| Literature DB >> 20407648 |
Abstract
The case of a 25-year-old medical student with bilateral pheochromocytoma is described. Following diagnostic testing, tumors were surgically removed. Genetic analysis revealed that the patient is a heterozygote with the following mutations on opposite homologs: G691S (exon 11) and S904S (TCC-TCG, exon 15), suggesting the diagnosis of multiple endocrine neoplasia 2A (MEN2A). A diagnosis of MEN2 would be an indication of thyroidectomy in this patient. Although this mutation is described in the literature, it has no known connection to pheochromocytomas. Therefore, it is unknown whether there is a causal connection between the G691S genotype and the pheochromocytomas in this patient. If so, G691S is to be added to the list of genotypes causing MEN2A. Here, the procedure of sequencing the RET protooncogene is described and a possible association between the G691S genotype and MEN2A is discussed.Entities:
Keywords: Genetics; multiple endocrine neoplasia; pheochromocytoma
Year: 2009 PMID: 20407648 PMCID: PMC2846568 DOI: 10.4103/0971-6866.50868
Source DB: PubMed Journal: Indian J Hum Genet ISSN: 1998-362X
Primer
| Exon | Primer sequence | Name | Tm | PCR product(bp) |
|---|---|---|---|---|
| 10 | GGACACTGCCCTGGAAATAT | ex10 F | 55,0 | 275 |
| TGTTGGGACCTCAGATGTGCTG | ex10 R | 55,3 | ||
| 11 | ATACGCAGCCTGTACCCAGT | ex11 F | 57,2 | 497 |
| CACAGACTGTCCCCACACAG | ex11 R | 57,1 | ||
| 12 | CCCCTGTCATCCTCACACTT | ex 12 F | 56,4 | 300 |
| CTCTTCAGGGTCCCATGCT | ex 12 R | 56,6 | ||
| 13 | TGACCTGGTATGGTCATGGA | ex 13 F | 54,6 | 249 |
| GGAGAACAGGGCTGTATGGA | ex 13 R | 55,9 | ||
| 14 | AAG ACC CAA GCT GCC TGA C | ex 14 F | 57,6 | 350 |
| CAT GGT GGG CTA GAG TGT GG | ex 14 R | 58,1 | ||
| 15 | CTGGTCACACCAGGCTGAG | ex 15 F | 60,5 | 288 |
| CGGTATCTTTCCTAGGCTTCC | ex 15 R | 60,5 | ||
| 16 | TCTCCTTTACCCCTCCTTCC | ex 16 F | 55,8 | 176 |
| TGTAACCTCCACCCCAAGAG | ex 16 R | 56,6 |
Polymerase chain reaction
| 11 μl | H2O |
| 1 μl | MgCl2 |
| 2 μl | Forward primer |
| 2 μl | Reverse primer |
| 2 μl | Master mix |
| 2 μl | DNA |
| 20 μl | Total volume |
Temperature protocol
| Temperature (°C) | Time (s) | For exon | Cycles |
|---|---|---|---|
| 96 | 600 | ||
| 96 | 10 | * | |
| 55 | 5 | 10,12,13 | * |
| 60 | 5 | 11,14,15,16 | * |
| 72 | 12 | * | |
| *35 cycles | |||
| 40 | 60 |
Cycle sequencing
| 8 μl | H2O |
| 8 μl | Master mix |
| 2 μl | Forward or reverse primer |
| 2 μl | PCR product |
Temperature protocol cycle sequencing
| Temperature (°C) | Time | Cycles |
|---|---|---|
| 96 | 20 s | * |
| 50 | 20 s | * |
| 60 | 4 min | * |
| *30 cycles | ||
| 4 |