAGCAGCTAACTCAT
15i-fACATCTCTAAGTGATCTAACAATCGAATC650
15i-rTCATCATCATCAAAATCTAGAGAACTCA
15l-fCTATTGAAGGAACTCCTTACTGTTTTTC669
15l-rTGCCACCCATATTTCTGGG
15m-fGCCTTCAAGACTCAAGGGTGA657
15m-rGGAGAAGTGGTGGCTGTTTG
15n-fCCTTAAGACTCCAGCCTCCAA656
15n-rGTCTAGATGATGGAGAAAGAGATTCAA
15o-fCAACCTTAAGAAGAAAATTGGAGGA664
15o-rGATCTAGGATTGTTAATGGGACAGTC
15p-fTGCTGTTTCTAAAACAGAGGATGTT663
15p-rAGTTTCATTTGAAACAAAATGTCTATATAGC
APC Primer sequences (Amplification conditions: : 94°C for 30sec, 62°C for 60sec, 72°C for 60sec, 35 cycles). PCR products were sequenced using the ABI PRISM di-Deoxy Terminator Cycle sequencing kit in an ABI 9700 Thermal Cyclers and ABI PRISM 310 Genetic Analyzer. Deviations from the wild-type sequence were identified using Mutation Surveyor, sequence analysis and assembly software. The analysis of the APC gene in the DNA sample from proband revealed the presence of the novel deletion, 1605_1606delTG. This frameshift mutation is located in exon 12 of APC gene and is characterized by a deletion of two nucleotides, generating a premature stop codon between codons 537 and 538 (Figure 2). The presence of the mutation was confirmed by resequencing a second DNA sample from the patient.
Figure 2.

Carrier frameshift variant c.1605_1606delTG. Electropherogram for the sense strand of exon 12 of APC gene. DNA sequence reveals a heterozygous TG nucleotide deletion (A), resulting in frameshift and subsequent chain termination. The wide type sequence is shown in (B).

Carrier frameshift variant c.1605_1606delTG. Electropherogram for the sense strand of exon 12 of APC gene. DNA sequence reveals a heterozygous TG nucleotide deletion (A), resulting in frameshift and subsequent chain termination. The wide type sequence is shown in (B). The genetic analysis conducted in family members showed the same mutation in the daughter and the son affected with FAP, while the healthy daughter did not have this mutation (Figure 1). In this study, we identified in the proband, affected with FAP and desmoid tumour the novel mutation 1605_1606delTG. The proband passed on the mutation to one of her daughters and the son resulting in FAP phenotype. The different onset age of FAP in proband, daughter and son (54, 28 and 18 years, respectively) indicates intrafamilial variability. In the FAP, the sites of the mutation determine the presence or the absence of extracolonic manifestation of the disease, as desmoid tumours. The identified frameshift mutation is located in exon 12 at codon 535 in the 5′end of APC gene, a region of APC gene not usually associated with desmoid tumor. Indeed, the previous studies show that in patients affected with FAP and desmoid tumour the mutations of APC gene are localized predominantly in exon 15 (Lips et al, 2009). It is possible that the site of the mutation may also influence the severity of desmoid phenotype (Couture et al, 2000). It has been previously reported that the most severe desmoid phenotype (penetrance=100%) presents in families which carry mutations in the 3′ end of the APC gene (Eccles et al, 2001). In the proband, after three months of medical treatment with Toremifene, a selective oestrogen receptor modulator, the abdominal ultrasound showed no detectable hydronephrosis and the magnetic resonance imaging documented a downsizing of the mass. These data suggest that the mutations that are not in the 3′ end of the APC gene may be associated with a less severe phenotype. Both siblings affected with FAP and positive for APC gene mutation received colectomy nearly an year ago and at present are undergoing a clinical follow-up program. We propose that a longer follow-up could clarify the association between this novel mutation and the development of desmoid tumour. The identification of this novel mutation in APC gene and the outcome of the clinical follow-up of the subjects of this study are likely to be helpful in the FAP patient treatment and care strategies in the future.
  7 in total

1.  A novel 3' mutation in the APC gene in a family presenting with a desmoid tumour.

Authors:  D Eccles; J Harvey; A Bateman; F Ross
Journal:  J Med Genet       Date:  2001-12       Impact factor: 6.318

2.  [The World Medical Association (WMA). The WMA declaration of Helsinki 1960 with recommendations on biomedical research on human subjects (modified in 1975, 1980 and 1989)].

Authors: 
Journal:  Chirurgia (Bucur)       Date:  1998 Mar-Apr

3.  A germline mutation at the extreme 3' end of the APC gene results in a severe desmoid phenotype and is associated with overexpression of beta-catenin in the desmoid tumor.

Authors:  J Couture; A Mitri; R Lagace; R Smits; T Berk; H L Bouchard; R Fodde; B Alman; B Bapat
Journal:  Clin Genet       Date:  2000-03       Impact factor: 4.438

Review 4.  Detecting mutations in the APC gene in familial adenomatous polyposis (FAP).

Authors:  Madhuri R Hegde; Benjamin B Roa
Journal:  Curr Protoc Hum Genet       Date:  2006-08

5.  Mutational analysis of patients with adenomatous polyposis: identical inactivating mutations in unrelated individuals.

Authors:  J Groden; L Gelbert; A Thliveris; L Nelson; M Robertson; G Joslyn; W Samowitz; L Spirio; M Carlson; R Burt
Journal:  Am J Hum Genet       Date:  1993-02       Impact factor: 11.025

Review 6.  The role of APC and beta-catenin in the aetiology of aggressive fibromatosis (desmoid tumors).

Authors:  D J Lips; N Barker; H Clevers; A Hennipman
Journal:  Eur J Surg Oncol       Date:  2008-08-21       Impact factor: 4.424

Review 7.  Extra-intestinal manifestations of familial adenomatous polyposis.

Authors:  Emma J Groen; Annemieke Roos; Friso L Muntinghe; Roelien H Enting; Jakob de Vries; Jan H Kleibeuker; Max J H Witjes; Thera P Links; André P van Beek
Journal:  Ann Surg Oncol       Date:  2008-07-09       Impact factor: 5.344

  7 in total
  2 in total

1.  APC and MUTYH Analysis in FAP Patients: A Novel Mutation in APC Gene and Genotype-Phenotype Correlation.

Authors:  Giovanna D'Elia; Gemma Caliendo; Amelia Casamassimi; Michele Cioffi; Anna Maria Molinari; Maria Teresa Vietri
Journal:  Genes (Basel)       Date:  2018-06-27       Impact factor: 4.096

2.  APC Splicing Mutations Leading to In-Frame Exon 12 or Exon 13 Skipping Are Rare Events in FAP Pathogenesis and Define the Clinical Outcome.

Authors:  Vittoria Disciglio; Giovanna Forte; Candida Fasano; Paola Sanese; Martina Lepore Signorile; Katia De Marco; Valentina Grossi; Filomena Cariola; Cristiano Simone
Journal:  Genes (Basel)       Date:  2021-02-28       Impact factor: 4.096

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.