Previous studies have shown that subunits E (eIF3e), F (eIF3f) and H (elF3h) of eukaryotic translation initiation factor 3 play important roles in cell development in humans and yeast. eIF3e and eIF3h have also been reported to be important for normal cell growth in Arabidopsis. However, the functions of subunit eIF3f remain largely unknown in plant species. Here we report characterization of mutants for the Arabidopsis eIF3f (AteIF3f) gene. AteIF3f encodes a protein that is highly expressed in pollen grains, developing embryos and root tips, and interacts with Arabidopsis eIF3e and eIF3h proteins. A Ds insertional mutation in AteIF3f disrupted pollen germination and embryo development. Expression of some of the genes that are essential for pollen tube growth and embryogenesis is down-regulated in ateif3f-1 homozygous seedlings obtained by pollen rescue. These results suggested that AteIF3f might play important roles in Arabidopsis cell growth and differentiation in combination with eIF3e and eIF3h.
Previous studies have shown that subunits E (eIF3e), F (eIF3f) and H (elF3h) of eukaryotic translation initiation factor 3 play important roles in cell development in humans and yeast. eIF3e and eIF3h have also been reported to be important for normal cell growth in Arabidopsis. However, the functions of subunit eIF3f remain largely unknown in plant species. Here we report characterization of mutants for the ArabidopsiseIF3f (AteIF3f) gene. AteIF3f encodes a protein that is highly expressed in pollen grains, developing embryos and root tips, and interacts with ArabidopsiseIF3e and eIF3h proteins. A Ds insertional mutation in AteIF3f disrupted pollen germination and embryo development. Expression of some of the genes that are essential for pollen tube growth and embryogenesis is down-regulated in ateif3f-1 homozygous seedlings obtained by pollen rescue. These results suggested that AteIF3f might play important roles in Arabidopsis cell growth and differentiation in combination with eIF3e and eIF3h.
In higher plants, pollen tube elongation in the pistil is a crucial step for sexual reproduction. Many important biological processes are involved. For example, a tip‐focused calcium gradient plays a central role in orienting tip growth (Dumas and Gaude, 2006). Cell wall‐modifying enzymes are required for normal pollen tube elongation (Krichevsky ). Exocytosis is also one of the major processes responsible for polarized cell growth (Malho ). To carry out these biological processes, numerous proteins need to be synthesized precisely during pollen tube growth and elongation.In protein synthesis processes, mRNA translation is regulated at both global and message‐specific levels, especially at the step of translation initiation. The normal initiation of eukaryotic protein synthesis is facilitated by at least 12 eukaryotic translation initiation factors (eIFs), several of which are multiprotein complexes. The largest, eukaryotic translation initiation factor 3 (eIF3) (approximately 650 kDa), participates in most translation initiation processes (Asano ; Sonenberg ; Kawaguchi and Bailey‐Serres, 2002). eIF3 helps to maintain the 40S and 60S ribosomal subunits in a dissociated state, and stabilizes binding of the eIF2–GTP–Met–tRNAiMet ternary complex to the 40S subunit (Chaudhuri ; Sonenberg ). It promotes binding of the 43S pre‐initiation complex to the 5′ end of mRNA (Kolupaeva ; Hinnebusch, 2006). Moreover, it also plays roles in scanning for and recognizing AUG start codons (Lukaszewicz ; Dever, 2002; Nielsen ; Valasek ).The components of eIF3 have been identified in many species. In humans, the functional core of eIF3 is made up of six (eIF3a, eIF3b, eIF3c, eIF3e, eIF3f, eIF3h) of 11 subunits. These are conserved in mammals, Triticum aestivum (wheat), Arabidopsis thaliana, Saccharomyces pombe and Drosophila melanogaster (Asano ; Burks ; Masutani ; Zhou ). However, only eIF3a, eIF3b and eIF3c are found in the eIF3 core of Saccharomyces cerevisiae, which has five subunits (eIF3a, eIF3b, eIF3c, eIF3g and eIF3i), indicating that eIF3e, eIF3f and eIF3h may not be necessary for global translation initiation (Asano ; Burks ; Zhou ). eIF3e and eIF3h are not essential for global translation initiation in fission yeast, but their knockout affects spore formation, indicating that they may have special roles in cell differentiation (Bandyopadhyay ; Zhou ; Ray ). eIF3f is down‐regulated in many humantumours, and over‐expression of eIF3f inhibits cell proliferation and induces apoptosis in tumour cells (Shi ; 2008a, 2008b). These results suggest that eIF3e, eIF3f and eIF3h play important roles in the normal growth of human and yeast cells but are not necessary for global translation initiation.In Arabidopsis, deletion of the eIF3e gene (AteIF3e) results in male gametophytic lethality in the eIF3e‐Tnull mutant (Yahalom ), indicating that it is required for male gametogenesis. Over‐expression of eIF3e affects seed formation (Yahalom ). Therefore, eIF3e plays roles in Arabidopsis embryogenesis. Mutation of the ArabidopsiseIF3h gene not only significantly reduced Arabidopsis fertility, but also resulted in hypersensitivity of eif3h‐1 mutant seedlings to exogenous sugars (2004, 2007). In summary, eIF3e and eIF3h are important for normal plant cell growth. However, the roles of subunit eIF3f are largely unknown in plant species.Here, we report the characterization of a male gametophyte‐defective mutant generated by insertion of the transposon element Ds in At2g39990. As the At2g39990 protein was identified in the ArabidopsiseIF3 complex and has high similarities to the eIF3f proteins found in many species (Burks ), we named the gene Arabidopsis thalianaeIF3f (AteIF3f), and the mutant alleles used in this study were named ateif3f‐1 and ateif3f‐2. AteIF3f was highly expressed in pollen grains, pollen tubes, embryos and root tips, and was also constitutively expressed in other tissues. In a pollen rescue experiment, we found that the mutation in AteIF3f also led to defects in embryogenesis. Further transcriptome analysis using ateif3f‐1 homozygous seedlings generated by pollen rescue showed that AteIF3f affected the expression of genes that are essential for pollen tube growth and embryogenesis, for example AtCSLA7 (Goubet ). We also demonstrated that AteIF3f interacts with ArabidopsiseIF3e and eIF3h. These results suggest that eIF3f may play important roles in plant cell growth in combination with eIF3e and eIF3h in Arabidopsis.
Results
Isolation and genetic analysis of the ateif3f‐1 mutant
The ateif3f‐1 mutant was isolated in a genetic screen for male gametophyte‐defective mutants of a collection of gene‐trap and enhancer‐trap Ds insertion lines in Arabidopsis ecotype Landsberg erecta (Ler) (Sundaresan ). The Ds insertion created a genetic tag of kanamycin resistance in the mutant plant and a GUS reporter that was expressed specifically in pollen grains (see Figure S1a,b). We first performed a genetic analysis of the ateif3f‐1 mutant (Table 1). The progeny from self‐crossed ateif3f‐1/+ plants exhibited a segregation ratio of approximately 1:1 kanamycin‐resistant (KanR):kanamycin‐sensitive (KanS) (2116:2202), rather than the typical Mendelian segregation ratio of 3:1, and no KanR homozygous plants were identified in the progeny. This result indicates that the mutant is defective in gametophytic function.
Genetic analysis of the ateif3f‐1 mutantKanR, kanamycin‐resistant; KanS, kanamycin‐sensitive; WT, wild‐type.To determine how the mutation affected male or female gametophytic functions, ateif3f‐1/+ plants were used as males or females in crosses with wild‐type plants. As shown in Table 1, when the ateif3f‐1/+ plants were used as female parents, 49.2% (766/1558) of the resulting F1 progeny were KanR. In contrast, when ateif3f‐1/+ pollen grains were used to pollinate wild‐type plants, only 3.76% (61/1621) of the F1 progeny were KanR. Thus the ateif3f‐1 mutation apparently drastically affected male gametophytic function and had little influence on female gametophytic function.
The ateif3f‐1 mutant is defective in pollen germination
To investigate how ateif3f‐1 affected male gametophytic function, we performed a quartet assay by introgression of the ateif3f‐1 mutation into the background of a quartet1‐2 (qrt1‐2) mutant. The qrt1‐2 mutation blocks separation of the pollen grains from tetrads and has almost no effect on pollen tube growth (Preuss ). Therefore, a quartet from an ateif3f‐1/+ qrt1‐2/qrt1‐2 plant has two ateif3f‐1 qrt1‐2 pollen grains (mutant) and two qrt1‐2 pollen grains (representing wild‐type) derived from the same microsporocyte. We first stained the mature quartet pollen grains from ateif3f‐1/+ qrt1‐2/qrt1‐2 plants using 4′,6‐diamidino‐2‐phenylindole (DAPI). The ateif3f‐1 qrt1‐2 pollen grains had two sperm nuclei and a vegetative nucleus like wild‐type pollen grains and were morphologically normal. Therefore, the ateif3f‐1 mutation affected neither the formation of pollen nor its mitotic division (Figure 1a,b).
Figure 1
Characterization of ateif3f‐1 mutant pollen. (a,b) DAPI‐stained quartet pollen grains from ateif3f‐1 /+ qrt1‐2/qrt1‐2 plants in light field (a) and under UV light (b). (c–f) In vitro germination of pollen grains from ateif3f‐1/+ qrt1‐2/qrt1‐2 plants (c), qrt1‐2/qrt1‐2 plants (d), ateif3f‐1/+ plants (e) and wild‐type plants (f). The mutant pollen grains are labelled using GUS staining. Pt, pollen tube. (g) Pollen germination rates of ateif3f‐1/+ and wild‐type plants. Scale bars = 25 μm.
Characterization of ateif3f‐1 mutant pollen. (a,b) DAPI‐stained quartet pollen grains from ateif3f‐1 /+ qrt1‐2/qrt1‐2 plants in light field (a) and under UV light (b). (c–f) In vitro germination of pollen grains from ateif3f‐1/+ qrt1‐2/qrt1‐2 plants (c), qrt1‐2/qrt1‐2 plants (d), ateif3f‐1/+ plants (e) and wild‐type plants (f). The mutant pollen grains are labelled using GUS staining. Pt, pollen tube. (g) Pollen germination rates of ateif3f‐1/+ and wild‐type plants. Scale bars = 25 μm.We examined germination of the pollen grains from ateif3f‐1/+ qrt1‐2/qrt1‐2 plants in vitro. Typically, the two ateif3f‐1 qrt1‐2 mutant pollen grains did not germinate, but the two qrt1‐2 pollen grains (representing wild‐type) did (Figure 1c). In the control, all four pollen grains germinated in an individual qrt1‐2 quartet (Figure 1d). Meanwhile, the mature pollen grains from ateif3f‐1/+ plants, which contained 50%ateif3f‐1 mutant pollen grains and 50% wild‐type pollen grains, were also cultured in vitro. GUS staining showed that, of the cultured pollen grains, the mutant pollen grains with GUS staining did not germinate or the pollen tube emerged but then stopped growing (Figure 1e), while the wild‐type pollen grains without GUS staining produced a normal pollen tube (Figure 1f). Statistical analysis showed that only 40.2% of the pollen grains from ateif3f‐1/+ plants (327/815) germinated in vitro, compared with 80.5% of the pollen grains from wild‐type plants (317/394) (Figure 1g). These results indicate that the ateif3f‐1 mutation strongly affects pollen germination and pollen tube growth.
The phenotype of ateif3f‐1 is caused by a Ds insertion in AteIF3f
To determine the insertion site of the Ds element in ateif3f‐1, the flanking sequence containing the Ds 3′ border sequence was obtained using thermal asymmetric interlaced PCR (TAIL‐PCR) (Liu and Whittier, 1995; Liu ). Sequence analysis indicated that the Ds element was inserted in the 5′ UTR of At2g39990, 13 bp downstream of the transcription start site and 70 bp upstream of the ATG (Figure 2a). This result was confirmed by PCR using gene‐specific and Ds 5′ border primers. The Ds insertion created a 6 bp (CGTCAG) duplication of the host sequence.
Figure 2
Characterization of the AteIF3f gene. (a) The organization of the AteIF3f gene, showing the Ds element and T‐DNA insertion sites. The black and white boxes indicate translated and untranslated regions, respectively. (b) Phylogenetic tree of eIF3f proteins from 16 species created from the eIF3f sequences from GenBank using DNAMAN software (http://www.lynnon.com). The sequence identities between any two clusters or two genes can be determined by aligning the vertical lines of the tree with the percentage scale bar.
Characterization of the AteIF3f gene. (a) The organization of the AteIF3f gene, showing the Ds element and T‐DNA insertion sites. The black and white boxes indicate translated and untranslated regions, respectively. (b) Phylogenetic tree of eIF3f proteins from 16 species created from the eIF3f sequences from GenBank using DNAMAN software (http://www.lynnon.com). The sequence identities between any two clusters or two genes can be determined by aligning the vertical lines of the tree with the percentage scale bar.At2g39990 encodes a protein that contains the typical MPN (Mpr1/Pad1 N‐terminal) domain conserved in eIF3f (see Figure S2) and has high similarity to the eIF3f proteins from human and yeast (Figure 2b). To confirm that the ateif3f‐1 mutant phenotype is caused by the Ds insertion in this gene, a 4.3 kb full‐length genomic DNA fragment of At2g39990, including the promoter and 5′ and 3′ UTRs, was subcloned into the pCAMBIA1300 vector. This construct was introduced into ateif3f‐1/+ plants. Transgenic lines were selected using kanamycin and hygromycin. The seeds from self‐pollinated T1 transgenic ateif3f‐1/+ plants were plated on kanamycin‐containing agar plates to analyse the Ds segregation ratio. Most of the transformant lines (19 of 22) showed an elevated KanR:KanS segregation ratio of approximately 2:1. The complemented mutant plants produced progeny that were homozygous for the ateif3f‐1 mutation in T2 and subsequent generations. When pollen grains from the two independent complemented lines homozygous for the ateif3f‐1 mutation were cultured in vitro, the germination rates increased to 74.9% (187/251) and 72.3% (175/244), close to the 80.3% (203/253) germination rate for wild‐type pollen grains (Figure 3a–c). These results demonstrate that the defect in gametophytic function in ateif3f‐1/+ plants was fully complemented by full‐length At2g39990 (AteIF3f) genomic DNA.
Figure 3
Complementation of the ateif3f‐1 mutant. (a) Pollen germination rates of the complemented plants 1 (Comp1) and 2 (Comp2) homozygous for the ateif3f‐1 mutation. (b,c) In vitro germination of pollen grains from ateif3f‐1 homozygous complemented lines (b) and wild‐type plants (c). GUS staining indicates that the pollen grains carry the ateif3f‐1 mutation. Pt, pollen tube. Scale bars = 30 μm. (d) Expression level of AteIF3f in ateif3f‐1/+ flowers compared to that in wild‐type plants.
Complementation of the ateif3f‐1 mutant. (a) Pollen germination rates of the complemented plants 1 (Comp1) and 2 (Comp2) homozygous for the ateif3f‐1 mutation. (b,c) In vitro germination of pollen grains from ateif3f‐1 homozygous complemented lines (b) and wild‐type plants (c). GUS staining indicates that the pollen grains carry the ateif3f‐1 mutation. Pt, pollen tube. Scale bars = 30 μm. (d) Expression level of AteIF3f in ateif3f‐1/+ flowers compared to that in wild‐type plants.We also examined the expression of AteIF3f in the ateif3f‐1 mutant using an ateif3f‐1/+ inflorescence RNA sample. The inflorescence transcriptome was mainly composed of the gametophytic transcriptome, that was contributed by 50% wild type and 50%ateif3f‐1 mutant gametophytes. The real‐time PCR results showed that expression of AteIF3f in the ateif3f‐1/+ inflorescences was greatly reduced compared to that in wild‐type plants (Figure 3d). Therefore, expression of AteIF3f was knocked down in ateif3f‐1 mutant gametophytes.To validate this result, ateif3f‐2 (FLAG_41307) was selected from the seed stocks of the Arabidopsis thaliana Resource Centre of the Versailles Genetics and Plant Breeding Laboratory (INRA, Paris, France). ateif3f‐2 is a T‐DNA insertion mutant in Arabidopsis ecotype Wassilewskija (WS). PCR analysis using a T‐DNA left‐border primer and a gene‐specific primer confirmed that T‐DNA was inserted in the 3rd exon, 954 bp downstream of the ATG in AteIF3f (Figure 2a and Figure S2). The mutant also carried a KanR‐selective marker. The progeny from self‐pollinated ateif3f‐2/+ plants also exhibited a KanR:KanS segregation ratio of approximately 1:1 (1132:1348), instead of 3:1. When a wild‐type AteIF3f full‐length genomic DNA construct was introduced into ateif3f‐2/+ plants, 17 of 20 T1 transgenic ateif3f‐2/+ lines showed an increased KanR:KanS segregation ratio of approximately 2:1. These findings are consistent with the results obtained from the study of ateif3f‐1/+ plants, and confirm that the defect in male gametophytes in ateif3f‐1 is caused by a mutation in AteIF3f.
AteIF3f is constitutively expressed, mostly in tissues active in cell growth and differentiation
To understand the function of AteIF3f, its expression pattern was assessed using RT‐PCR with RNA isolated from various wild‐type plant tissues. Expression of AteIF3f was detected in inflorescences, leaves, stems, siliques, roots and seedlings. Furthermore, the expression level of AteIF3f was different in the various tissues, with the highest level in inflorescences and the lowest level in stems (Figure 4a).
Figure 4
Expression pattern of AteIF3f. (a) RT‐PCR assay comparing the AteIF3f mRNA levels in inflorescences (In), leaves (Lv), stems (St), siliques (Sd), roots (Rt) and seedlings (Si). The expression level of the TUBULIN gene was used as an internal control. (b–f) GUS activity in inflorescences (b), anthers (c), mature leaves (d), developing seeds (e) and seedlings (f) from transgenic wild‐type plants carrying the pAteIF3f:GUS construct. Scale bars = 500 μm (b,d,f) and 50 μm (c,e).
Expression pattern of AteIF3f. (a) RT‐PCR assay comparing the AteIF3f mRNA levels in inflorescences (In), leaves (Lv), stems (St), siliques (Sd), roots (Rt) and seedlings (Si). The expression level of the TUBULIN gene was used as an internal control. (b–f) GUS activity in inflorescences (b), anthers (c), mature leaves (d), developing seeds (e) and seedlings (f) from transgenic wild‐type plants carrying the pAteIF3f:GUS construct. Scale bars = 500 μm (b,d,f) and 50 μm (c,e).To investigate the expression pattern of AteIF3f in detail, a promoter fragment of AteIF3f was fused to a GUS reporter gene and introduced into wild‐type plants. GUS activity was detected constitutively in many tissues, including pollen grains, embryos and root tips (Figure 4b–f).The expression pattern of the AteIF3f protein was further investigated using an AteIF3f–GFP fusion protein construct under the control of the AteIF3f promoter (pAteIF3f:AteIF3f‐GFP). The construct was introduced into the ateif3f‐1/+ mutant and wild‐type plants. Phenotypic and genetic analysis showed that this construct complemented the phenotype of the ateif3f‐1/+ mutant (Table S1), indicating that the AteIF3f–GFP fusion protein encodes a functional version of AteIF3f. GFP fluorescence was detected constitutively in many tissues, including the pollen grains, pollen tubes, embryos, ovules and root tips (Figure 5a–e). A magnified image of the GFP signal in a root tip cell showed that the fusion protein was localized in the cytoplasm (Figure 5f), which is consistent with the location of mRNA translation.
Figure 5
Expression of an AteIF3f–GFP fusion protein in various tissues. (a–f) GFP signals in mature pollen grains (a), pollen tubes (b), embryos (c), unfertilized ovules (d) and lateral root tips (e,f) from transgenic plants carrying the pAteIF3f:AteIF3f‐GFP construct. Scale bars = 20 μm (a,b,f) and 50 μm (c–e).
Expression of an AteIF3f–GFP fusion protein in various tissues. (a–f) GFP signals in mature pollen grains (a), pollen tubes (b), embryos (c), unfertilized ovules (d) and lateral root tips (e,f) from transgenic plants carrying the pAteIF3f:AteIF3f‐GFP construct. Scale bars = 20 μm (a,b,f) and 50 μm (c–e).
An ateif3f‐1 homozygous mutant generated by pollen rescue was defective in embryogenesis
To generate ateif3f‐1 homozygous plants for further investigation of AteIF3f function, we performed a pollen rescue experiment using promoters of the pollen‐specific genes VGD1 and LAT52 (Muschietti ; Jiang ) fused with AteIF3f cDNA. The resulting constructs, pLAT52:AteIF3f and pVGD1:AteIF3f, were introduced into ateif3f‐1/+ mutant plants to specifically rescue ateif3f‐1 pollen. Seeds from self‐pollinated T1 transgenic plants were plated on agar plates containing kanamycin. If the function of ateif3f‐1 pollen is fully recovered and the ateif3f‐1 homozygous seeds are able to grow normally, the KanR:KanS segregation ratio should increase to 2:1 according to Mendelian segregation. If the pollen function is fully complemented but the mutation causes embryonic lethality, the KanR:KanS segregation ratio should only increase to 1.5:1, and no ateif3f‐1 homozygous plants will be generated. The results showed that the KanR:KanS segregation ratio in the progeny from the pollen‐rescued plants was approximately 1.5:1, consistent with the second hypothesis.We investigated the embryogenesis process in pollen‐rescued lines that were heterozygous for the Ds insertion and homozygous for the T‐DNA insertion (ateif3f‐1/+ pLAT52:AteIF3f/pLAT52:AteIF3f or ateif3f‐1/+ pVGD1:AteIF3f/pVGD1:AteIF3f). In the siliques of these pollen‐rescued plants, approximately 25% (151:627) of the seeds were defective (Figure 6a,c) compared to seeds from wild‐type siliques (Figure 6b,d). The abnormal embryos stopped developing and started to degrade at various stages in different pollen‐rescued lines. We randomly selected four transgenic lines, two from each construct, for further observation. In one transgenic line, the abnormal embryo stopped developing at the early globular stage (Figure 6e) and started to degrade when the normal embryos in the same silique were at the transition (globular to heart) stage (Figure 6f). In the other two transgenic lines, the mutant embryos developed to the late globular stage but were inflated and abnormal (Figure 6g), while the normal embryos in the same silique had developed to the torpedo stage (Figure 6h). In a few cases, the abnormal embryo survived (Figure 6i) until the normal embryos matured (Figure 6j). Some of the defective embryos developed into mature seeds and gave rise to seedlings on regular MS medium (Figure 7a). These seedlings had malformations in body shape, lacked chlorophyll and had abnormal anthocyanin accumulation, suggesting that their cell division and plastid differentiation processes were affected. Sometimes they even lacked hypocotyls and cotyledons (Figure 7b–d), and their root cell structure was severely disordered and disperse (Figure 7e). A PCR assay using DNA from the defective ateif3f‐1 seedlings indicated that they were homozygous for the ateif3f‐1 mutation. Real‐time PCR and RT‐PCR assays using RNA extracted from ateif3f‐1 homozygous seedlings showed that expression of AteIF3f was dramatically lower in such seedlings (Figure 7f,g). Transgenic wild‐type plants with either pLAT52:AteIF3f cDNA or pVGD1:AteIF3f cDNA construct were also examined as negative controls. No defective embryos were found in these transgenic plants. Therefore, we conclude that the mutation in ateif3f‐1 leads to the embryo defect.
Figure 6
The mutation in AteIF3f affects embryo development. (a,b) Developing siliques from wild‐type plants (b) and ateif3f‐1/+ plants (a) carrying the pollen‐rescuing construct pVGD1:AteIF3f, showing the white defective seeds (white arrows). (c,d) Mature siliques from wild‐type plants (d) and ateif3f‐1/+ plants (c) carrying the pollen‐rescuing construct pVGD1:AteIF3f showing shrunken defective seeds (black arrows). (e,g,i) ateif3f‐1 homozygous embryos from the pollen‐rescued lines, arrested at the early globular (e), late globular (g) and torpedo (i) stages. (f,h,j) Normal embryos in the same siliques as (e,g,i). Scale bars = 200 μm (a–d), 10 μm (e,f) and 20 μm (g–j).
Figure 7
Characterization of ateif3f‐1 homozygous seedlings. (a) Comparison of an ateif3f‐1 homozygous seedling and a normal wild‐type seedling germinated under the same conditions. (b–d) Phenotypes of ateif3f‐1 homozygous seedlings, showing that some lacked cotyledons (d) and some lacked hypocotyls and roots (c). (e) Defective roots of ateif3f‐1 homozygous seedlings. (f,g) Comparison of AteIF3f expression levels in wild‐type seedlings and ateif3f‐1 homozygous seedlings by real‐time PCR (f) and RT‐PCR (g). Scale bars = 200 μm (a–d) and 100 μm (e).
The mutation in AteIF3f affects embryo development. (a,b) Developing siliques from wild‐type plants (b) and ateif3f‐1/+ plants (a) carrying the pollen‐rescuing construct pVGD1:AteIF3f, showing the white defective seeds (white arrows). (c,d) Mature siliques from wild‐type plants (d) and ateif3f‐1/+ plants (c) carrying the pollen‐rescuing construct pVGD1:AteIF3f showing shrunken defective seeds (black arrows). (e,g,i) ateif3f‐1 homozygous embryos from the pollen‐rescued lines, arrested at the early globular (e), late globular (g) and torpedo (i) stages. (f,h,j) Normal embryos in the same siliques as (e,g,i). Scale bars = 200 μm (a–d), 10 μm (e,f) and 20 μm (g–j).Characterization of ateif3f‐1 homozygous seedlings. (a) Comparison of an ateif3f‐1 homozygous seedling and a normal wild‐type seedling germinated under the same conditions. (b–d) Phenotypes of ateif3f‐1 homozygous seedlings, showing that some lacked cotyledons (d) and some lacked hypocotyls and roots (c). (e) Defective roots of ateif3f‐1 homozygous seedlings. (f,g) Comparison of AteIF3f expression levels in wild‐type seedlings and ateif3f‐1 homozygous seedlings by real‐time PCR (f) and RT‐PCR (g). Scale bars = 200 μm (a–d) and 100 μm (e).
The ateif3f‐1 mutation affects the expression of genes related to cell development in Arabidopsis
Due to the limited supply of ateif3f‐1 homozygous plant material, we analysed the transcriptome alterations in ateif3f‐1 homozygous seedlings in comparison with wild‐type seedlings using Affymetrix ATH1 genome arrays. Two biological replicates were performed, and the data from four ATH1 chips were analysed using affylmGUI software (Wettenhall ). The expression of 3185 genes was changed more than threefold in ateif3f‐1 homozygous seedlings compared to wild‐type seedlings (Appendices S1 and S2). The affected genes were involved in various biological processes, some of which are closely related to cell development. For example, AtCSLA7 is required for normal pollen tube growth, embryo development and endosperm proliferation (Goubet ). The microarray result showed that the expression level of AtCSLA7 in ateif3f‐1 homozygous seedlings was significantly lower than in wild‐type seedlings (Figure 8a). This result was confirmed by real‐time PCR and RT‐PCR (Figure 8a,b).
Figure 8
Mutation of AteIF3f affects the expression of downstream genes. Comparison of AtCSLA7 and ASN1 expression levels in ateif3f‐1 homozygous seedlings and wild‐type seedlings using microarray data and real‐time PCR (a,c) and RT‐PCR (b,d).
Mutation of AteIF3f affects the expression of downstream genes. Comparison of AtCSLA7 and ASN1 expression levels in ateif3f‐1 homozygous seedlings and wild‐type seedlings using microarray data and real‐time PCR (a,c) and RT‐PCR (b,d).Subunit eIF3h is involved in the sugar signalling pathway (Kim ), and so we looked particularly at sugar‐sensing genes. We found that the expression levels of the sugar response genes AT1G74670, ASPARAGINE SYNTHETASE1 (ASN1) and PROLINE DEHYDROGENASE2 (ProDH2) were reduced in the ateif3f‐1 homozygous seedlings to 1.4%, 2.4% and 25.3% of their levels in wild‐type seedlings, respectively (Figure 8c). The real‐time PCR and RT‐PCR assays confirmed that expression of ASN1 was significantly reduced in ateif3f‐1 homozygous seedlings (Figure 8c,d).
ateif3f‐1 has phenotypes similar to those of eif3h and eif3e mutants
The mutation in AteIF3f may affect expression of sugar‐sensing genes. To determine whether this was related to sugar responses, ateif3f‐1 seeds with the pollen‐rescuing construct were germinated on MS agar plates containing 0%, 1%, 2%, 4% or 6% (W/V) sucrose. After culturing for 6 days under light, the ateif3f‐1 homozygous seedlings exhibited a sugar‐sensitive phenotype, and grew best on medium without sucrose. Increasing sucrose concentrations may alter anthocyanin accumulation and repress chlorophyll synthesis (Figure 9a). Replacement of sucrose with glucose and maltose yielded similar results. When mannitol was substituted, however, the ateif3f‐1 homozygous seedlings synthesized chlorophyll at a similar level to that seen on the medium without any sugar (Figure 9b). This sugar‐sensitive phenotype is similar to the phenotype of eif3h‐1 seedlings previously reported (Kim ).
Figure 9
ateif3f‐1 homozygous seedlings are sensitive to exogenous sugars. (a) ateif3f‐1 homozygous and wild‐type seedlings cultured on MS medium containing various concentrations of sucrose. (b) ateif3f‐1 homozygous and wild‐type seedlings cultured on MS medium containing various sugars. Scale bars = 400 μm.
ateif3f‐1 homozygous seedlings are sensitive to exogenous sugars. (a) ateif3f‐1 homozygous and wild‐type seedlings cultured on MS medium containing various concentrations of sucrose. (b) ateif3f‐1 homozygous and wild‐type seedlings cultured on MS medium containing various sugars. Scale bars = 400 μm.To compare the ateif3f‐1 mutant with mutants for ArabidopsiseIF3e, eif3e‐1 (FLAG_495E05) was selected from the seed stocks of the Arabidopsis thaliana Resource Centre (ARC) at the Versailles Genetics and Plant Breeding Laboratory (INRA, Paris, France). In eif3e‐1, a T‐DNA is inserted in the 4th intron, in the middle of the eIF3e gene. The T‐DNA insertion also carries the KanR‐selective marker. No eif3e‐1 homozygous mutant plants were identified in the progeny. When an eif3e‐1/+ plant was self‐crossed, the KanR:KanS segregation ratio in the resulting progeny was approximately 0.73:1 (428:586) instead of the typical 3:1. When cultured in vitro, only 38.7% (210/543) of the pollen grains from eif3e‐1/+ plants germinated, compared to 78.8% (349/443) of the pollen grains from wild‐type plants under the same conditions. These results showed that the mutation in the eIF3e gene also affects pollen germination, consistent with the results reported previously (Yahalom ). Therefore, the ateif3f mutant has similar phenotypes to those of eif3e and eif3h mutants in Arabidopsis.
AteIF3f protein interacts with the Arabidopsis regulatory subunit eIF3e and eIF3h in yeast and plant cells
As described above, the phenotypes of the ateif3f mutant were similar to those of eif3e and eif3h. eIF3e and eIF3h interact directly with each other in Arabidopsis (Kim ). These three subunits probably have a very close relationship to each other. To assess their connections further, we investigated the interaction among them using yeast two‐hybrid (Y2H) assays. The coding regions of eIF3e and eIF3h cDNAs from Arabidopsis were subcloned into the pGADT7 vector to generate target fusion protein constructs, while that of AteIF3f cDNA was subcloned into the pGBKT7 vector to generate a bait fusion protein construct. Co‐expression of these bait and target constructs showed that AteIF3f interacts with ArabidopsiseIF3e and eIF3h in yeast (Figure 10).
Figure 10
AteIF3f protein interacts with Arabidopsis eIF3e and eIF3h in yeast. Yeast cells carrying different constructs were cultured on SD/Leu‐Trp medium and SD/Trp‐Leu‐His‐Ade medium. The blue colour indicates activation of reporter genes. AD, target construct vector; BD, bait construct vector.
AteIF3f protein interacts with ArabidopsiseIF3e and eIF3h in yeast. Yeast cells carrying different constructs were cultured on SD/Leu‐Trp medium and SD/Trp‐Leu‐His‐Ade medium. The blue colour indicates activation of reporter genes. AD, target construct vector; BD, bait construct vector.To support this result, a bimolecular fluorescence complementation (BiFC) assay was performed. The AteIF3f cDNA was subcloned into the vector pSPYNE‐35S to generate a fusion protein with an N‐terminus of yellow fluorescent protein (YFP) (AteIF3f–YN), and eIF3e and eIF3h cDNAs were subcloned into the vector pSPYCE‐35S to generate the C‐terminal YFP fusion proteins eIF3e–YC and eIF3h–YC. The constructs were introduced into an Agrobacterium tumefaciens strain. Pairs of strains expressing the AteIF3f–YN and eIF3e–YC constructs or the AteIF3f–YN and eIF3h–YC constructs were co‐transformed into tobacco leaves. Four pairs of negative control strains were also used to transform the tobacco leaf cells. In transformed tobacco leaf cells, YFP fluorescence was detected in the cytoplasm when AteIF3f–YN and eIF3e–YC or AteIF3f–YN and eIF3h–YC were co‐expressed (Figure 11a,b). No obvious fluorescent signal was detected by the expression of either AteIF3f–YN, eIF3e–YC or eIF3h–YC alone (Figure 11c–f). This result shows that AteIF3f interacts with eIF3e and eIF3h in plant cells.
Figure 11
BiFC assay indicating that the AteIF3f protein interacts with Arabidopsis eIF3e and eIF3h in tobacco leaf cells. Co‐expression of (a) AteIF3f–YN and eIF3e–YC, (b) AteIF3f–YN and eIF3h–YC, (c) YC and AteIF3f–YN, (d) YN and eIF3e–YC, (e) YN and eIF3h–YC, and (f) YC and YN. Scale bars = 30 μm.
BiFC assay indicating that the AteIF3f protein interacts with ArabidopsiseIF3e and eIF3h in tobacco leaf cells. Co‐expression of (a) AteIF3f–YN and eIF3e–YC, (b) AteIF3f–YN and eIF3h–YC, (c) YC and AteIF3f–YN, (d) YN and eIF3e–YC, (e) YN and eIF3h–YC, and (f) YC and YN. Scale bars = 30 μm.
Discussion
AteIF3f is important for normal cell growth and differentiation in Arabidopsis
In mammals, the subunit eIF3f is not essential for global translation initiation, but it has a wide range of roles in normal cell growth. For instance, eIF3f plays a central role in both the atrophic and the hypertrophic pathways in muscle cells. Genetic blockade of eIF3f expression induced atrophy. On the other hand, genetic activation of eIF3f promoted structural muscle protein synthesis and led to muscle hypertrophy (Csibi ). However, the roles of eIF3f in plant cells remain unknown. In this study, we found that a mutation in AteIF3f severely affected pollen germination and embryogenesis, providing evidence for an important role of AteIF3f in plant species. Transcriptome analysis of ateif3f‐1 homozygous seedlings showed that lack of AteIF3f significantly altered the expression of more than 3000 genes, many of which are important development‐related genes, for example AtCSLA7. We verified that the expression of AtCSLA7 was truly down‐regulated in the mutant using real‐time PCR. The expression of AtCSLA7 was reduced to about 7% of the wild‐type level in homozygous ateif3f‐1 mutant seedlings (Figure 8a). AtCSLA7 belongs to a subfamily of cellulose synthase‐like (CLS) genes that are involved in biosynthesis of the plant cell wall. Mutation in AtCSLA7 affected pollen tube growth and led to seed lethality (Goubet ). The microarray data also showed that ASN1, SCO1, AtNAP7 and CAO were significantly down‐regulated in the mutant seedlings. The expression level of SCO1 was reduced to 14% of the wild‐type level in homozygous ateif3f‐1 seedlings. Mutant sco1 (snowy cotyledon1) embryos produce undifferentiated proplastids, resulting in defects in greening of the cotyledons of sco1 seedlings (Albrecht ). The expression level of AtNAP1 was reduced to 31% of the wild‐type level in the ateif3f‐1 homozygous seedlings. The AtNAP7 protein is localized in the plastid. Mutation of AtNAP7 led to embryonic lethality at the globular stage. The atnap7 mutant contained abnormally developing plastids with disorganized thylakoid structures (Xu and Moller, 2004). Expression of the chlorophyllide a oxygenase (CAO) gene, which regulates chlorophyll b synthesis, was reduced to 2.5% of the wild‐type level in homozygous ateif3f‐1 seedlings (Espineda ; Yamasato ). In summary, these results imply that AtelF3f plays important roles in plant cell development, possibly by regulating the expression of genes important for normal pollen tube growth, embryo development, plastid differentiation and chlorophyll synthesis.Our results show that AteIF3f interacts with eIF3h. The ateif3f‐1 mutant was hypersensitive to exogenous sucrose, similar to the eif3h‐1 mutant (2004, 2007). It has been reported that eIF3h is involved in translational initiation of transcription factor ATB2/AtbZIP11 mRNA (2004, 2007). Previous studies proposed that ASN1 and ProDH2 were two direct targets of transcription factor ATB2/AtbZIP11 in Arabidopsis (Hanson ) and the translation of AtbZIP11 mRNA was repressed by sucrose (Rook ; Wiese ). Our microarray, real‐time PCR and RT‐PCR analyses all showed that the expression level of ASN1, the direct target of AtbZIP11, was drastically reduced in ateif3f‐1 homozygous seedlings (Figure 8c,d) (Hanson ). The microarray assay showed that expression of AtbZIP11 at the transcriptional level was not reduced in ateif3f‐1 homozygous seedlings compared to wild‐type seedlings. Thus, the ateif3f‐1 mutation did not affect the transcription of AtbZIP11 mRNA. However, we still lack direct protein evidence for the effect of the ateif3f‐1 mutation on AtbZIP11 mRNA translation due to a lack of ateif3f‐1 homozygous materials for protein preparation. Nevertheless, our results at least provide a clue that AtelF3f may affect the function of AtbZIP11 in expression of ASN1.In addition, AteIF3f was constitutively expressed at the highest level in actively growing tissues/cells such as pollen grains, pollen tubes, ovules, lateral root tips and embryos (4, 5), implying that AteIF3f may be more important in actively differentiating and proliferating tissues in Arabidopsis, such as the tissues involved in organ formation, than in other types of tissues. This assumption is consistent with the ateif3f‐1 mutant phenotypes observed in this study. For instance, the pollen tube growth of ateif3f‐1 was inhibited. In the pollen‐rescued mutant lines, the ateif3f‐1 homozygous embryos were defective in organogenesis. Cotyledon and root formation were severely affected in some ateif3f‐1 homozygous seedlings. These results indicate that AteIF3f is important for normal plant cell growth, especially for cells undergoing differentiation and organ formation.
The activity of the eIF3 complex might be regulated by interaction partnerships between AteIF3f, eIF3e and eIF3h
eIF3 is structurally related to two other protein complexes, the COP9 signalosome (CSN) and the 19S proteasome lid. Most subunits of all three complexes contain one of two signature motifs, the PCI (proteasome/CSN/eIF3) domain or the MPN domain (Hofmann and Bucher, 1998). The subunits of the three complexes share sequence homologies with each other, and have a common 6 PCI + 2 MPN domain structure (Kim ; Chang and Schwechheimer, 2004; Scheel and Hofmann, 2005). Thus, subunits from one complex can interact with subunits from other complexes (Karniol ; Yahalom ; Kim ; Huang ). In Arabidopsis, previous studies have shown that eIF3h directly interacts with eIF3a, eIF3b, eIF3c, eIF3e, CSN7 and CSN8 (Kim ). The subunit eIF3e was purified together with the COP9 signalosome when it was first identified in plants (Karniol ). eIF3e also exhibited subcellular co‐localization with CSN and was negatively regulated by CSN (2001, 2008). The multiple binding partnerships of eIF3e and eIF3h in Arabidopsis suggest that their activity might be regulated by these interacting proteins. In plant species, eIF3f has been identified from wheat and ArabidopsiseIF3 complexes. However, the interactive partners of eIF3f in plants remained unclear.In this study, we demonstrated that AteIF3f interacts with both ArabidopsiseIF3e and eIF3h in Y2H and BiFC assays. Although the interaction partners of eIF3f are less well known in plant cells, several binding partners and a potential binding site of eIF3f have been identified in humans and yeast. For example, eIF3f is involved in apoptosis by interacting with cyclin‐dependent kinase 11 (CDK11), which is an important effector in apoptosis (2003, 2009). Additionally, eIF3f interacts with coronavirus spike protein to inhibit host cell translation (Xiao ). eIF3f has also been reported to be a key target of the muscle‐specific E3 ubiquitin ligase MAFbx/Atrogin‐1 for ubiquitination and degradation by the proteasome during muscle atrophy (Csibi ). A possible binding site for mTOR (mammalian target of rapamycin) and S6K1 was found in the eIF3f subunit in mammals and yeast (Hinnebusch, 2006). The studies showed that the TOR signalling network regulates the translation and transcription of ribosomal components, and revealed that S6K1 phosphorylates several targets related to translation. eIF3f mediates the association between the eIF3 complex and mTOR or S6K1, which switch the eIF3 complex on and off (Holz ; Harris ). These results imply the existence of many potential binding partners for AteIF3f in Arabidopsis.The regulation of eIF3 activity might be tightly related to the protein interaction partners of AteIF3f, eIF3e and eIF3h. All the single mutants for AteIF3f, eIF3e and eIF3h have severe defects in plant cell growth, suggesting that the presence of the correct interacting partners of these subunits, including themselves, may be crucial for normal cell development.
Experimental procedures
Plant materials and growth conditions
The Arabidopsis thaliana plants used in this study were of the Landsberg erecta and Wassilewskija backgrounds. The plants were grown in soil at 22°C under a cycle of 16 h light/8 h dark. The generation of Ds insertion lines and the screening of mutants were performed as described by Sundaresan . The T‐DNA insertion line, FLAG_41307, was obtained from the Arabidopsis thaliana Resource Centre (ARC) at the Versailles Genetics and Plant Breeding Laboratory (INRA, Paris, France).
Localization of Ds and T‐DNA insertion sites in the ateif3f alleles
Isolation of the flanking sequences of the Ds element by TAIL‐PCR (Liu ) was performed as described previously (Yang ) using AteIF3f genomic DNA and Ds3/AD2 primer sets. The insertion site was confirmed by PCR using Ds‐specific primers (Ds5‐1, 5′‐CCGTTTACCGTTTTGTATATCCCCG‐3′; Ds5‐2, 5′‐CGTTCCGT‐TTTCGTTTTTTACC‐3′; Ds5‐3, 5′‐GGTCGGTACGGGATTTCCC‐3′) and the gene‐specific primer 5′‐CACCACCTATCCTTCGTAGAT‐3′.The T‐DNA insertion site in the FLAG_41307 line was confirmed by PCR using the T‐DNA left border‐specific primer 5′‐TCCGATTCAGTACAATCGATT‐3′ and the gene‐specific primer 5′‐TTGATGCCTTCTCCTACCTTC‐3′.
Characterization of pollen grains and pollen germination in vitro
Mature pollen grains were stained in a DAPI staining solution (0.1 m sodium phosphate, pH 7.0, 1 mm EDTA, 0.1% Triton X‐100 and 0.25 mg ml−1 DAPI). After incubation for 15 min, the stained pollen grains were viewed under UV light.Pollen germination in vitro was performed as described by Jiang . The number of germinating pollen grains was counted after incubation at 22–24°C for 6 h.
Complementation experiments
A 4.3 bp full‐length genomic DNA fragment of AteIF3f was amplified by PCR using primers 5′‐AACTGCAGAGTCGTGTGACTCACTGAG‐TC‐3′ and 5′‐ACGCGTCGACTATGTTCAGGACAGCTGACAT‐3′. The resulting fragment was cloned into the pCAMBIA1300 vector and introduced into ateif3f‐1 and ateif3f‐2 heterozygous plants by the Agrobacterium tumefaciens (strain GV3101)‐mediated infiltration method (Bechtold and Pelletier, 1998). Transformed plants were selected on MS medium supplied with 50 mg L−1 kanamycin and 20 mg L−1 hygromycin.The pollen rescue experiment was performed by pollen‐specific expression of AteIF3f full‐length cDNA in ateif3f‐1/+ plants. The AteIF3f full‐length cDNA was amplified using primers 5′‐GCTCTAGATTGATGCCTTCTCCTACCTTC‐3′ and 5′‐CGAGCTCCAACAAGAA‐GCTGATTCTTAC‐3′. The LAT52 promoter fragment was obtained from the plasmid pUCLNGFP2 (a gift from Dr Zhenbiao Yang, Department of Botany and Plant Science, University of California at Riverside, CA). The VGD1 promoter fragment was obtained from plasmid PME18 (Jiang ). The constructs were transformed into ateif3f‐1/+ plants.The short cDNA fragment was amplified by PCR using primers 5′‐GCTCTAGATTGATGCCTTCTCCTACCTTC‐3′ and 5′‐GGGGTACCTAGCATTTGAGCAGCTGTGTT‐3′ to produce the AteIF3f–GFP fusion protein construct. The fusion protein was driven by the native AteIF3f promoter. The resulting constructs were transformed into ateif3f‐1/+ plants to examine whether the fusion protein was functional.
GUS assay
Pollen grains and vegetative tissues were stained in a 100 mm phosphate buffer solution (pH 7.0) containing 0.5 mm potassium ferricyanide [K3Fe(CN)6], 0.5 mm potassium ferrocyanide [K4Fe(CN)6], 0.1% Triton X‐100, 10 mm EDTA and 0.5 mg ml−1 bromochloroindoyl‐β‐glucuronide (X‐Gluc). After incubation at 37°C overnight, the stained materials were clarified and observed as described by Jiang .
Microscopic observation of embryos
The embryos were treated in a clarifying solution for several minutes and observed using a Leica DM 2500 microscope (http://www.leica.com/). The clarifying solution contained 7.5 g gum arabic, 100 g chloral hydrate and 5 ml glycerol per 60 ml water.
RT‐PCR and real‐time PCR assays
Reverse transcription was performed using alfalfa mosaic virus reverse transcriptase (TaKaRa, http://www.takara-bio.com). TUBULIN cDNA was used as an internal control to normalize the amount of cDNA template. The primers 5′‐CTTCGTATTTGGTCAATCCGGTGC‐3′ and 5′‐GAACATGGCTGAGGCTGTCAAGTA‐3′ were used to amplify the TUBULIN cDNA fragment, and primers 5′‐TTGTCGGC‐TGGTATTCAACTG‐3′ and 5′‐CGAGCTCCAACAAGAAGCTGATTCTTAC‐3′ were used to analyse the AteIF3f expression levels in various tissues. The primers 5′‐GTTAGGATGTTCCGATGATTC‐3′ and 5′‐AGGCTCATAAGGCGTTGAAGG‐3′ were used to assess the expression level of ASN1.In real‐time PCR assays, first‐strand cDNA was synthesized using a SuperScript II kit (Invitrogen, http://www.invitrogen.com/). The expression levels of AteIF3f, ASN1 and AtCSLA7 were determined using Power SYBR Green PCR Master Mix on an ABI 7500 real‐time instrument (Applied Biosystems (http://www.appliedbiosystems.com/). The PCR program used was 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec and 60°C for 1 min. The 18S rRNA levels were quantified as an internal control to normalize the RNA quantity. The primers used to measure the expression levels of AteIF3f, ASN1 and AtCSLA7 are listed in Table S2. The relative mRNA levels were calculated by the comparative C
t method.
Microarray analysis
The RNA samples used in the microarray assay were extracted from wild‐type and ateif3f‐1 homozygous seedlings. Two biological replicates were taken. ATH1 genome arrays (Affymetrix, http://www.affymetrix.com) were used to assess the transcriptome differences between wild‐type and ateif3f‐1 homozygous seedlings. The raw data (CEL files) for four ATH1 chips were analysed using affylmGUI software (Wettenhall ). The genes whose expression was changed more than threefold were selected and grouped into down‐regulated and up‐regulated genes. More details of the microarray analysis are summarized in Appendices S1 and S2.
Yeast two‐hybrid assay
The yeast two‐hybrid assay was performed using Gal4 system vectors (Clontech, http://www.clontech.com/). The full‐length coding sequences of ArabidopsiseIF3e, AteIF3f and eIF3h were amplified by PCR using the primers listed in Table S2. The AteIF3f cDNA fragment was cloned into the pGBKT7 vector, and the eIF3e and eIF3h cDNA fragments were cloned into the pGADT7 vector and co‐transformed into yeast strain AH109.
BiFC assay
The coding sequences of ArabidopsiseIF3e, AteIF3f and eIF3h were amplified by PCR using the primers listed in Table S2. They were subcloned into vectors pSPYNE‐35S and pSPYCE‐35S (gift from Dr Shuhua Yang, College of Biological Sciences, China Agricultural University, Beijing, China) containing YFP fragments to form AteIF3f–YN, eIF3e–YC and eIF3h–YC fusion proteins. The constructs were introduced into Agrobacterium tumefaciens strain GV3101 by an electroporation method. The mixed strains were injected into 3‐week‐old tobacco leaves to transiently transform tobacco epidermal cells. Fluorescence was detected 3‐6 days after infiltration.
Acknowledgements
This work was supported by research grants from the Ministry of Sciences and Technology (project numbers 2007CB108700 and 2007CB947600), the Natural Science Foundation of China (project number 30530060) and the Ministry of Education (111 project numbered B06003). We thank Dr V. Sundaresan (Department of Plant Sciences, University of California, Davis), Dr Wei‐Cai Yang (Institute of Genetic and Development Biology, CAS, China) and Ms Li‐Fen Xie (Temasek Life Sciences Laboratory, Singapore) for their kind help with the mutant screen.Figure S1.
ateif3f‐1 mutant expressed
reporter GUS. (a) A wild type inflorescence. (b) An
ateif3f‐1/+ inflorescence, showing GUS staining specifically in anthers (pollen grains).Figure S2. Alignment of eIF3f protein sequences
from six species. AteIF3f (MPN: 29‐286aa) from
A. thaliana; Os05g0104800 (MPN: 20‐277aa) from
O. sativa; EIF3F (MPN: 92‐354aa) from
H. sapiens; Eif3f (MPN: 96‐361aa) from
M. musculus; SPBC4C3.07(MPN: 23‐298aa) from
S. pombe; CHLREDRAFT_120842 (MPN: 14‐281aa) from
C. reinhardtii. The rectangle box indicates the
position of the conserved MPN domain. The black arrow indicates the
T‐DNA insertion site in the ateif3f‐2.Table S1. Genetic analysis of
pAteIF3f:AteIF3f‐GFP transgenic ateif3f‑1 mutant lines.Table S2. Primers used in real‐time PCR, Y2H and BiFC assays.Appendix S1. Selected genes down‐regulated in
ateif3f‑1 homozygous seedlings.Appendix S2. Selected genes up‐regulated in
ateif3f‑1 homozygous seedlings.As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer‐reviewed and may be re‐organized for online delivery, but are not copy‐edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.Supporting info itemClick here for additional data file.Supporting info itemClick here for additional data file.Supporting info itemClick here for additional data file.Supporting info itemClick here for additional data file.Supporting info itemClick here for additional data file.
Authors: Adriana Doldan; Anupama Chandramouli; Reneé Shanas; Achyut Bhattacharyya; Stanley P L Leong; Mark A Nelson; Jiaqi Shi Journal: Mol Carcinog Date: 2008-10 Impact factor: 4.784
Authors: Chunshui Zhou; Fatih Arslan; Susan Wee; Srinivasan Krishnan; Alexander R Ivanov; Anna Oliva; Janet Leatherwood; Dieter A Wolf Journal: BMC Biol Date: 2005-05-17 Impact factor: 7.431
Authors: Laetitia B B Martin; Robert W Sherwood; Joshua J Nicklay; Yong Yang; Tara L Muratore-Schroeder; Elizabeth T Anderson; Theodore W Thannhauser; Jocelyn K C Rose; Sheng Zhang Journal: Proteomics Date: 2016-05-10 Impact factor: 3.984
Authors: Yvonne Schröter; Sebastian Steiner; Wolfram Weisheit; Maria Mittag; Thomas Pfannschmidt Journal: Front Plant Sci Date: 2014-10-29 Impact factor: 5.753
Authors: Sandra Missbach; Benjamin L Weis; Roman Martin; Stefan Simm; Markus T Bohnsack; Enrico Schleiff Journal: PLoS One Date: 2013-01-30 Impact factor: 3.240