| Literature DB >> 20182630 |
Kai Lee Yap1, Michael J Hafez, Tsui-Lien Mao, Robert J Kurman, Kathleen M Murphy, Ie-Ming Shih.
Abstract
Gestational trophoblastic neoplasms (GTNs) are a rare group of neoplastic diseases composed of choriocarcinomas, placental site trophoblastic tumors (PSTTs) and epithelioid trophoblastic tumors (ETTs). Since these tumors are derivatives of fetal trophoblastic tissue, approximately 50% of GTN cases are expected to originate from a male conceptus and carry a Y-chromosomal complement according to a balanced sex ratio. To investigate this hypothesis, we carried out a comprehensive analysis by genotyping a relatively large sample size of 51 GTN cases using three independent sex chromosome genetic markers; Amelogenin, Protein Kinase and Zinc Finger have X and Y homologues that are distinguishable by their PCR product size. We found that all cases contained the X-chromosomal complement while only five (10%) of 51 tumors harbored the Y-chromosomal complement. Specifically, Y-chromosomal signals were detected in one (5%) of 19 choriocarcinomas, one (7%) of 15 PSTTs and three (18%) of 17 ETTs. The histopathological features of those with a Y-chromosome were similar to those without. Our results demonstrate the presence of a Y-chromosomal complement in GTNs, albeit a low 10% of cases. This shortfall of Y-chromosomal complements in GTNs may reinforce the notion that the majority of GTNs are derived from previous molar gestations.Entities:
Year: 2010 PMID: 20182630 PMCID: PMC2825661 DOI: 10.1155/2010/364508
Source DB: PubMed Journal: J Oncol ISSN: 1687-8450 Impact factor: 4.375
The primer sequences used to amplify the PRK and ZF loci.
| Primer Name | Sequence |
|---|---|
| PRK-F | 5′ FAM-TTTTGTTTCTTTCTGTCCATACTTAAAG 3′ |
| PRK-R | 5′ TCCCAAACCACTCAACTG 3′ |
| ZF-F | 5′ FAM-TGTGCATAACTTTGTTCCTGATG 3′ |
| ZF-R | 5′ AGCACTTGCTCAGGAATGATG 3′ |
The sex chromosome assignment in all the GTN samples.
| Case | Diagnosis |
|
|
| Y peak |
|---|---|---|---|---|---|
| CC1 | CC |
|
|
|
|
| CC2 | CC |
|
|
|
|
| CC3 | CC |
|
|
|
|
| CC4 | CC |
|
|
|
|
| CC5 | CC |
|
|
|
|
| CC6 | CC |
|
|
|
|
| CC7 | CC |
|
|
|
|
| CC8 | CC |
|
|
|
|
| CC9 | CC |
|
|
|
|
| CC10 | CC |
|
|
|
|
| CC11 | CC |
|
|
|
|
| CC12 | CC |
|
|
|
|
| CC13 | CC |
|
|
|
|
| CC14 | CC |
|
|
|
|
| CC15 | CC |
|
|
|
|
| CC16 | CC |
|
|
|
|
| CC17 | CC |
|
|
|
|
| CC18 | CC |
|
|
|
|
| CC19 | CC |
|
|
|
|
| ETT1 | ETT |
|
|
|
|
| ETT2 | ETT |
|
|
|
|
| ETT3 | ETT |
|
|
|
|
| ETT4 | ETT |
|
|
|
|
| ETT5 | ETT |
|
|
|
|
| ETT6 | ETT |
|
|
|
|
| ETT7 | ETT |
|
|
|
|
| ETT8 | ETT |
|
|
|
|
| ETT9 | ETT |
|
|
|
|
| ETT10 | ETT |
|
|
|
|
| ETT11 | ETT |
|
|
|
|
| ETT12 | ETT |
|
|
|
|
| ETT13 | ETT |
|
|
|
|
| ETT14 | ETT |
|
|
|
|
| ETT15 | ETT |
|
|
|
|
| ETT16 | ETT |
|
|
|
|
| ETT17 | ETT + CC |
|
|
|
|
| PSTT1 | PSTT |
|
|
|
|
| PSTT2 | PSTT |
|
|
|
|
| PSTT3 | PSTT |
|
|
|
|
| PSTT4 | PSTT |
|
|
|
|
| PSTT5 | PSTT |
|
|
|
|
| PSTT6 | PSTT |
|
|
|
|
| PSTT7 | PSTT |
|
|
|
|
| PSTT8 | PSTT |
|
|
|
|
| PSTT9 | PSTT |
|
|
|
|
| PSTT10 | PSTT |
|
|
|
|
| PSTT11 | PSTT |
|
|
|
|
| PSTT12 | PSTT |
|
|
|
|
| PSTT13 | PSTT |
|
|
|
|
| PSTT14 | PSTT |
|
|
|
|
| PSTT15 | PSTT + ETT |
|
|
|
|
CC: CHORIOCARCINOMA, ETT: EPITHELIOID TROPHOBLASTIC TUMOR, PSTT: PLACENTAL SITE TROPHOBLASTIC TUMOR.
Figure 1Histological features of gestational trophoblastic neoplasms. Choriocarcinoma is characterized by biphasic growth pattern composed of syncytiotrophoblast and mononucleate trophoblastic cells, forming vasculogenic mimicry. Placental site trophoblastic tumor (PSTT) is composed of confluent masses of neoplastic intermediate (extravillous) trophoblastic cells, infiltrating within smooth muscle cells. Epithelioid trophoblastic tumor (ETT) contains neoplastic chorionic-type intermediate (extravillous) trophoblastic cells surrounding an artery.
Figure 2Genotypes in representative trophoblastic tumor specimens. The presence of either the X or Y-chromosome in GTNs was determined by the analysis of three genes that have X and Y homologues distinguishable by their PCR product size; Amelogenin X and Y (AMELX and AMELY), Protein Kinase X and Y (PRKX and PRKY), and Zinc Finger X and Y (ZFX and ZFY). Arrows denote the Y chromosomal peaks.
Summary of percentage of tumor cases positive for a Y allele for at least one marker.
| Choriocarcinoma | ETT | PSTT | |
|---|---|---|---|
| Total case no. | 19 | 17 | 15 |
| With Y peaks | 1 | 3 | 1 |
| % with Y peaks | 5.3% | 17.6% | 6.7% |
| CI (95%) | 15.4%–0% | 35.7%–0% | 19.4%–0% |
ETT: epithelioid trophoblastic tumor; PSTT: placental site trophoblastic tumor; CI: confidence interval.