| Literature DB >> 20204130 |
Anne Mette Hoegh1, Rehannah Borup, Finn Cilius Nielsen, Steen Sørensen, Thomas V F Hviid.
Abstract
Several studies point to the placenta as the primary cause of pre-eclampsia. Our objective was to identify placental genes that may contribute to the development of pre-eclampsia. RNA was purified from tissue biopsies from eleven pre-eclamptic placentas and eighteen normal controls. Messenger RNA expression from pooled samples was analysed by microarrays. Verification of the expression of selected genes was performed using real-time PCR. A surprisingly low number of genes (21 out of 15,000) were identified as differentially expressed. Among these were genes not previously associated with pre-eclampsia as bradykinin B1 receptor and a 14-3-3 protein, but also genes that have already been connected with pre-eclampsia, for example, inhibin beta A subunit and leptin. A low number of genes were repeatedly identified as differentially expressed, because they may represent the endpoint of a cascade of events effectuated throughout gestation. They were associated with transcriptional regulation and vasoregulative pathways, along with a number of hypothetical proteins and gene sequences with unknown functions.Entities:
Mesh:
Substances:
Year: 2010 PMID: 20204130 PMCID: PMC2831461 DOI: 10.1155/2010/787545
Source DB: PubMed Journal: J Biomed Biotechnol ISSN: 1110-7243
Clinical data on the included women and deliveries.
| Pre-eclampsia | Control | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Chip pool | Age | Para | Weeks of gestation | Sex of child | Smoking | Delivery | Co-morbidities | Chip pool | Age | Para | Weeks of gestation | Sex of child | Smoking | Delivery |
| A | 26 | I | 39 | M | N | IL | ||||||||
| B | 32 | I | 33 | M | N | ES | ||||||||
| B | 25 | I | 39 | F | N | IL | ∗ | B | 26 | I | 39 | F | N | ES |
| B | 26 | I | 40 | M | N | IL | ||||||||
| C | 24 | I | 38 | F | N | V unc | C | 32 | I | 39 | F | N | V unc | |
| C | 29 | II | 37 | F | N | V unc | C | 30 | II | 39 | F | N | ES | |
| C | 35 | I | 37 | M | N | V unc | C | 33 | I | 38 | M | N | ES | |
| — | 29 | I | 32 | M | N | AS | ∗∗ | |||||||
| — | 24 | I | 36 | M | N | AS | ||||||||
| — | 27 | II | 38 | M | N | ES | ||||||||
| — | 34 | V | 38 | M | N | ES | ||||||||
| — | 29 | II | 39 | M | N | ES | ||||||||
| — | 38 | IV | 38 | F | N | ES | ||||||||
| — | 36 | III | 37 | M | N | ES | ||||||||
| — | 25 | I | 39 | F | N | ES | ||||||||
| — | 35 | II | 38 | M | N | ES | ||||||||
| — | 31 | II | 38 | M | N | ES | ||||||||
| — | 33 | II | 38 | F | N | AS | ||||||||
Italics mean no real-time PCR experiments performed. Paired pre-eclamptics and controls for microarray analysis are listed on the same line in the table. IL = induction of labour, ES = elective sectio, AS = acute section, V unc = uncomplicated vaginal delivery Co-morbidities: *abortus imminens, **possible HELLP.
Primers and PCR conditions.
| Gene target | Forward primer 5′-3′ | Reverse primer 5′-3′ | TDa a | TDa b | TDa c | TDa d | PCRb |
|---|---|---|---|---|---|---|---|
| °C/c | °C/c | °C/c | °C/c | °C/c | |||
| Fibulin 1A | aagttggcaggagtggagac | cccccataggtgaatcacag | 58/2 | 57/2 | 56/2 | — | 55/35 |
| sFLT-3 | taagcacaccacgcccagtc | aagaccgcttgccagctacg | 69/2 | 68/2 | 67/2 | — | 66/30 |
| Inhibin | gcttcatgtgggcaaagtcg | ccccctttaagcccacttcc | 64/2 | 62/ | 60/ | 59/2 | 58/30 |
| Leptin | gtccaagctgtgcccatcc | cccaggctgtccaaggtctc | 64/2 | 62/ | 60/ | 59/2 | 58/30 |
(a)Touchdown cycle, annealing temperature/number of cycles.
(b)PCR, annealing temperature/number of cycles.
Regulation of genes in pre-eclamptic placentas compared to controls.
| Accession1 | Gene of interest | Fold change | |
|---|---|---|---|
| NM_003330.1 | thioredoxin reductase 1 | −1.57 | .025 |
| U63296.1 | hydroxyprostaglandin dehydrogenase 15-(NAD+), | 1.48 | .027 |
| BC005939.1 | prostaglandin D2 synthase 21 kDa (brain) | −1.51 | .031 |
| AI761561 | hexokinase 2 | 1.59 | .045 |
| NM_000230.1 | leptin | 2.94 | .025 |
| AA502643 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein e | −1.65 | .005 |
| NM_002192.1 | inhibin, beta A subunit (activin A, activin AB alpha polypeptide) | 2.06 | .007 |
| NM_000494.1 | collagen, type XVII, alpha 1 | 1.50 | .039 |
| NM_006487.1 | fibulin 1A | −2.49 | .009 |
| AA972711 | zinc finger protein 292 | −1.37 | .024 |
| NM_005121.1 | thyroid hormone receptor-associated protein, 240 kDa subunit | −1.32 | .012 |
| NM_000710.1 | bradykinin B1 receptor | −1.44 | .024 |
| NM_013332.1 | hypoxia-inducible protein 2 | 1.61 | .029 |
| AI206718 | ESTs, Weakly similar to zinc finger protein 339 | 1.52 | .024 |
| AF052169.1 | hypothetical protein BC013764 | −1.46 | .033 |
| AF007149.1 | hypothetical protein LOC257407 | −1.40 | .035 |
| AK025495.1 | KIAA0790 protein | 1.56 | .041 |
| AK027231.1 | KIAA1102 protein | 1.54 | .003 |
| AB033025.1 | KIAA1199 protein | 1.59 | .040 |
| NM_004844.1 | SH3-domain binding protein 5 (BTK-associated), (signal transduction) | 1.58 | .030 |
| AF016535.1 | ATP-binding cassette, sub-family B (MDR/TAP), member 1, (transporter activity) | 1.45 | .037 |
1Genbank accession number.
Figure 1The interquartile range (IQR) values for the MVA plots show that the variation between the arrays within each group (case versus case or control versus control) is in the same range as the variation between the groups (case versus control). This indicates a high similarity between the case and control groups which is also apparent by the relatively low number of differentially expressed genes identified.
Figure 2The expression patterns of the sequences as determined by real-time PCR. White bars represent pre-eclampsia cases; grey bars represent controls. Each bar represents the mean (+SEM) relative expression of the individual samples in the experiment. P-values for comparisons between cases and controls were: Fibulin (.619; FC 1.46), leptin (.012; FC 3.41), inhibin (.500; FC 1.13), tyr 3-monooxygenase/tryp 5-monooxygenase activation protein ε (P = .166; FC − 1.27); Mann-Whitney test. (Pre-eclampsia cases: n = 9, controls: n = 12; one control placenta was found to have a cDNA yield which was significantly lower than the other samples and it was therefore excluded from the subsequent analyses.)