Literature DB >> 20358281

The fluorescence properties and lifetime study of G-quadruplexes single- and double-labeled with pyrene.

Anna Dembska1, Bernard Juskowiak.   

Abstract

We report steady state fluorescence and lifetime emission studies of d(GGTTGGTGTGGTTGG) (TBA) and d(GGGTTAGGGTTAGGGTTAGGG) (Htelom) oligonucleotides labeled with pyrene through a 3-aminopropyl linker. Such G-rich sequences are able to self-assemble into G-quadruplexes, especially in the presence of specific cations like potassium. A comparative studies with single- and double-labeled G-quadruplexes were carried out. For each probe we have measured fluorescence decays for emission wavelength of 390 and 480 nm in the varying concentration of potassium ion. We have calculated average lifetimes <τ> for every system as well as the fractional distribution α(i) of emitting species.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20358281     DOI: 10.1007/s10895-010-0653-x

Source DB:  PubMed          Journal:  J Fluoresc        ISSN: 1053-0509            Impact factor:   2.217


  19 in total

1.  Light-switching excimer probes for rapid protein monitoring in complex biological fluids.

Authors:  Chaoyong James Yang; Steffen Jockusch; Marie Vicens; Nicholas J Turro; Weihong Tan
Journal:  Proc Natl Acad Sci U S A       Date:  2005-11-21       Impact factor: 11.205

2.  A pyrene-labeled G-quadruplex oligonucleotide as a fluorescent probe for potassium ion detection in biological applications.

Authors:  Satoru Nagatoishi; Takahiko Nojima; Bernard Juskowiak; Shigeori Takenaka
Journal:  Angew Chem Int Ed Engl       Date:  2005-08-12       Impact factor: 15.336

3.  Oxidation of guanine in G, GG, and GGG sequence contexts by aromatic pyrenyl radical cations and carbonate radical anions: relationship between kinetics and distribution of alkali-labile lesions.

Authors:  Young Ae Lee; Alexander Durandin; Peter C Dedon; Nicholas E Geacintov; Vladimir Shafirovich
Journal:  J Phys Chem B       Date:  2008-01-23       Impact factor: 2.991

4.  Analytical potential of the quadruplex DNA-based FRET probes.

Authors:  Bernard Juskowiak
Journal:  Anal Chim Acta       Date:  2006-02-03       Impact factor: 6.558

5.  Hybridization-dependent fluorescence of oligodeoxynucleotides incorporating new pyrene-modified adenosine residues.

Authors:  Kohji Seio; Masanhiro Mizuta; Kaori Tasaki; Keigo Tamaki; Akihiro Ohkubo; Mitsuo Sekine
Journal:  Bioorg Med Chem       Date:  2008-05-22       Impact factor: 3.641

6.  Fluorescence quenching properties of multiple pyrene-modified RNAs.

Authors:  Kenji Maie; Mitsunobu Nakamura; Tadao Takada; Kazushige Yamana
Journal:  Bioorg Med Chem       Date:  2009-06-06       Impact factor: 3.641

7.  Comparison of potassium ion preference of potassium-sensing oligonucleotides, PSO-1 and PSO-2, carrying the human and Oxytricha telomeric sequence, respectively.

Authors:  Shigeori Takenaka; Hiroyuki Ueyama; Takahiko Nojima; Makoto Takagi
Journal:  Anal Bioanal Chem       Date:  2003-03-20       Impact factor: 4.142

8.  Optimization of excimer-forming two-probe nucleic acid hybridization method with pyrene as a fluorophore.

Authors:  M Masuko; H Ohtani; K Ebata; A Shimadzu
Journal:  Nucleic Acids Res       Date:  1998-12-01       Impact factor: 16.971

9.  Interactions of sodium and potassium ions with oligonucleotides carrying human telomeric sequence and pyrene moieties at both termini.

Authors:  Hirohisa Hayashida; Jan Paczesny; Bernard Juskowiak; Shigeori Takenaka
Journal:  Bioorg Med Chem       Date:  2008-08-26       Impact factor: 3.641

10.  Quenching of fluorescent nucleobases by neighboring DNA: the "insulator" concept.

Authors:  James N Wilson; Younjin Cho; Samuel Tan; Andrea Cuppoletti; Eric T Kool
Journal:  Chembiochem       Date:  2008-01-25       Impact factor: 3.164

View more
  1 in total

Review 1.  Recent Advances in Nucleic Acid Targeting Probes and Supramolecular Constructs Based on Pyrene-Modified Oligonucleotides.

Authors:  Olga A Krasheninina; Darya S Novopashina; Evgeny K Apartsin; Alya G Venyaminova
Journal:  Molecules       Date:  2017-11-30       Impact factor: 4.411

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.