Oxidative stress-mediated up-regulation of myocardial ischemic preconditioning up-regulated protein 1 gene expression in H9c2 cardiomyocytes is regulated by cyclic AMP-response element binding protein.

The cyclic AMP (cAMP)/protein kinase A (PKA) cascade plays a central role in cardiomyocyte proliferation and apoptosis. Here, we show that H(2)O(2) stimulates expression of the antiapoptotic myocardial ischemic preconditioning up-regulated protein 1 (Mipu1) gene in H9c2 cardiomyocytes through a pathway involving the cAMP-response element binding protein (CREB). Stimulation of H9c2 cardiomyocytes with H(2)O(2) resulted in increased Mipu1 promoter activity. Analysis of the rat Mipu1 promoter revealed two potential cAMP-response elements, one of which (CRE-II, TGTGGATGTTGACGAGCTTGT) was shown, using mutagenesis and deletion analysis, to be functional. Subsequent studies established that H(2)O(2) increased phosphorylation of CREB serine 133 through a pathway involving PKA activation. Phospho-CREB was demonstrated to bind to CRE-II of the Mipu1 promoter, and H(2)O(2) treatment resulted in increases in their interaction as assessed by ChIP. Furthermore, H(2)O(2)-mediated up-regulation of Mipu1 protein expression was abrogated by the suppression of CREB expression with small interfering RNA of CREB. It was demonstrated that the H(2)O(2)-induced up-regulation of Mipu1 in H9c2 cardiomyocytes was mediated by cAMP/PKA-dependent CREB activation. Copyright (c) 2010 Elsevier Inc. All rights reserved.