Phylogenetic lineages in the Capnodiales.

The Capnodiales incorporates plant and human pathogens, endophytes, saprobes and epiphytes, with a wide range of nutritional modes. Several species are lichenised, or occur as parasites on fungi, or animals. The aim of the present study was to use DNA sequence data of the nuclear ribosomal small and large subunit RNA genes to test the monophyly of the Capnodiales, and resolve families within the order. We designed primers to allow the amplification and sequencing of almost the complete nuclear ribosomal small and large subunit RNA genes. Other than the Capnodiaceae (sooty moulds), and the Davidiellaceae, which contains saprobes and plant pathogens, the order presently incorporates families of major plant pathological importance such as the Mycosphaerellaceae, Teratosphaeriaceae and Schizothyriaceae. The Piedraiaceae was not supported, but resolves in the Teratosphaeriaceae. The Dissoconiaceae is introduced as a new family to accommodate Dissoconium and Ramichloridium. Lichenisation, as well as the ability to be saprobic or plant pathogenic evolved more than once in several families, though the taxa in the upper clades of the tree lead us to conclude that the strictly plant pathogenic, nectrotrophic families evolved from saprobic ancestors (Capnodiaceae), which is the more primitive state.

INTRODUCTION

The Dothideomycetes encompasses plant and human pathogens, endophytes, saprobes and epiphytes. The class presently contains two subclasses, namely Pleosporomycetidae and Dothideomycetidae (Schoch et al. 2006, 2009a). Although the main orders, Pleosporales and Dothideales correlate with the presence or absence of pseudoparaphyses and other centrum characteristics, many orders remain unresolved. The Dothideomycetidae include the orders Dothideales, Capnodiales and Myriangiales, which lack paraphyses, pseudoparaphyses and periphysoids. Based on a multi-gene phylogeny, and the presence of ostiolar periphyses as possible synapomorphy, the Capnodiales were recognised as the order incorporating the Capnodiaceae, Davidiellaceae, Mycosphaerellaceae and Piedraiaceae (Schoch ). However, several studies (Hunter , Crous et al. 2007a, b) showed the Mycosphaerellaceae to be polyphyletic, and to contain additional variation at the familial level, leading to the circumscriptions of the Teratosphaeriaceae and Schizothyriaceae. Crous et al. (2009b, c) again revealed Teratosphaeriaceae to be too widely defined, including some further unresolved families.

The present study focuses on the Capnodiales, which is based on the Capnodiaceae, representing a group of leaf epiphytes associated with honeydew of insects, usually visible as a black growth on leaf surfaces, fruit and twigs. Members of the Capnodiaceae form superficial ascomata with fasciculate asci, and hyaline to dark, septate ascospores. Anamorphs are dematiaceous, and include mycelial (phragmo- to dictyoconidia), spermatial and pycnidial synanamorphs (Hughes 1976, Cheewangkoon ).

The Mycosphaerellaceae was treated as a family in the Dothideales by Hawksworth et al. (1995), while Kirk et al. (2001) introduced a separate order, the Mycosphaerellales for this family, and Kirk et al. (2008) again placed it in the Capnodiales. The Mycosphaerellaceae is recognised by having characteristic pseudothecial ascomata that can be immersed or superficial, embedded in host tissue or erumpent, having ostiolar periphyses, but lacking interascal tissue at maturity. Ascospores are hyaline, but in some cases slightly pigmented (Barr 1987), and predominantly 1-septate, although some taxa with 3-septate ascospores have been recorded (Crous ). Although up to 30 anamorph genera have been linked to Mycosphaerella (Crous et al. 2000, 2001, 2007a, b, c, 2009a, b, c, Crous 2009), recent studies have shown this to be incorrect, and that the family in fact consists of numerous genera with morphologically conserved Mycosphaerella-like teleomorphs, and distinct anamorphs (Crous et al. 2007a, b, 2009b, c).

Families tentatively placed in the Capnodiales (Lumbsch & Huhndorf 2007, Kirk ) include epiphytes (Antennulariellaceae, Capnodiaceae, Metacapnodiaceae) (Hughes 1976), saprobes and plant pathogens (Davidiellaceae, Dissoconiaceae, Mycosphaerellaceae, Schizothyriaceae, Teratosphaeriaceae) (Aptroot 2006, Crous 2009), and colonisers or hair shafts of mammals (Piedraiaceae) (de Hoog ). To address the status of the Capnodiales as an order, and the intrafamilial relationships within this order, DNA sequences of the 18S, 5.8S and 28S nrRNA genes were generated for a set of specifically selected taxa. A further aim was to clarify genera within these families, and resolve anamorph-teleomorph relationships for the taxa investigated.

MATERIALS AND METHODS

Isolates

Isolates were selected (Table 1 - see online Supplementary Information) that are representative of the Mycosphaerellaceae (Crous 1998, Crous et al. 2004a, c, 2006a, b, 2007a), Schizothyriaceae (Batzer et al. 2005, 2007), Teratosphaeriaceae (Crous et al. 2007a, 2008b, c, 2009a, b, c), Piedraiaceae (Kruys ), Davidiellaceae (Braun , Schubert et al. 2007a, b), Capnodiaceae (Schoch ), as well as numerous other genera for which the familial relationships have remained unclear, such as the Phaeophleospora complex (Crous et al. 1997, 2007a, 2009b, c, Andjic ), Polythrincium (Simon ), the Dissoconium complex (Crous et al. 2004c, 2007c, 2008b, Arzanlou ), and several less well-known genera represented by one or two species only. For fresh material excised leaf spots bearing ascomata were soaked in water for approximately 2 h, after which they were placed in the bottom of Petri dish lids, with the top half of the dish containing 2 % malt extract agar (MEA; Crous ). Ascospore germination patterns were examined after 24 h, and single-ascospore and conidial cultures established as described by Crous et al. (1991). Colonies were sub-cultured onto synthetic nutrient-poor agar (SNA), potato-dextrose agar (PDA), oatmeal agar (OA), MEA (Crous ), and incubated at 25 °C under continuous near-ultraviolet light to promote sporulation. Other cultures were obtained from the culture collection of the Centraalbureau voor Schimmelcultures (CBS-KNAW) in Utrecht, the Netherlands or the working collection of Pedro Crous (CPC).

Table 1.

Details of the isolates for which novel sequences were generated. Samples without an 18S rDNA accession number were only used in the 28S rDNA analysis; sequences of CBS 723.79 and CBS 123.26 were used in both analyses. The accession number for 5.8S nrDNA also includes the flanking spacer regions.

Species	Accession number1	Host	Country	Collector	GenBank Accession numbers 18S nrDNA, 5.8S nrDNA, 28S nrDNA
Aulographina pinorum	CBS 302.71; ETH 7129; UAMH 4037	Pinus maritima	France	E. Müller	—, GU214622, GU214393
Batcheloromyces leucadendri	CBS 110892; CPC 1837	Leucadendron sp.	South Africa	L. Swart	GU214515, AY260100, EU019246
Batcheloromyces proteae	CBS 110696; CPC 1518	Protea cynaroides	South Africa	L. Viljoen	AY251102, AY260099, EU019247
Brunneosphaerella protearum	CPC 13905	Protea sp.	South Africa	P.W. Crous	—, GU214623, GU214394
	CPC 13914	Protea sp.	South Africa	P.W. Crous	—, GU214624, GU214395
	CPC 15231	Protea nitida	South Africa	L. Mostert	—, GU214625, GU214396
	CPC 16338	Protea sp.	South Africa	P.W. Crous	—, GU214626, GU214397
Capnobotryella renispora	CBS 214.90; CBS 176.88; IAM 13014; JCM 6932; TNS F-198506	Capnobotrys neessii	Japan	J. Sugiyama	AY220612, AY220612, GU214398
	CBS 215.90; IAM 13015	Capnobotrys neessii	Japan	J. Sugiyama	AY220613, AY220613, GU214399
Capnodium coffeae	CBS 147.52	Coffea robusta	Zaire	—	DQ247808, AJ244239, GU214400
Catenulostroma chromoblastomycosum	CBS 597.97	Man, chromoblastomycosis	Zaire	V. de Brouwere	GU214516, AJ244260, EU019251
Catenulostroma elginense	CBS 111030; CPC 1958	Protea grandiceps	South Africa	J.E. Taylor	GU214517, AY260093, EU019252
Catenulostroma germanicum	CBS 539.88	Stone	Germany	—	GU214518, EU019253, EU019253
Catenulostroma microsporum	CBS 110890; CPC 1832	Protea cynaroides	South Africa	L. Swart	GU214520, AY260097, EU019255
Catenulostroma protearum	CBS 125421; CPC 15370	Leucadendron tinctum	South Africa	F. Roets	—, GU214627, GU214401
	CPC 15368	Hakea sericea	South Africa	F. Roets	—, GU214628, GU214402
	CPC 15369	Leucadendron tinctum	South Africa	F. Roets	—, GU214629, GU214403
Cercospora apii	CBS 118712	—	Fiji	P. Tyler	GU214653, GU214653, GU214653
Cercospora beticola	CBS 116456; CPC 11557	Beta vulgaris	Italy	V. Rossi	AY840527, AY840527, GU214404
Cercospora capsici	CPC 12307	Capsicum annuum	South Korea	H.D. Shin	GU214654, GU214654, GU214654
Cercospora janseana	CBS 145.37; CPC 4303; IMI 303642	Oryza sativa	U.S.A.	E.C. Tullis	AY251103, AY260064, GU214405
Cercospora sojina	CPC 12322	Glycine soja	South Korea	H.D. Shin	GU214655, GU214655, GU214655
Cercospora zebrinae	CBS 112893; CPC 3955	Trifolium protense	Canada	K. Seifert	AY251104, AY260078, GU214406
	CBS 118789; WAC 5106	Trifolium subterraneum	Australia	M.J. Barbetti	GU214656, GU214656, GU214656
	CBS 118790; IMI 262766; WAC 7973	Trifolium subterraneum	Australia	M.J. Barbetti	GU214657, GU214657, GU214657
Cercosporella virgaureae	CBS 113304	Erigeron annueus	South Korea	H.D. Shin	GU214658, GU214658, GU214658
Cladosporium bruhnei	CBS 115683; ATCC 66670; CPC 5101	CCA-treated Douglas-fir pole	U.S.A.	—	AY251096, AY251078, GU214408
	CBS 188.54; ATCC 11290; IMI 049638; CPC 3686	—	—	G.A. de Vries	AY251098, AY251077, EU019263
Cladosporium cladosporioides	CBS 109.21; ATCC 11277; ATCC 200940; CPC 3682; IFO 6368; IMI 049625	Hedera helix	U.K.	G.A. de Vries	AY251093, AY251073, EU019262
	CBS 401.80; CPC 3683	Triticum aestivum	Netherlands	N.J. Fokkema	AY251091, AY251074, GU214409
Cladosporium herbarum	CBS 723.79	Allium porrum	New Zealand	A.C. Jamieson	EU167558, EU167558, GU214410
Cladosporium sp.	CPC 15513	Rubus fruticosus	Italy	P.W. Crous	—, GU214630, GU214411
	CPC 15516	Pyrus communis	Ukraine	A. Akulov	—, GU214631, GU214412
Cladosporium uredinicola	ATCC 46649; CPC 5390	Quercus nigra	U.S.A.	G. Morgan-Jones	AY251097, AY251071, EU019264
Davidiella rosigena	CBS 330.51	Leaf spot in Rosa sp.	Netherlands	—	—, GU214632, GU214413
Devriesia hilliana	CBS 123187; CPC 15382	Macrozamia communis	New Zealand	C.F. Hill	—, GU214633, GU214414
Devriesia lagerstroemiae	CBS 125422; CPC 14403	Lagerstroemia indica	U.S.A.	P.W. Crous & M.J. Wingfield	—, GU214634, GU214415
Devriesia staurophora	CBS 375.81; ATCC 200934; CPC 3687	Páramo soil	Colombia	H. Valencia	EF137359, AF393723, GU214416
Devriesia strelitziicola	CBS 122480; X1045	Strelitzia sp.	South Africa	W. Gams & H. Glen	—, GU214635, GU214417
Dissoconium aciculare	CBS 201.89	Brassica sp.	Netherlands	T. Hijwegen	GU214522, AY725519, GU214418
	CBS 204.89	Astragalus sp.	Germany	T. Hijwegen	GU214523, AY725520, GU214419
	CBS 342.82; CPC 1534	Erysiphe, on Medicago lupulina	Germany	T. Hijwegen	GU214524, AF173308, EU019266
Dissoconium commune	CBS 110747; CPC 831	Eucalyptus nitens	South Africa	P.W. Crous	GU214525, AY725535, GU214420
	CBS 114238; CPC 10440	Eucalyptus globulus	Spain	J.P.M. Vazquez	GU214526, AY725541, EU019267
	CBS 114239; CPC 10492	Eucalyptus globulus	New Zealand	W. Gams	GU214527, AY725542, GU214421
Dissoconium dekkeri	CBS 110748; CMW 14906; CPC 825	Eucalyptus grandis	South Africa	G. Kemp	GU214528, AF309625, GU214422
	CBS 111169; CMW 5164; CPC 1232	Eucalyptus globulus	Zambia	—	GU214529, AY725550, GU214423
	CBS 111272; CPC 1188	Eucalyptus nitens	South Africa	M.J. Wingfield	GU214530, AY725551, GU214424
	CBS 111282; CPC 1233	Eucalyptus globulus	Zambia	—	GU214531, AF173305, GU214425
	CBS 567.89; CPC 1535	Juniperus chinensis	Netherlands	T. Hijwegen	AY251101, AF173309, EU019268
Dothistroma pini	CBS 116487; CMW 10951	Pinus nigra	U.S.A.	G. Adams	GU214532, AY808302, GU214426
Dothistroma septosporum	CBS 112498; CPC 3779	Pinus radiata	Ecuador	—	GU214533, AY293062, GU214427
Graphiopsis chlorocephala	CBS 121523; CPC 11969	Paeonia officinalis	Germany	K. Schubert	GU214534, EU009458, EU009458
Hortaea acidophila	CBS 113389	Lignite, pH 1	Germany	U. Hölker	—, GU214636, GU214428
Hortaea thailandica	CBS 125423; CPC 16651	Syzygium siamense	Thailand	P.W. Crous & K.D. Hyde	—, GU214637, GU214429
Lecanosticta acicola	CBS 871.95; MPFN 314	Pinus radiata	France	M. Morelet	GU214663, GU214663, GU214663
Leptoxyphium fumago	CBS 123.26; ATCC 11925; IMI 089363; LSHB X13	Hibiscus tiliaceus	Indonesia	—	GU214535, —, GU214430
Melanodothis caricis	CBS 860.72; ATCC 24309; DAOM 116433	Carex sitchensis	Canada	—	—, GU214638, GU214431
Miuraea persicae	CPC 10069	Prunus persica	South Korea	H.D. Shin	GU214660, GU214660, GU214660
Mycosphaerella acaciigena	CBS 112515; CPC 3837	Acacia mangium	Venezuela	M.J. Wingfield	AY251116, AY752143, GU214432
	CBS 112516; CPC 3838	Acacia mangium	Venezuela	M.J. Wingfield	GU214661, GU214661, GU214661
Mycosphaerella africana	CBS 116154; CMW 4945; CPC 794	Eucalyptus viminalis	South Africa	P.W. Crous	GU214536, AF173314, GU214433
Mycosphaerella bixae	CBS 111804; CPC 2554	Bixa orellana	Brazil	P.W. Crous & R.L. Benchimol	GU214557, AF362056, GU214455
Mycosphaerella ellipsoidea	CBS 110843; CPC 850	Eucalyptus cladocalyx	South Africa	P.W. Crous	GU214537, AY725545, GU214434
Mycosphaerella endophytica	CBS 114662; CPC 1193	Eucalyptus sp.	South Africa	P.W. Crous	GU214538, DQ302953, GU214435
Mycosphaerella graminicola	CBS 100335; IPO 69001.61	Triticum aestivum	—	G.H.J. Kema	GU214539, EU019297, EU019297
	CBS 110744; CPC 658	Triticum sp.	South Africa	P.W. Crous	AY251117, AF362068, EU019298
	CBS 115943; IPO323	Triticum aestivum	Netherlands	R. Daamen	GU214540, AF181692, GU214436
Mycosphaerella handelii	CBS 113302	Rhododendron sp.	Netherlands	P.W. Crous & U. Braun	EU167581, EU167581, GU214437
Mycosphaerella heimii	CBS 110682; CMW 4942; CPC 760	Eucalyptus sp.	Madagascar	P.W. Crous	GU214541, AF309606, GU214438
Mycosphaerella heimioides	CBS 111190; CMW 3046; CPC 1312	Eucalyptus sp.	Indonesia	M.J. Wingfield	GU214542, AF309609, GU214439
Mycosphaerella holualoana	CBS 110699; CPC 2155	Leucospermum sp.	U.S.A.: Hawaii	P.W. Crous	GU214543, AY260084, GU214440
Mycosphaerella irregulariramosa	CBS 111211; CPC 1362	Eucalyptus saligna	South Africa	M.J. Wingfield	GU214544, AF309608, GU214441
Mycosphaerella keniensis	CBS 111001; CMW 5147; CPC 1084	Eucalyptus grandis	Kenya	M.J. Wingfield	GU214545, AF173300, GU214442
Mycosphaerella latebrosa	CBS 652.85	Acer pseudoplatanus	Netherlands	H.A. van der Aa	AY251114, AF362067, GU214443
	CBS 687.94	Acer pseudoplatanus	Netherlands	G. Verkley	GU214546, AY152553, GU214444
Mycosphaerella lupini	CPC 1661	Lupinus sp.	U.S.A.	W. Kaiser	GU214547, AF362050, FJ839661
Mycosphaerella marasasii	CBS 110790; CPC 348	Syzygium cordatum	South Africa	M.J. Wingfield	GU214548, AF309591, GU214445
Mycosphaerella marksii	CBS 110942; CPC 982	Eucalyptus botryoides	Australia	A.J. Carnegie	GU214549, AF309589, GU214446
	CPC 11222	Eucalyptus grandis	Bolivia	M.J. Wingfield	GU214550, DQ302983, GU214447
Mycosphaerella parkii	CBS 387.92; CMW 14775; CPC 353	Eucalyptus grandis	Brazil	M.J. Wingfield	GU214551, AF309590, GU214448
Mycosphaerella sp.	CBS 111166; CPC 1224	Eucalyptus cladocalyx	South Africa	A.R. Wood	GU214552, AF173302, GU214449
	CBS 111167; CPC 1225	Eucalyptus cladocalyx	South Africa	A.R. Wood	GU214553, AF309593, GU214450
Mycosphaerella sphaerulinae	CBS 112621; CPC 4314	Eucalyptus sp.	Chile	—	GU214554, AY293066, GU214451
Mycosphaerella stromatosa	CBS 101953; CPC 1731	Protea sp.	South Africa	S. Denman	AY251115, EU167598, EU167598
Mycosphaerella tasmaniensis	CBS 111687; CMW 14780; CPC 1555	Eucalyptus nitens	Australia	—	GU214555, AF310107, GU214452
Passalora ageratinae	CBS 125419; CPC 15365	Ageratina adenophora	South Africa	A.R. Wood	—, GU214639, GU214453
Passalora bellynckii	CBS 150.49; CPC 3635	Cynanchum vincetoxicum	Switzerland	S. Blumer	GU214556, AF222831, GU214454
Passalora brachycarpa	CBS 115124	—	—	C.F. Hill	GU214664, GU214664, GU214664
Passalora armatae	CBS 125420; CPC 15419	Dalbergia armata	South Africa	A.R. Wood	—, GU214640, GU214456
Passalora dioscoreae	CPC 10855	Dioscorea tokora	South Korea	H.D. Shin	GU214665, GU214665, GU214665
Passalora dodonaea	CPC 1223	Dodonaea sp.	—	P.W. Crous	AY251108, GU214641, GU214457
Passalora eucalypti	CBS 111318; CPC 1457	Eucalyptus saligna	Brazil: Suzano	P.W. Crous	GU214558, AF309617, GU214458
Passalora fulva	CBS 119.46; CPC 3688	Lycopersicon esculentum	Netherlands	—	AY251109, AY251069, DQ008163
Passalora graminis	CBS 113303	Alopecurus aequalis var. amurensis	South Korea	H.D. Shin	GU214666, GU214666, GU214666
Passalora perplexa	CBS 116364; CPC 11150	Acacia crassicarpa	Indonesia	M.J. Wingfield	GU214559, AY752163, GU214459
Passalora sequoiae	CPC 11258	Juniperus virginiana	U.S.A.	C.S. Hodges	GU214667, GU214667, GU214667
Passalora sp.	CBS 115525; CPC 3951	Tilia americana	Canada	K. Seifert	GU214560, AY293064, GU214460
	CPC 12319	Ambrosia artemisifolia var. elatior	South Korea	H.D. Shin	GU214668, GU214668, GU214668
Passalora vaginae	CBS 140.34; DSM 1148; IMI 303641	Saccharum officinarum	Taiwan	—	GU214561, AF222832, GU214461
Passalora zambiae	CBS 112970; CPC 1228	Eucalyptus globulus	Zambia	T. Coutinho	GU214562, AY725522, EU019272
	CBS 112971; CMW 14782; CPC 1227	Eucalyptus globulus	Zambia	T. Coutinho	GU214563, AY725523, EU019273
Passalora-like genus	CPC 11876	Avicermia sp.	South Africa	W. Gams	GU214564, GU214642, GQ852622
Penidiella columbiana	CBS 486.80	Paepalanthus columbianus	Colombia	W. Gams	GU214565, AJ244261, EU019274
Phacellium paspali	CBS 113093; RoKI 1144	Setaria palmicola	Taiwan	R. Kirschner & C.-J. Chen	GU214669, GU214669, GU214669
Phaeophleospora atkinsonii	CBS 124565; ICMP 17860	Leaf of Hebe sp.	New Zealand	—	—, GU214643, GU214462
	CBS 124566; ICMP 17862	Leaf of Hebe sp.	New Zealand	—	—, GU214644, GU214463
Phaeophleospora eugeniicola	CPC 2557	Eugenia sp.	Brazil	—	GU214566, FJ493190, FJ493208
	CPC 2558	Eugenia sp.	Brazil	—	GU214567, FJ493191, FJ493209
Phloeospora maculans	CBS 115123	—	—	C.F. Hill	GU214670, GU214670, GU214670
Piedraia hortae var. hortae	CBS 374.71	Man	French Guiana	—	—, GU214645, GU214464
	CBS 375.71	Man	Brazil	—	—, GU214646, GU214465
	CBS 480.64; IHEM 3823; UAMH 4341	Man, hair	Brazil	—	—, GU214647, GU214466
Piedraia hortae var. paraguayensis	CBS 276.32; VKM F-393	—	—	—	—, GU214648, GU214467
Piedraia quintanilhae	CBS 327.63; IMI 101644	Genetta tigrina	Central African Republic	—	—, —, GU214468
Polychaeton citri	CBS 116435	Citrus aurantium, leaf, with Pseudococcus citri	Iran	R. Zare & W. Gams	—, GU214649, GU214469
Pseudocercospora angolensis	CBS 112933; CPC 4118	Citrus sp.	Zimbabwe	—	GU214568, AY260063, GU214470
	CBS 149.53; ATCC 11669	Citrus sinensis	Angola	—	AY251106, AF222847, GU214471
Pseudocercospora atromarginalis	CPC 11372	Solanum nigrum	South Korea	H.D. Shin	GU214671, GU214671, GU214671
Pseudocercospora chengtuensis	CPC 10785	Lycium chinense	South Korea	H.D. Shin	GU214672, GU214672, GU214672
Pseudocercospora cordiana	CBS 114685; CPC 2552	Cordia goeldiana	Brazil	P.W. Crous & R.L. Benchimol	GU214569, AF362054, GU214472
Pseudocercospora cruenta	CBS 462.75	Phaseolus sp.	Fiji	W. IJzermans-Lutgerhorst	AY251105, AF362065, GU214473
	CPC 10846	Vigna sp.	Trinidad	H. Booker	GU214673, GU214673, GU214673
Pseudocercospora eucommiae	CPC 10802	Eucommia ulmoides	South Korea	H.D. Shin	GU214674, GU214674, GU214674
Pseudocercospora fijiensis	X300	Musa sp.	Tonga	—	GU214570, AY752150, GU214474
Pseudocercospora fuligena	CPC 12296	Lycopersicum sp.	Thailand	—	GU214675, GU214675, GU214675
Pseudocercospora griseola f. griseola	CBS 194.47; ATCC 22393	Phaseolus vulgaris	Portugal	—	DQ289861, DQ289801, GU214475
	CBS 880.72	Phaseolus vulgaris	Netherlands	H. A. v. Kesteren	DQ289862, DQ289802, GU214476
Pseudocercospora humuli	CPC 11358	Humulus japonicus	South Korea	H.D. Shin	GU214676, GU214676, GU214676
Pseudocercospora kaki	CPC 10636	Diospyros lotus	South Korea	H.D. Shin	GU214677, GU214677, GU214677
Pseudocercospora luzardii	CPC 2556	Hancornia speciosa	Brazil	A.C. Alfenas & P.W. Crous	GU214571, AF362057, GU214477
Pseudocercospora macrospora	CBS 114696; CPC 2553	Bertholletia excelsa	Brazil	P.W. Crous & R.L. Benchimol	GU214572, AF362055, GU214478
Pseudocercospora ocimicola	CPC 10283	Ocimum basilicum	Mexico	M.E. Palm	GU214678, GU214678, GU214678
Pseudocercospora opuntiae	CBS 117708; CPC 11772	Opuntia sp.	Mexico	M. De Jesus Yanez	GU214679, GU214679, GU214679
Pseudocercospora pallida	CPC 10776	Campsis grandiflora	South Korea	H.D. Shin	GU214680, GU214680, GU214680
Pseudocercospora paraguayensis	CBS 111317; CPC 1458	Eucalyptus nitens	Brazil: Suzano	P.W. Crous	GU214573, AF309596, GU214479
Pseudocercospora protearum var. leucadendri	CPC 1869	Leucadendron sp.	South Africa	S. Denman & P.W. Crous	AY251107, AY260089, GU214480
Pseudocercospora pseudoeucalyptorum	CBS 114242; CMW 14908; CPC 10390	Eucalyptus globulus	Spain	J.P.M. Vazquez	GU214574, AY725526, GU214481
Pseudocercospora punctata	CBS 113315	Syzygium cordatum	South Africa	M.J. Wingfield	EU167582, EU167582, GU214407
	CPC 10532	Syzygium cordatum	South Africa	M.J. Wingfield	GU214659, GU214659, GU214659
Pseudocercospora sp.	CPC 11592	Zelkova serrata	South Korea	H.D. Shin	GU214575, DQ303085, GU214482
Pseudocercospora vitis	CPC 11595	Vitis vinifera	South Korea	H.D. Shin	DQ073923, DQ073923, GU214483
Pseudocercospora-like genus	CPC 10712	Quercus sp.	Netherlands	G. Verkley	GU214681, GU214681, GU214681
Pseudocercosporella capsellae	CPC 10301	Brassica sp.	U.K.	R. Evans	GU214662, GU214662, GU214662
Pseudocercosporella fraxini	CPC 11509	Fraxinus rhynchophylla	South Korea	H.D. Shin	GU214682, GU214682, GU214682
Pseudocercosporella sp.	CBS 112737; CPC 3959	Rhus typhina	Canada	K. Seifert	GU214684, GU214684, GU214684
	CPC 4008	Rhys typhina	Canada	K. Seifert	GU214686, GU214686, GU214686
	CPC 10050	Rubus oldhamii	South Korea	H.D. Shin	GU214685, GU214685, GU214685
	CPC 11414	Vicia amurense	South Korea	H.D. Shin	GU214683, GU214683, GU214683
Pseudotaeniolina globosa	CBS 109889	Rock	Italy	C. Urzi	GU214576, AY128700, EU019283
Rachicladosporium cboliae	CBS 125424; CPC 14034	Twig debris	U.S.A.	P.W. Crous	—, GU214650, GU214484
Ramichloridium apiculatum	CPC 12310	Vicia amurensis	South Korea	H.D. Shin	GU214687, GU214687, GU214687
Ramichloridium cerophilum	CBS 103.59; MUCL 10034	Sasa sp.	Japan	—	EU041798, EU041798, GU214485
Ramichloridium musae	CBS 190.63; MUCL 9557	Musa sapientum	—	—	GU214577, EU041800, EU041857
Ramichloridium-like genus	CPC 10672	Phellodendron amurense	South Korea	H.D. Shin	GU214688, GU214688, GU214688
Ramularia acroptili	CBS 120252	Acroptilon repens	Turkey	R. Sobhian	GU214689, GU214689, GU214689
Ramularia brunnea	CPC 4903	—	—	—	GU214691, GU214691, GU214691
Ramularia coleosporii	CPC 11516	Plectranthus excisus	South Korea	H.D. Shin	GU214692, GU214692, GU214692
Ramularia endophylla	CBS 113265	Quercus robur	Netherlands	G. Verkley	AY490775, AY490763, AY490776
Ramularia grevilleana	CPC 656	Fragaria sp.	South Africa	P.W. Crous	GU214578, AF173312, GU214486
Ramularia nagornyi	CBS 120253	Centaurea solstitiales	Greece	D. Berner	GU214579, EU019257, EU019257
Ramularia pratensis var. pratensis	CPC 11294	Rumex crispus	South Korea	H.D. Shin	GU214580, EU019284, EU019284
Ramularia sp.	CBS 324.87	leaf spot on Brassica sp., in Mycosphaerella sp.	Netherlands	—	GU214581, EU019285, EU019285
	CPC 10066	Alangium plataniflium	South Korea	H.D. Shin	GU214690, GU214690, GU214690
	CPC 11297	Stellaria aquatica	South Korea	H.D. Shin	GU214693, GU214693, GU214693
Ramularia uredinicola	CPC 10813	Salix sp.	South Korea	H.D. Shin	GU214694, GU214694, GU214694
Ramularia-like genus	CPC 10852	Polygonum sp.	South Korea	H.D. Shin	GU214695, GU214695, GU214695
Ramulispora sorghi	CBS 110578; CPC 905	Sorghum sp.	South Africa	D. Nowell	AY251110, AY259131, GU214487
	CBS 110579; CPC 906	Sorghum sp.	South Africa	D. Nowell	AY251111, AY259132, GU214488
Readeriella dimorphospora	CBS 120034; CPC 12636	Eucalyptus nitens	Australia	—	GU214521, EF394850, EU019258
Readeriella mirabilis	CBS 116293; CPC 10506	Eucalyptus fastigata	New Zealand	W. Gams	EU754110, AY725529, EU019291
Schizothyrium pomi	CBS 228.57	—	Italy	R. Ciferri	EF134947, EF134947, EF134947
	CBS 406.61	Rubus idaeus	Netherlands	—	EF134949, EF134949, EF134949
	CBS 486.50	Polygonum sachalinense	Netherlands	—	EF134948, EF134948, EF134948
Scorias spongiosa	CBS 325.33	Aphid	—	—	GU214696, GU214696, GU214696
Septoria apiicola	CBS 400.54; IMI 092628	Apium graveolens	Netherlands	J.A. von Arx	GU214584, AY152574, GU214490
Septoria convolvuli	CBS 102325	Calystegia sepium	Netherlands	G. Verkley	GU214697, GU214697, GU214697
Septoria cucubali	CBS 102368	Cucubalus baccifer	Netherlands	G. Verkley	GU214698, GU214698, GU214698
Septoria dysentericae	CPC 12328	Daucus carota	Brazil	N. Massola	GU214699, GU214699, GU214699
Septoria lactucae	CBS 352.58	Lactuca sativa	Germany	—	GU214585, AY489282, GU214491
Septoria leucanthemi	CBS 109090	Chrysanthemum leucanthemum	Austria	G. Verkley	GU214586, AY489277, GU214492
Septoria obesa	CBS 354.58; BBA 8554; IMI 091324	Chrysanthemum indicum	Germany	—	GU214587, AY489285, GU214493
Septoria protearum	CPC 1470	Protea cynaroides	South Africa	L. Viljoen	GU214588, AY260081, GU214494
Septoria pyricola	CBS 222.31; CPC 3677	Pyrus communis	—	—	GU214589, AY152591, GU214495
Septoria quercicola	CBS 663.94	Quercus robur	Netherlands	—	GU214590, AY490771, GU214496
Septoria rosae	CBS 355.58; ATCC 24311; PD 341; CPC 4302	Rosa sp.	—	—	AY251113, AY293065, GU214497
Septoria senecionis	CBS 102366	Senecio fluviatilis	Netherlands	G. Verkley	GU214591, AY489272, GU214498
Septoria-like genus	CBS 102377	Castanea sativa	Netherlands	G. Verkley	GU214592, AY152588, GU214499
Sonderhenia eucalypticola	CPC 11252	Eucalyptus globulus	Spain	M.J. Wingfield	GU214593, DQ303064, GU214500
Sphaerulina polyspora	CBS 354.29	—	—	—	—, GU214651, GU214501
Staninwardia suttonii	CBS 120061; CPC 13055	Eucalyptus robusta	Australia	B.A. Summerell	GU214594, DQ923535, DQ923535
Stenella araguata	CBS 105.75; ATCC 24788; FMC 245	Man	Venezuela	—	GU214596, EU019250, EU019250
Stigmina platani	CBS 110755; IMI 136770; CPC 4299	Platanus orientalis	India	—	GU214598, AY260090, FJ839663
Stigmina synanamorph	CPC 11721	Platanus occidentalis	South Korea	H.D. Shin	GU214700, GU214700, GU214700
Stomiopeltis betulae	CBS 114420	Betula sp.	Sweden	K. & L. Holm	GU214701, GU214701, GU214701
Teratosphaeria aff. nubilosa	CBS 114419; CPC 10497	Eucalyptus globulus	New Zealand	—	GU214599, AY725574, EU019303
	CBS 116283; CPC 10495	Eucalyptus globulus	Spain	W. Gams	GU214600, AY725573, GU214503
Teratosphaeria alcornii	CBS 313.76; CPC 3632	Eucalyptus tessellaris	Australia	J.L. Alcorn	GU214514, AF362061, EU019245
Teratosphaeria angophorae	CBS 120493; DAR 77452	Angophora floribunda	Australia	A.J. Carnegie	—, GU214652, GU214504
Teratosphaeria bellula	CBS 111700; CPC 1821; JT 196	Protea eximia	South Africa	J.E. Taylor	GU214601, EU019301, EU019301
Teratosphaeria cryptica	CBS 110975; CMW 3279; CPC 936	Eucalyptus globulus	Australia	A.J. Carnegie	GU214602, AF309623, GU214505
Teratosphaeria destructans	CBS 111369; CPC 1366	Eucalyptus grandis	Indonesia	M.J. Wingfield	GU214603, DQ267595, EU019287
	CBS 111370; CPC 1368	Eucalyptus sp.	Indonesia	P.W. Crous	GU214702, GU214702, GU214702
Teratosphaeria fibrillosa	CPC 1876	Protea nitida	South Africa	J.E. Taylor	EU019282, EU019282, GU214506
Teratosphaeria juvenalis	CBS 110906; CMW 13347; CPC 40	Eucalyptus cladocalyx	South Africa	P.W. Crous	AY720715, AY725513, FJ493217
	CBS 111149; CPC 23	Eucalyptus cladocalyx	South Africa	P.W. Crous	AY720714, AY725514, EU019294
Teratosphaeria macowanii	CBS 110756; CPC 1872	Protea nitida	South Africa	J.E. Taylor	GU214519, AY260095, EU019254
	CBS 111029; CPC 1488	Protea sp.	South Africa	P.W. Crous	AY251118, AY260096, FJ493199
Teratosphaeria mexicana	CBS 110502; CMW 14461	Eucalyptus globulus	Australia	—	GU214604, AY725558, GU214507
	CBS 120744; CPC 12349	Eucalyptus sp.	U.S.A.: Hawaii	W. Gams	GU214605, EU019302, EU019302
Teratosphaeria molleriana	CBS 111164; CMW 4940; CPC 1214	Eucalyptus globulus	Portugal	M.J. Wingfield	GU214606, AF309620, EU019292
	CBS 116370; CPC 10397	Eucalyptus globulus	Spain	J.P.M. Vazquez	GU214607, AY725561, GU214508
	CPC 4577	Eucalyptus sp.	Australia	—	GU214582, AY725524, GU214489
Teratosphaeria nubilosa	CBS 115669; CPC 933	Eucalyptus nitens	South Africa	M.J. Wingfield	GU214608, AY725548, GU214509
	CBS 116005; CMW 3282; CPC 937	Eucalyptus globulus	Australia	A.J. Carnegie	GU214609, AY725572, GU214510
Teratosphaeria ohnowa	CBS 112896; CMW 4937; CPC 1004	Eucalyptus grandis	South Africa	M.J. Wingfield	AY251119, AF309604, EU019305
	CBS 112973; CMW 4936; CPC 1005	Eucalyptus grandis	South Africa	M.J. Wingfield	GU214610, AF309605, GU214511
Teratosphaeria pseudosuberosa	CBS 118911; CPC 12085	Eucalyptus sp.	Uruguay	M.J. Wingfield	GU214611, DQ303011, EU019256
Teratosphaeria secundaria	CBS 115608; CPC 504	Eucalyptus grandis	Brazil	A.C. Alfenas	GU214612, DQ303018, EU019306
Teratosphaeria sp.	CBS 208.94; CPC 727	Eucalyptus grandis	Indonesia	A.C. Alfenas	GU214613, AY626982, EU019307
Teratosphaeria stellenboschiana	CBS 116428; CPC 10886	Eucalyptus sp.	South Africa	P.W. Crous	GU214583, AY725518, EU019295
Teratosphaeria suberosa	CPC 11032	Eucalyptus sp.	Colombia	M.J. Wingfield	GU214614, DQ303044, GU214512
Teratosphaeria suttonii	CPC 11279	Eucalyptus tereticornis	Bolivia	M.J. Wingfield	GU214615, DQ303055, FJ493222
	CPC 12352	Eucalyptus sp.	U.S.A.: Hawaii	W. Gams	GU214616, EU019288, EU019288
Teratosphaeria toledana	CBS 113313; CMW 14457	Eucalyptus sp.	Spain	P.W. Crous & G. Bills	GU214617, AY725580, GU214513
	CBS 115513; CPC 10840	Eucalyptus sp.	Spain	P.W. Crous & G. Bills	GU214618, FJ493198, FJ493225
Teratosphaeria verrucosa	CPC 18	Eucalyptus cladocalyx	South Africa	P.W. Crous	AY720713, AY725517, EU019293
Thedgonia-like genus	CPC 12304	Oplismenus undulatifolius	South Korea	H.D. Shin	GU214703, GU214703, GU214703
Toxicocladosporium irritans	CBS 185.58	Mouldy paint	Suriname	M.B. Schol-Schwarz	GU214619, EU040243, EU040243
Verrucisporota daviesiae	CBS 116002; VPRI 31767	Daviesia latifolia	Australia	V. Beilharz	GU214620, FJ839633, FJ839669
Verrucisporota proteacearum	CBS 116003; VPRI 31812	Grevillea sp.	Australia	J.L. Alcorn	GU214621, FJ839635, FJ839671
Zasmidium anthuriicola	CBS 118742	Anthurium sp.	Thailand	C.F. Hill	GU214595, FJ839626, FJ839662
Zasmidium citri	CBS 116366; CMW 11730; CPC 10522	Acacia mangium	Thailand	K. Pongpanich	GU214597, AY752145, GU214502

ATCC: American Type Culture Collection, Virginia, U.S.A.; BBA: Biologische Bundesanstalt für Land- und Forstwirtschaft, Berlin-Dahlem, Germany; CBS: Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; CMW: Culture Collection of the Forestry and Agricultural Biotechnology Institute (FABI) of the University of Pretoria, Pretoria, South Africa; CPC: Culture collection of Pedro Crous, housed at CBS; DAOM: Plant Research Institute, Department of Agriculture (Mycology), Ottawa, Canada; DAR: Plant Pathology Herbarium, Orange Agricultural Institute, Forest Road, Orange. NSW 2800, Australia; DSM: Deutsche Sammlung von Mikrorrganismen und Zellkulturen GmbH, Braunschweig, Germany; ETH: Swiss Federal Institute of Technology Culture Collection, Zurich, Switzerland; FMC: Venezuelan School of Medicine; IAM: IAM Culture Collection, Institute of Molecular and Cellular Biosciences, The University of Tokyo, Japan; ICMP: International Collection of Micro-organisms from Plants, Landcare Research, Private Bag 92170, Auckland, New Zealand; IFO: Institute for Fermentation, Osaka, Japan; IHEM: Collection of the Laboratorium voor Microbiologie en Microbiele Genetica, Rijksuniversiteit, Ledeganckstraat 35, B-9000, Gent, Belgium; IMI: International Mycological Institute, CABI-Bioscience, Egham, Bakeham Lane, U.K.; IPO: Culture collection of the Research Institute for Plant Protection, Wageningen, The Netherlands; JCM: Japan Collection of Microorganism, RIKEN BioResource Center, Japan; JT: Working collection of Joanne E. Taylor; LSHB: London School of Hygiene & Tropical Medicine, London, U.K.; MPFN: Culture collection at the Laboratoire de Pathologie Forestie're, INRA, Centre de Recherches de Nancy, 54280 Champenoux, France; MUCL: Université Catholique de Louvain, Louvain-la-Neuve, Belgium; PD: Plant Protection Service, Wageningen, The Netherlands; RoKI: Private culture collection Roland Kirschner; TNS: Herbarium of the National Museum of Nature and Science of Japan, Tokyo, Japan; UAMH: University of Alberta Microfungus Collection and Herbarium, Edmonton, Alberta, Canada; VKM: All-Russian Collection of Microorganisms, Russian Academy of Sciences, Institute of Biochemistry and Physiology of Microorganisms, 142292 Pushchino, Moscow Region, Russia; VPRI: Victorian Department of Primary Industries, Knoxfield, Australia; WAC: Department of Agriculture Western Australia Plant Pathogen Collection, Perth, Australia; X: Working collection of Mahdi Arzanlou.

DNA isolation, amplification and molecular phylogeny

Genomic DNA was extracted from mycelium taken from fungal colonies on MEA using the UltraClean™ Microbial DNA Isolation Kit (Mo Bio Laboratories, Inc., Solana Beach, CA, U.S.A.). A part of the nuclear rDNA operon spanning the 3' end of the 18S rRNA gene (SSU), the first internal transcribed spacer (ITS1), the 5.8S rRNA gene, the second ITS region (ITS2) and the first 900 bp at the 5' end of the 28S rRNA gene (LSU) was amplified and sequenced as described by Cheewangkoon et al. (2008) standard for all strains included (Table 1). For selected strains (see Table 1), the almost complete SSU and LSU (missing the first and last 20–30 nucleotides) were amplified and sequenced using novel and previously published primers (Table 2; see below).

Table 2.

Details of primers used for this study and their relation to selected published primers. Primer names ending with a “d” denotes a degenerate primer whereas those ending with a “m” denotes specific primers designed based on the partial novel sequences generated. The start and end positions of the primers are derived using Magnaporthe grisea GenBank accession AB026819 as reference in the 5'–3' direction.

Name	Sequence (5′-3′)	Orientation	%GC	Tm (°C)	Start	End	Reference
5.8S1Fd	CTC TTG GTT CBV GCA TCG	Forward	57.4	49.8 - 54.2 - 56.8	2333	2350	This study
5.8S1Rd	WAA TGA CGC TCG RAC AGG CAT G	Reverse	52.3	57.6 - 58.9 - 60.2	2451	2472	This study
F377	AGA TGA AAA GAA CTT TGA AAA GAG AA	Forward	26.9	40.3	3005	3030	www.lutzonilab.net/primers/page244.shtml
ITS1	TCC GTA GGT GAA CCT GCG G	Forward	63.2	49.5	2162	2180	White et al. (1990)
ITS1F	CTT GGT CAT TTA GAG GAA GTA A	Forward	36.4	39.0	2124	2145	Gardes & Bruns (1993)
ITS1Fd	CGA TTG AAT GGC TCA GTG AGG C	Forward	54.5	48.0	2043	2064	This study
ITS1Rd	GAT ATG CTT AAG TTC AGC GGG	Reverse	47.6	43.1	2671	2691	This study
ITS4	TCC TCC GCT TAT TGA TAT GC	Reverse	45.0	41.6	2685	2704	White et al. (1990)
ITS4S	CCT CCG CTT ATT GAT ATG CTT AAG	Reverse	41.7	42.9	2680	2703	Kretzer et al. (1996)
ITS5	GGA AGT AAA AGT CGT AAC AAG G	Forward	40.9	40.8	2138	2159	White et al. (1990)
LR0R	GTA CCC GCT GAA CTT AAG C	Forward	52.6	43.2	2668	2686	Rehner & Samuels (1994)
LR2	TTT TCA AAG TTC TTT TC	Reverse	23.5	28.5	3009	3025	www.lutzonilab.net/primers/page244.shtml
LR2R	AAG AAC TTT GAA AAG AG	Forward	29.4	30.4	3012	3028	www.lutzonilab.net/primers/page244.shtml
LR3	GGT CCG TGT TTC AAG AC	Reverse	52.9	40.5	3275	3291	Vilgalys & Hester (1990)
LR3R	GTC TTG AAA CAC GGA CC	Forward	52.9	40.5	3275	3291	www.lutzonilab.net/primers/page244.shtml
LR5	TCC TGA GGG AAA CTT CG	Reverse	52.9	41.0	3579	3595	Vilgalys & Hester (1990)
LR5R	GAA GTT TCC CTC AGG AT	Forward	47.1	37.8	3580	3596	www.biology.duke.edu/fungi/mycolab/primers.htm
LR6	CGC CAG TTC TGC TTA CC	Reverse	58.8	43.5	3756	3772	Vilgalys & Hester (1990)
LR7	TAC TAC CAC CAA GAT CT	Reverse	41.2	35.3	4062	4078	Vilgalys & Hester (1990)
LR8	CAC CTT GGA GAC CTG CT	Reverse	58.8	44.3	4473	4489	www.lutzonilab.net/primers/page244.shtml
LR8R	AGC AGG TCT CCA AGG TG	Forward	58.8	44.3	4473	4489	www.lutzonilab.net/primers/page244.shtml
LR9	AGA GCA CTG GGC AGA AA	Reverse	52.9	43.6	4799	4815	www.lutzonilab.net/primers/page244.shtml
LR10	AGT CAA GCT CAA CAG GG	Reverse	52.9	41.6	5015	5031	www.lutzonilab.net/primers/page244.shtml
LR10R	GAC CCT GTT GAG CTT GA	Forward	52.9	41.6	5013	5029	www.lutzonilab.net/primers/page244.shtml
LR11	GCC AGT TAT CCC TGT GGT AA	Reverse	50.0	43.9	5412	5431	www.lutzonilab.net/primers/page244.shtml
LR12	GAC TTA GAG GCG TTC AG	Reverse	52.9	39.4	5715	5731	Vilgalys & Hester (1990)
LR12R	CTG AAC GCC TCT AAG TCA GAA	Forward	47.6	43.7	5715	5735	www.biology.duke.edu/fungi/mycolab/primers.htm
LR13	CAT CGG AAC AAC AAT GC	Reverse	47.1	38.8	5935	5951	www.lutzonilab.net/primers/page244.shtml
LR14	AGC CAA ACT CCC CAC CTG	Reverse	61.1	47.6	5206	5223	www.lutzonilab.net/primers/page244.shtml
LR15	TAA ATT ACA ACT CGG AC	Reverse	35.3	32.5	2780	2796	www.lutzonilab.net/primers/page244.shtml
LR16	TTC CAC CCA AAC ACT CG	Reverse	52.9	42.1	3311	3327	Moncalvo et al. (1993)
LR17R	TAA CCT ATT CTC AAA CTT	Forward	27.8	31.2	3664	3681	www.lutzonilab.net/primers/page244.shtml
LR20R	GTG AGA CAG GTT AGT TTT ACC CT	Forward	43.5	43.6	5570	5592	www.lutzonilab.net/primers/page244.shtml
LR21	ACT TCA AGC GTT TCC CTT T	Reverse	42.1	41.7	3054	3072	www.lutzonilab.net/primers/page244.shtml
LR22	CCT CAC GGT ACT TGT TCG CT	Reverse	55.0	46.8	2982	3001	www.lutzonilab.net/primers/page244.shtml
LSU1Fd	GRA TCA GGT AGG RAT ACC CG	Forward	55.0	41.8 - 44.0 - 46.3	2655	2674	This study
LSU1Rd	CTG TTG CCG CTT CAC TCG C	Reverse	63.2	49.6	2736	2754	This study
LSU2Fd	GAA ACA CGG ACC RAG GAG TC	Forward	57.5	45.5 - 46.5 - 47.6	3280	3299	This study
LSU2Rd	ATC CGA RAA CWT CAG GAT CGG TCG	Reverse	52.1	48.3 - 49.0 - 49.8	3379	3402	This study
LSU3Fd	GTT CAT CYA GAC AGC MGG ACG	Forward	57.1	44.7 - 47.4 - 50.2	3843	3863	This study
LSU3Rd	CAC ACT CCT TAG CGG ATT CCG AC	Reverse	56.5	49.1	3876	3898	This study
LSU4Fd	CCG CAG CAG GTC TCC AAG G	Forward	68.4	51.2	4469	4487	This study
LSU4Rd	CGG ATC TRT TTT GCC GAC TTC CC	Reverse	54.3	47.4 - 48.7 - 50.0	4523	4545	This study
LSU5Fd	AGT GGG AGC TTC GGC GC	Forward	70.6	51.6	3357 / 5072	3373 / 5088	This study
LSU5Rd	GGA CTA AAG GAT CGA TAG GCC ACA C	Reverse	52.0	48.3	5355	5379	This study
LSU6Fd	CCG AAG CAG AAT TCG GTA AGC G	Forward	54.5	48.1	5499	5520	This study
LSU6Rd	TCT AAA CCC AGC TCA CGT TCC C	Reverse	54.5	48.6	5543	5564	This study
LSU7Fd	GTT ACG ATC TRC TGA GGG TAA GCC	Forward	52.1	46.0 - 47.4 - 48.8	5943	5966	This study
LSU7Rd	GCA GAT CGT AAC AAC AAG GCT ACT CTA C	Reverse	46.4	47.9	5927	5954	This study
LSU8Fd	CCA GAG GAA ACT CTG GTG GAG GC	Forward	60.9	51.2	3469	3491	This study
LSU8Rd	GTC AGA TTC CCC TTG TCC GTA CC	Reverse	56.5	48.9	4720	4742	This study
LSU9Fm	GGT AGC CAA ATG CCT CGT CAT C	Forward	54.5	47.9	4882	4903	This study
LSU9Rm	GAT TYT GCS AAG CCC GTT CCC	Reverse	59.5	49.2 - 50.0 - 50.9	4979	4999	This study
LSU10Fm	GGG AAC GTG AGC TGG GTT TAG A	Forward	54.5	48.6	5543	5564	This study
LSU10Rm	CGC TTA CCG AAT TCT GCT TCG G	Reverse	54.5	48.1	5499	5520	This study
LSU11Fm	TTTGGTAAGCAGAACTGGCGATGC	Forward	50.0	49.4	3753	3776	This study
LSU12Fd	GTGTGGCCTATCGATCCTTTAGTCC	Forward	52.0	48.3	5355	5379	This study
NS1	GTA GTC ATA TGC TTG TCT C	Forward	42.1	36.9	413	431	White et al. (1990)
NS1R	GAG ACA AGC ATA TGA CTA C	Reverse	42.1	36.9	413	431	www.lutzonilab.net/primers/page244.shtml
NS2	GGC TGC TGG CAC CAG ACT TGC	Reverse	66.7	53.8	943	963	White et al. (1990)
NS3	GCAAGTCTGGTGCCAGCAGCC	Forward	66.7	53.8	943	963	White et al. (1990)
NS4	CTT CCG TCA ATT CCT TTA AG	Reverse	40.0	38.2	1525	1544	White et al. (1990)
NS5	AAC TTA AAG GAA TTG ACG GAA G	Forward	36.4	40.1	1523	1544	White et al. (1990)
NS6	GCA TCA CAG ACC TGT TAT TGC CTC	Reverse	50.0	47.5	1806	1829	White et al. (1990)
NS7	GAG GCA ATA ACA GGT CTG TGA TGC	Forward	50.0	47.5	1806	1829	White et al. (1990)
NS8	TCC GCA GGT TCA CCT ACG GA	Reverse	60.0	50.4	2162	2181	White et al. (1990)
NS17	CAT GTC TAA GTT TAA GCA A	Forward	31.6	34.2	447	465	Gargas & Taylor (1992)
NS18	CTC ATT CCA ATT ACA AGA CC	Reverse	40.0	38.0	887	906	Gargas & Taylor (1992)
NS19	CCG GAG AAG GAG CCT GAG AAA C	Forward	59.1	49.3	771	792	Gargas & Taylor (1992)
NS20	CGT CCC TAT TAA TCA TTA CG	Reverse	40.0	37.3	1243	1262	Gargas & Taylor (1992)
NS21	GAA TAA TAG AAT AGG ACG	Forward	33.3	30.5	1193	1210	Gargas & Taylor (1992)
NS22	AAT TAA GCA GAC AAA TCA CT	Reverse	30.0	36.4	1687	1706	Gargas & Taylor (1992)
NS23	GAC TCA ACA CGG GGA AAC TC	Forward	55.0	45.5	1579	1598	Gargas & Taylor (1992)
NS24	AAA CCT TGT TAC GAC TTT TA	Reverse	30.0	36.2	2143	2162	Gargas & Taylor (1992)
SR11R	GGA GCC TGA GAA ACG GCT AC	Forward	60.0	47.8	779	798	Spatafora et al. (1995)
SR1R	TAC CTG GTT GAT TCT GC	Forward	47.1	38.5	394	410	Vilgalys & Hester (1990)
SR3	GAA AGT TGA TAG GGC T	Reverse	43.8	34.8	696	711	www.biology.duke.edu/fungi/mycolab/primers.htm
SSU1Fd	CTG CCA GTA GTC ATA TGC TTG TCT C	Forward	48.0	46.5	407	431	This study
SSU1Rd	CTT TGA GAC AAG CAT ATG AC	Reverse	40.0	48.7	416	435	This study
SSU2Fd	GAA CAA YTR GAG GGC AAG	Forward	50.0	47.8 - 50.7 - 53.5	930	947	This study
SSU2Rd	TAT ACG CTW YTG GAG CTG	Reverse	47.2	48.4 - 49.9 - 51.2	974	991	This study
SSU3Fd	ATC AGA TAC CGT YGT AGT C	Forward	44.7	48.4 - 49.5 - 50.5	1389	1407	This study
SSU3Rd	TAY GGT TRA GAC TAC RAC GG	Reverse	47.5	49.0 - 52.5 - 56.0	1397	1416	This study
SSU4Fd	CCG TTC TTA GTT GGT GG	Forward	52.9	50.0	1670	1686	This study
SSU4Rd	CAG ACA AAT CAC TCC ACC	Reverse	50.0	50.3	1682	1699	This study
SSU5Fd	TAC TAC CGA TYG AAT GGC	Forward	47.2	48.9 - 50.1 - 51.2	2037	2054	This study
SSU5Rd	CGG AGA CCT TGT TAC GAC	Reverse	55.6	52.5	2148	2165	This study
SSU6Fm	GCT TGT CTC AAA GAT TAA GCC ATG CAT GTC	Forward	43.3	49.0	423	452	This study
SSU6Rm	GCA GGT TAA GGT CTC GTT CGT TAT CGC	Reverse	51.9	50.1	1707	1733	This study
SSU7Fm	GAG TGT TCA AAG CAG GCC TNT GCT CG	Forward	55.8	51.0 - 52.2 - 53.3	1153	1178	This study
SSU7Rm	CAA TGC TCK ATC CCC AGC ACG AC	Reverse	58.7	49.5 - 50.8 - 52.1	1921	1943	This study
SSU8Fm	GCA CGC GCG CTA CAC TGA C	Forward	68.4	52.2	1848	1866	This study
V9G	TTA CGT CCC TGC CCT TTG TA	Forward	45.0	42.8	2002	2021	de Hoog & Gerrits van den Ende (1998)

Novel primers were designed using a variety of complete SSU and LSU sequences obtained from the GenBank sequence database (www.ncbi.nlm.nih.gov/). The selection was not limited only to fungi belonging to the Dothideomycetes but encompassed as many as possible full sequences in order to make the primers as robust as possible. We aimed to keep the melting temperature (Tm) of the novel primers at 40–45 °C and the GC content to approximately 50 % to keep them as compatible as possible to existing published primers. Primer parameters were calculated using the OligoAnalyzer tool on the web site of Integrated DNA Technologies (http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/) with the “Oligo Conc” parameter set at 0.2 mM and the “Na+ Conc” parameter set at 16 mM. A framework of existing and novel primers was then aligned onto the sequence of Magnaporthe grisea (GenBank accession AB026819) to derive primer positions (Table 2) and evaluate coverage over the gene regions. These primers were amplified and sequenced in the following overlapping sections to cover the almost complete SSU and LSU for the selected strains (Table 2): SSU1Fd or SSU6Fm with SSU2Rd, SSU2Fd with SSU3Rd, SSU7Fm with SSU4Rd or SSU6Rm, SSU4Fd with 5.8S1Rd, V9G or LSU1Fd with LSU3Rd, LSU8Fd with LSU8Rd, LSU4Fd with LSU5Rd, and LSU5Fd with LSU7Rd. For some strains (Table 3) it was necessary to add an additional overlap for SSU4Fd with 5.8S1Rd (using SSU4Fd with SSU7Rm and SSU8Fm with 5.8S1Rd), for LSU8Fd with LSU8Rd (using LSU8Fd with LSU3Rd and LSU3Fd with LSU8Rd), and for LSU5Fd with LSU7Rd (using LSU5Fd with LSU6Rd and LSU6Fd with LSU7Rd) to complete the gaps due to large insertions.

Table 3.

Isolates containing group I intron sequences. The insertion positions of these introns are derived using Magnaporthe grisea GenBank accession AB026819 as reference in the 5'–3' direction.

Isolate	Insertion between	18S or 28S nrDNA	Intron size (bp)	Blast result
Batcheloromyces leucadendriCBS 110892	1559 - 1560	18S nrDNA	350	No significant similarity
	1820 - 1821	18S nrDNA	399	190/252 of AY545722 Hydropisphaera erubescens 18S nrDNA
	4875 - 4876	28S nrDNA	328	211/264 of DQ246237 Teratosphaeria mexicana 28S nrDNA
	5424 - 5425	28S nrDNA	538	No significant similarity
	5538 - 5539	28S nrDNA	383	218/283 of EU181458 Trichophyton soudanense 28S nrDNA
Batcheloromyces proteaeCBS 110696	1559 - 1560	18S nrDNA	325	No significant similarity
	1820 - 1821	18S nrDNA	399	191/254 of AY545722 Hydropisphaera erubescens 18S nrDNA
	4875 - 4876	28S nrDNA	328	211/263 of DQ246237 Teratosphaeria mexicana 28S nrDNA
	5424 - 5425	28S nrDNA	535	75/90 of DQ442697 Arxula adeninivorans 26S nrDNA
	5538 - 5539	28S nrDNA	372	34/36 of GQ120133 Uncultured marine fungus 18S nrDNA
Catenulostroma macowaniiCBS 110756	1559 - 1560	18S nrDNA	395	297/379 of DQ848302 Mycosphaerella latebrosa 18S nrDNA
	5424 - 5425	28S nrDNA	914	No significant similarity
Catenulostroma macowaniiCBS 111029	1559 - 1560	18S nrDNA	395	303/379 of DQ848302 Mycosphaerella latebrosa 18S nrDNA
	5424 - 5425	28S nrDNA	914	No significant similarity
Cercospora apiiCBS 118712	1820 - 1821	18S nrDNA	733	288/363 of EU167577 Mycosphaerella milleri 18S nrDNA
Cercospora capsici CPC 12307	1820 - 1821	18S nrDNA	732	287/363 of EU167577 Mycosphaerella milleri 18S nrDNA
Cercospora janseanaCBS 145.37	1820 - 1821	18S nrDNA	350	295/365 of EU167577 Mycosphaerella milleri 18S nrDNA
Devriesia staurophoraCBS 375.81	3560 - 3561	28S nrDNA	309	No significant similarity
Miuraea persicae CPC 10069	1820 - 1821	18S nrDNA	603	399/443 of DQ848342 Mycosphaerella populorum 18S nrDNA
Mycosphaerella latebrosaCBS 652.85	1559 - 1560	18S nrDNA	370	234/296 of DQ848311 Septoria betulae 18S nrDNA
	1820 - 1821	18S nrDNA	933	Matches same species
	2168 - 2169	18S nrDNA	494	377/449 of DQ848326 Septoria alnifolia 18S nrDNA
	4875 - 4876	28S nrDNA	481	No significant similarity
	missing 5018 - 5019	28S nrDNA	Not present	Not present
	5424 - 5425	28S nrDNA	680	No significant similarity
	5538 - 5539	28S nrDNA	471	No significant similarity
Micosphaerella latebrosaCBS 687.94	1559 - 1560	18S nrDNA	370	231/295 of DQ848310 Septoria betulae 18S nrDNA
	1820 - 1821	18S nrDNA	918	Matches same species
	2168 - 2169	18S nrDNA	494	377/449 of DQ848326 Septoria alnifolia 18S nrDNA
	4875 - 4876	28S nrDNA	480	No significant similarity
	5018 - 5019	28S nrDNA	417	144/181 of AF430703 Beauveria bassiana 28S nrDNA
	5424 - 5425	28S nrDNA	680	No significant similarity
	5538 - 5539	28S nrDNA	471	No significant similarity
Mycosphaerella marksiiCBS 110942	1559 - 1560	18S nrDNA	341	332/355 of DQ848296 Mycosphaerella musae 18S nrDNA
Mycosphaerella marksii CPC 11222	1559 - 1560	18S nrDNA	341	332/355 of DQ848296 Mycosphaerella musae 18S nrDNA
Passalora-like genus CPC 11876	5538 - 5539	28S nrDNA	580	No significant similarity
Passalora bellynckiiCBS 150.49	1559 - 1560	18S nrDNA	409	147/191 of DQ848296 Mycosphaerella musae 18S nrDNA
Passalora dodonaea CPC 1223	5424 - 5425	28S nrDNA	738	No significant similarity
Phacellium paspaliCBS 113093	4875 - 4876	28S nrDNA	340	161/197 of DQ248314 Symbiotaphrina kochii 28S nrDNA
Phaeophleospora eugeniicola CPC 2557	missing 5424 - 5425	28S nrDNA	Not present	Not present
	5538 - 5539	28S nrDNA	744	No significant similarity
Phaeophleospora eugeniicola CPC 2558	5424 - 5425	28S nrDNA	1846	No significant similarity
	5538 - 5539	28S nrDNA	744	No significant similarity
Pseudocercospora angolensisCBS 112933	5018 - 5019	28S nrDNA	379	No significant similarity
Pseudocercospora angolensisCBS 149.53	5018 - 5019	28S nrDNA	379	No significant similarity
Pseudocercospora punctataCBS 113315	5424 - 5425	28S nrDNA	723	No significant similarity
	5538 - 5539	28S nrDNA	725	67/73 of AF430699 Beauveria bassiana 28S nrDNA
Pseudocercospora punctata CPC 10532	5424 - 5425	28S nrDNA	731	No significant similarity
	5538 - 5539	28S nrDNA	725	67/73 of AF430699 Beauveria bassiana 28S nrDNA
Ramularia coleosporii CPC 11516	1559 - 1560	18S nrDNA	445	No significant similarity
Ramularia grevilleana CPC 656	5538 - 5539	28S nrDNA	546	No significant similarity
Septoria apiicolaCBS 400.54	5424 - 5425	28S nrDNA	763	No significant similarity
Septoria obesaCBS 354.58	1820 - 1821	18S nrDNA	575	No significant similarity
	2168 - 2169	18S nrDNA	548	394/454 of DQ848326 Septoria alnifolia 18S nrDNA
	4875 - 4876	28S nrDNA	430	No significant similarity
Septoria pyricolaCBS 222.31	5424 - 5425	28S nrDNA	723	No significant similarity
Septoria quercicolaCBS 663.94	1559 - 1560	18S nrDNA	334	241/308 of DQ848303 Mycosphaerella latebrosa 18S nrDNA
	1820 - 1821	18S nrDNA	442	379/452 of DQ848335 Mycosphaerella latebrosa 18S nrDNA
	4875 - 4876	28S nrDNA	345	No significant similarity
	5018 - 5019	28S nrDNA	367	122/155 of DQ518980 Lipomyces spencermartinsiae 28S nrDNA
	5424 - 5425	28S nrDNA	526	No significant similarity
	5538 - 5539	28S nrDNA	603	No significant similarity
Septoria rosaeCBS 355.58	1820 - 1821	18S nrDNA	496	No significant similarity
Sonderhenia eucalypticola CPC 11252	1559 - 1560	18S nrDNA	408	339/404 of DQ848314 Mycosphaerella populorum 18S nrDNA
	4875 - 4876	28S nrDNA	337	229/289 of AB044641 Cordyceps sp. 28S nrDNA
	5424 - 5425	28S nrDNA	705	No significant similarity
Stigmina plataniCBS 110755	1559 - 1560	18S nrDNA	379	40/44 of AB007686 Exophiala calicioides 18S nrDNA
	5018 - 5019	28S nrDNA	376	No significant similarity
Stigmina synanamorph CPC 11721	5018 - 5019	28S nrDNA	371	No significant similarity
Teratosphaeria aff. nubilosaCBS 114419	4871 - 4872	28S nrDNA	141	No significant similarity; high identity to Teratosphaeria nubilosa
	5538 - 5539	28S nrDNA	580	No significant similarity; high identity to Teratosphaeria nubilosa
Teratosphaeria aff. nubilosaCBS 116283	4871 - 4872	28S nrDNA	141	No significant similarity; high identity to Teratosphaeria nubilosa
	5538 - 5539	28S nrDNA	580	No significant similarity; high identity to Teratosphaeria nubilosa
Teratosphaeria juvenalisCBS 110906	1559 - 1560	18S nrDNA	403	52/61 of DQ471010 Rutstroemia firma 18S nrDNA
	4875 - 4876	28S nrDNA	345	224/290 of EF115309 Cordyceps bassiana 28S nrDNA
	5424 - 5425	28S nrDNA	478	47/50 of EF115313 Cordyceps bassiana 28S nrDNA
	5538 - 5539	28S nrDNA	402	No significant similarity
Teratosphaeria juvenalisCBS 111149	1559 - 1560	18S nrDNA	403	52/61 of DQ471010 Rutstroemia firma 18S nrDNA
	4875 - 4876	28S nrDNA	345	224/290 of EF115309 Cordyceps bassiana 28S nrDNA
	5424 - 5425	28S nrDNA	478	47/50 of EF115313 Cordyceps bassiana 28S nrDNA
	5538 - 5539	28S nrDNA	402	No significant similarity
Teratosphaeria mexicanaCBS 110502	954 - 955	18S nrDNA	316	129/158 of DQ518980 Lipomyces spencermartinsiae 26S nrDNA
	1559 - 1560	18S nrDNA	360	No significant similarity
	1820 - 1821	18S nrDNA	388	128/168 of AF281670 Cryptendoxyla hypophloia 18S nrDNA
	3560 - 3561	28S nrDNA	383	124/151 of EF647754 Thecaphora thlaspeos 28S nrDNA
	4875 - 4876	28S nrDNA	327	99/114 of L81104 Gaeumannomyces graminis var. tritici 28S nrDNA
	5018 - 5019	28S nrDNA	315	No significant similarity
	5424 - 5425	28S nrDNA	553	No significant similarity
Teratosphaeria mexicanaCBS 120744	954 - 955	18S nrDNA	318	130/158 of DQ518980 Lipomyces spencermartinsiae 26S nrDNA
	1559 - 1560	18S nrDNA	360	No significant similarity
	1820 - 1821	18S nrDNA	389	85/109 of AF281670 Cryptendoxyla hypophloia 18S nrDNA
	3560 - 3561	28S nrDNA	378	119/155 of AY298780 Lentinellus castoreus 18S nrDNA
	4875 - 4876	28S nrDNA	327	162/200 of AB033530 Penicillium sabulosum 18S nrDNA
	5018 - 5019	28S nrDNA	309	No significant similarity
	5424 - 5425	28S nrDNA	659	No significant similarity
Teratosphaeria nubilosaCBS 115669	4871 - 4872	28S nrDNA	141	No significant similarity; high identity to Teratosphaeria aff. nubilosa
	5538 - 5539	28S nrDNA	580	No significant similarity; high identity to Teratosphaeria aff. nubilosa
Teratosphaeria nubilosaCBS 116005	4871 - 4872	28S nrDNA	141	No significant similarity; high identity to Teratosphaeria aff. nubilosa
	5538 - 5539	28S nrDNA	580	No significant similarity; high identity to Teratosphaeria aff. nubilosa
Teratosphaeria ohnowaCBS 112896	954 - 955	18S nrDNA	325	28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
	3560 - 3561	28S nrDNA	294	168/227 of FJ358267 Chaetothyriales sp. 28S nrDNA
	5424 - 5425	28S nrDNA	607	47/48 of EF115313 Cordyceps bassiana 28S nrDNA
Teratosphaeria ohnowaCBS 112973	954 - 955	18S nrDNA	324	28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
	3560 - 3561	28S nrDNA	294	168/227 of FJ358267 Chaetothyriales sp. 28S nrDNA
	5424 - 5425	28S nrDNA	607	47/48 of EF115313 Cordyceps bassiana 28S nrDNA
Teratosphaeria pseudosuberosaCBS 118911	3560 - 3561	28S nrDNA	324	28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
	4875 - 4876	28S nrDNA	364	No significant similarity
Teratosphaeria sp. CBS 208.94	954 - 955	18S nrDNA	342	No significant similarity
	3560 - 3561	28S nrDNA	309	59/70 of AY207244 Mycena pura 28S nrDNA
	4875 - 4876	28S nrDNA	296	44/51 of EF551317 Tremella globispora 28S nrDNA
Teratosphaeria suberosa CPC 11032	5424 - 5425	28S nrDNA	313	159/197 of AB033529 Penicillium oblatum 18S nrDNA
	5538 - 5539	28S nrDNA	596	80/99 of AB044639 Cordyceps kanzashiana 28S nrDNA
Thedgonia-like genus CPC 12304	1820 - 1821	18S nrDNA	444	262/331 of EU167577 Mycosphaerella milleri 18S nrDNA

The internal transcribed spacer regions, as well as all insertions (Table 3) were excluded from all analyses. Sequence data were deposited in GenBank (Table 1) and alignments in TreeBASE (www.treebase.org). Two separate analyses were performed: The first using only partial LSU data due to the limited number of complete LSU sequences available and the second using the almost complete SSU, 5.8S nrDNA and LSU alignment.

Maximum likelihood analyses (ML) were conducted in RAxML v. 7.0.4 (Stamatakis 2006) for the partial LSU alignment. A general time reversible model (GTR) with a discrete gamma distribution and four rate classes was applied. A tree was obtained by simultaneously running a fast bootstrap search of 1000 pseudoreplicates (Stamatakis ) followed by a search for the most likely tree. Maximum Likelihood bootstrap value (MLBP) equal or greater than 70 % are given at the nodes (Fig. 1).

Fig. 1.

RAxML tree using only the partial LSU alignment with bootstrap values after 1 000 pseudorepetitions on the nodes. Type strains and novel species described in this study are indicated in bold.

Maximum likelihood analyses (ML) were conducted in RAxML v. 7.0.4 (Stamatakis 2006) for the almost complete SSU, 5.8S nrDNA and LSU alignment. A general time reversible model (GTR) with a discrete gamma distribution and four rate classes was applied to each partition (SSU, 5.8S nrDNA and LSU). A tree was obtained by simultaneously running a fast bootstrap search of 500 pseudoreplicates (Stamatakis ) followed by a search for the most likely tree. Maximum Likelihood bootstrap value (MLBP) equal or greater than 70 % are given at the nodes (Fig. 2).

Fig. 2.

RAxML tree using the SSU, 5.8S nrDNA and LSU alignment with bootstrap values after 500 pseudorepetitions on the nodes.

Taxonomy

Fungal structures were mounted in lactic acid, and 30 measurements (× 1000 magnification) obtained per structure type. The range obtained is presented, except for spore measurements, where the 95 % confidence intervals are given with the extremes in parentheses. Colony colours (surface and reverse) were assessed after 1–2 wk on MEA at 25 °C in the dark, using the colour charts of Rayner (1970). All cultures obtained in this study are maintained in the culture collection of the Centraalbureau voor Schimmelcultures (CBS-KNAW) in Utrecht, the Netherlands (Table 1). Nomenclatural novelties and descriptions were deposited in MycoBank (Crous ). Names for which the taxonomy has not been resolved, but need to be allocated to another genus, are placed in inverted commas, e.g. “Mycosphaerella” iridis.

RESULTS

DNA amplification and phylogeny

Amplification products of approximately 1 700 bases were obtained for the standard amplification of the isolates listed in Table 1. The LSU region of these sequences was used to obtain additional sequences from GenBank that were added to the partial LSU alignment. We expected a total size of approximately 5 500 bp for the concatenated SSU, ITS1, 5.8S nrDNA, ITS2 and LSU at the start of the study; however, our alignment totalled about 12 000 bp due to numerous insertions (most likely group 1 introns) encountered for several strains (Table 3). These insertions frequently resulted in products too large to amplify or sequence effectively and sometimes required us to design additional novel primers in extra overlapping steps to complete these gaps (see Materials and Methods for details). Searching the GenBank database using these insertions had varied success (Table 3). Sequences of the 18S nrDNA are more abundant in the database whereas sequences of the second half to two-thirds of the 28S nrDNA are mostly absent. This also evident in Table 3, where insertions in the SSU more frequently found with similarity sequences in the database and insertions in the LSU (e.g. those between positions 5018–5019 and 5424–5425) frequently did not retrieve any significant similarity. Although there were some exceptions (e.g. the insertion between 1820 and 1821 in the SSU of Batcheloromyces leucadendri), most of the insertions in the SSU obtained hits with SSU sequences of species of Capnodiales in the database. In one case, between 954 and 955 for the SSU sequence of Teratosphaeria mexicana (both strains), a partial hit was obtained with an LSU sequence of Lipomyces spencermartinsiae (GenBank DQ518980). Many of the insertions in the LSU sequences did not retrieve significant hits in the database and those that did were with unrelated taxa. It is quite possible that this is an artifact of the poor representation of full-length LSU sequences in the database, especially for members of the Capnodiales. In some cases, an LSU insertion retrieved a hit with SSU sequences in the database, e.g. the insertion between 5538 and 5539 in Batcheloromyces proteae and between 3560 and 3561 and 4875 and 4876 in Teratosphaeria mexicana strain CBS 120744. In two cases (Mycosphaerella latebrosa and Phaeophleospora eugeniicola), an insertion was either lost or gained between two strains of the same species. The primers designed in this study allowed us to effectively amplify and sequence the SSU and LSU for the selected isolates. Althought these primers were not tested on taxa outside of the Capnodiales (except for one of the outgroups, Neofusicoccum australe), we attempted to design them as robust as possible using degeneracy if needed. We therefore expect that these primers will have wider applicability than just the Capnodiales in cases where other published primers fail to amplify or amplify poorly.

The RAxML search of the partial LSU alignment yielded a most likely tree (Fig. 1) with a log likelihood -13397.994021. The matrix had 395 distinct alignment patterns, with 6 % completely undetermined characters in the alignment. The manually adjusted alignment contained 295 sequences (including the outgroup sequence, Dothidea insculpta GenBank DQ247802) and 763 characters including alignment gaps. The RAxML search of the almost complete SSU, 5.8S nrDNA and LSU alignment yielded a most likely tree (Fig. 2) with a log likelihood -39022.881140. The matrix had 1211 alignment patterns with 0.01 % of the characters consisting of gaps or undetermined characters. The manually adjusted alignment contained 205 sequences (including the outgroup sequences, Neofusicoccum australe CPC 10899 and Magnaporthe grisea GenBank AB026819) and 5110 characters including alignment gaps. The obtained phylogenies (Figs 1, 2) are discussed in the Taxonomy section below.

Several well-supported clades could be distinguished in the present study (Figs 1, 2), correlating to families in the Capnodiales. These families, and several new genera and species, are treated below.

Treatment of phylogenetic clades

Woron. Ann. Mycol. 23: 177. 1925.

Data obtained from multi-gene phylogenies prompted Schoch et al. (2006) to merge Mycosphaerellales with Capnodiales. Although the present study included numerous additional isolates, the orders remain problematic. Although there is support for the Mycosphaerellales as an order, additional families such as the Schizothyriaceae and Dissoconiaceae (see below) would have to also be elevated to order level, which would result in orders containing a single family, while Teratosphaeriaceae appears to comprise unresolved lineages. For this reason it was decided to retain these families within Capnodiales, but noting that as more families are added and better circumscribed, it is quite possible that the Mycosphaerellales would again be resurrected.

Lindau, In: Engler & Prantl, Nat. Pflanzenfamilien 1(1): 421. 1897.

Type species: Mycosphaerella punctiformis (Pers.: Fr.) Starbäck, Bih. Kongl. Svenska Vetensk.-Akad. Handl. 15(3, 2): 9. 1889.

Notes: The Mycosphaerellaceae contains numerous genera, 20 of which are listed by Crous (2009), with many names under consideration (Crous et al. 2009b, c). From these data it is clear that genera such as Passalora, Pseudocercospora, Pseudocercosporella, Septoria, Zasmidium and Ramichloridium are paraphyletic (Hunter et al. in prep.). Well-resolved genera include Cercospora, Cercosporella, Ramularia, Ramulispora, Sonderhenia and Polythrincium. One particularly problematic clade contains Periconiella, Ramichloridium, Verrucisporota and Zasmidium, along with “Mycosphaerella” and Rasutoria teleomorphs. Barr (1987) erected Rasutoria for species with brown ascospores occurring on Gymnospermae. Rasutoria clusters in a clade adjacent to “Mycosphaerella” species with hyaline ascospores, such as M. aleuritidis and Mycosphaerella daviesiicola (Verrucisporota daviesiae) (Beilharz & Pascoe 2002).

The genus Phaeophleospora (1916) clusters with Lecanosticta acicola. The genus Lecanosticta (1922) has typical Phaeophleospora-like conidia, except that its conidiomata are acervular, and not pycnidial. If the type of Lecanosticta, L. pini also clusters in this clade, the generic concept Phaeophleospora may have to be widened to include Lecanosticta, as was done with Kirramyces to include Colletogloeopsis (Cortinas et al. 2006a, b).

Considerable controversy has surrounded the coelomycetes that Crous et al. (1997) placed in Phaeophleospora. Based on DNA phylogenetic data, it has now been shown that Kirramyces anamorphs (Walker ), including those accommodated in Colletogloeopsis (Crous & Wingfield 1996, Crous et al. 2004c, 2006c, Cortinas et al. 2006a, b), are linked to Teratosphaeria (Andjic , Crous et al. 2009b, c). Crous et al. (2007a) showed Phaeophleospora to reside in the Mycosphaerellaceae and Kirramyces in the Teratosphaeriaceae, respectively. However, most taxa investigated to date were collected from Eucalyptus. As shown in the present study, Phaeophleospora atkinsonii, a pathogen of Hebes spp. (Wu , Pennycook & McKenzie 2002), clusters distant from Phaeophleospora s. str., while the same is true for Phaeophleospora concentrica, which is a pathogen of Protea spp. (Taylor ), and Phaeophleospora stonei, a pathogen of Eucalyptus (Crous et al. 2007c, 2009c). These taxa thus clearly represent yet another two genera in the Phaeophleospora complex. An older name that would potentially be available is Scoleciasis. However, when B. Sutton examined exsiccati of the type species, S. aquatica, only ascomata of a Leptosphaeria species were found (Crous ). The association of S. aquatica with the Leptosphaeria was also noted in the original description, and this may indicate that Scoleciasis is allied to taxa in the Phaeosphaeriopsis/Phaeoseptoria complex (Arzanlou & Crous 2006). Both P. atkinsonii and P. concentrica have a typical Kirramyces morphology, namely brown, percurrently proliferating conidiogenous cells, and brown, obclavate, verruculose, transversely euseptate conidia. Further species thus need to be included in analyses before these generic concepts can be clarified.

During the course of this study several fresh collections of Leptosphaeria protearum were obtained. Leptosphaeria protearum is a major leaf spot and blight pathogen of Protea spp. (Knox-Davies ), and causes severe losses in plantations of South African Protea spp. in Hawaii, and has been recorded in many countries where South African proteas are cultivated (Taylor & Crous 1998, Taylor , Crous ). Cultures of this pathogen were found to cluster in the Mycosphaerellaceae, where they represent an undescribed genus, characterised by having bitunicate asci without pseudoparaphyses, brown, 3-septate ascospores, and a Coniothyrium-like anamorph. Its close phylogenetic relationship to Phaeophloeospora concentrica (Fig. 1) suggests that they could be congeneric, and that in future more Phaeophloeospora-like anamorphs may be found to cluster in this clade. We propose a new genus to accommodate Leptosphaeria protearum below.

Crous, gen. nov. MycoBank MB514694.

Etymology: Brunneus + Sphaerella = is after its brown ascospores and Sphaerella-like morphology.

Mycosphaerellae similis, sed ascosporis brunneis, 3-septatis.

Ascomata amphigenous, immersed to semi-immersed, black, single, gregarious, substomatal, pyriform or globose with a papillate, periphysate ostiole. Peridium consisting of three strata of slightly compressed textura angularis, an outer stratum of dark brown, thick-walled cells, becoming paler in the central stratum, and hyaline, thin-walled in the inner stratum. Asci clavate to cylindro-clavate, often curved, tapering to a pedicel, narrowing slightly to a rounded apex with an indistinct ocular chamber, 8-spored, bitunicate with fissitunicate dehiscense. Pseudoparaphyses absent. Ascospores biseriate, fusiform, broader at the apical end, initially hyaline and 1-septate, becoming yellow-brown and 3-septate at maturity, slightly constricted at median to supra-median septum.

Type species: Brunneosphaerella protearum (Syd. & P. Syd.) Crous, comb. nov.

(Marinc., M.J. Wingf. & Crous) Crous, comb. nov. MycoBank MB514695. Fig. 3.

Fig. 3.

Brunneosphaerella jonkershoekensis. A–B. Vertical sections through ascomata showing wall structure. C–D, G. Bitunicate asci. E–F. Ascospores. Scale bars: A, C = 50 μm, B = 20 μm, D, G = 10 μm, E–F = 5 μm (from Marincowitz ).

Basionym: Leptosphaeria jonkershoekensis Marinc., M.J. Wingf. & Crous, In: Marincowitz et al., Microfungi occurring on Proteaceae in the fynbos: 62. 2008.

Ascomata pseudothecial, subepidermal, immersed, obpyriform, papillate, 180–205 × 160–235 μm. Peridium 20–30 μm thick, composed of relatively large cells, 11–15 × 2.5–5.5 μm; cells arranged in three strata; outer stratum consisting of 3–5 layers of dark brown, very thick-walled cells; middle stratum transient, consisting of a few layers of pale brown, thick-walled, compressed cells; inner stratum consisting of 1–2 layers of thin-walled, very compressed cells. Pseudoparaphyses absent. Asci bitunicate, inflated cylindrical to clavate, 81–95 × 13–15 μm, ocular chamber dome-shaped, indistinct. Ascospores pale brown, fusoid to ellipsoidal, tapering towards the base, (25–)29–34(–36) × (5–)6–7(–9) μm (av. 31.4 × 6.7 μm), apical cell the shortest, upper hemispore slightly larger than lower, at times slightly curved, 3-septate, smooth, guttulate (adapted from Marincowitz ).

Host range and geographic distribution: Protea repens (South Africa, Western Cape) (Marincowitz ).

Specimen examined: south Africa, Western Cape Province, Jonkershoek Nature Reserve, leaf litter of Protea repens, 6 Jun. 2000, S. Marincowitz, PREM 59447 holotype.

Notes: Although no culture is presently available for this species, it clearly represents a species of Brunneosphaerella, characterised by its bitunicate asci, and brown, 3-septate ascospores, as well as the absence of pseudoparaphyses. Brunneosphaerella jonkershoekensis can easily be distinguished from B. protearum based on its much larger ascospores (Crous ).

(Syd. & P. Syd.) Crous, comb. nov. MycoBank MB514696. Fig. 4.

Fig. 4.

Brunneosphaerella protearum. A–D. Leaf spots on different Protea spp. E. Close up of leaf spot showing ascomata. F. Substomatal ascomata. G–H. Vertical sections though ascomata, showing wall structure. I–K. Germinating ascospores on MEA. L–M, R. Bitunicate asci. N–Q, S. Juvenile to mature ascospores. Scale bars: G = 75 μm, H = 10 μm.

Basionym: Leptosphaeria protearum Syd. & P. Syd., Ann. Mycol. 10: 441. 1912.

Anamorph: “Coniothyrium” protearum Joanne E. Taylor & Crous, IMI Descriptions of Fungi and Bacteria No. 1343. 1998.

Leaf spots circular to irregular, discrete to confluent, variable in size, under conditions favourable to disease symptoms more similar to a blight than a leaf spot, necrotic, sunken with a raised dark brown margin and with conspicuous black ascomata in the dead tissue, 4–30 mm diam. Ascomata pseudothecial, substomatal, amphigenous, immersed to semi-immersed, not erumpent, black, single, gregarious, 180–320 μm diam; in section, substomatal, subepidermal, pyriform or globose with a papillate, periphysate ostiole, immersed in a stroma consisting of deteriorated host mesophyll cells filled with fungal hyphae, (210–)230–264(–288) μm high, (180–)200–255(–300) μm diam. Peridium consisting of three strata of slightly compressed textura angularis, an outer stratum of dark brown, thick-walled cells, becoming paler in the central stratum, and hyaline, thin-walled in the inner stratum, altogether (20–)24.5–37.5(–50) μm thick. Asci clavate to cylindro-clavate, often curved, tapering to a pedicel, narrowing slightly to a rounded apex with an indistinct ocular chamber, 8-spored, bitunicate with fissitunicate dehiscense, (70–)80–87.5(–105) × (13.5–)14.5–16(–21.5) μm. Pseudoparaphyses absent. Ascospores biseriate, fusiform, broader at the apical end, initially hyaline and 1-septate, becoming yellow-brown and 3-septate at maturity, slightly constricted at median to supra-median septum, (21.5–)27.5–29.5(–37.5) × (6.3–)7.5–8(–10) μm in water mounts, (21–)25.5–27.5(–31) × (5.5–)6–7(–8) μm in lactophenol. Conidiomata barely visible and interspersed between ascomata, pycnidial, subepidermal, substomatal, separate, globose to pyriform, occasionally with well-developed papilla, dark brown, < 200 μm diam. Conidiophores reduced to conidiogenous cells. Conidiogenous cells discrete, smooth, hyaline, doliiform to ampulliform, holoblastic, proliferating 1–2 times percurrently, 4–6 × 3–4 μm. Conidia pale brown to medium brown, thick-walled on maturity, smooth to finely verruculose, eguttulate, ellipsoidal to globose, often truncate at one end, 5–10 × 3–7 μm (adapted from Crous ).

Host range and geographic distribution: Protea cynaroides, P. `Susara' (Portugal, Madeira) (Moura & Rodrigues 2001); P. caffra, P. compacta, P. cynaroides, P. gaguedi, P. grandiceps, P. lacticolor, P. laurifolia, P. lepidocarpodendron, P. lorifolia, P. magnifica, P. nitida, P. punctata, P. repens, P. `Sheila', Protea spp. (South Africa); P. cynaroides, P. laurifolia, P. neriifolia, P. `Ivory Musk', P. `Mink', P. `Pink Ice', P. `Rose Mink', P. susannae, Protea sp. (U.S.A., Hawaii) (Taylor ); P. cynaroides, P. gaguedi, P. neriifolia, Protea sp. (Zimbabwe, Inyanga) (Masuka ).

Specimens examined: south Africa, Western Cape Province, Bettys' Bay, leaf litter of Protea magnifica, 11 Jul. 2000, S. Marincowitz, PREM 59448; Helderberg Nature Reserve, leaf litter of Protea laurifolia, 14 Aug. 2000, S. Marincowitz, PREM 59482; Helderberg Nature Reserve, leaf litter of Protea obtusifolia, 14 Aug. 2000, S. Marincowitz, PREM 59495; Jonkershoek Nature Reserve, leaf litter of Protea nitida, 6 Jun. 2000, S. Marincowitz, PREM 59442; Jonkershoek Nature Reserve, leaf litter of Protea repens, 6 Jun. 2000, S. Marincowitz, PREM 59450; Jonkershoek Nature Reserve, S33°59'11.2” E18°57'14.7” leaves of Protea sp., 1 Apr. 2007, P.W. Crous, CBS H-20330, cultures CPC 13914–13916; Jonkershoek Nature Reserve, S33°59'26.1” E18°57'59.5” leaves of Protea repens, 1 Apr. 2007, P.W. Crous, CBS H-20331, cultures CPC 13911–13913; Jonkershoek Nature Reserve, leaves of Protea sp., 1 Apr. 2007, P.W. Crous, CBS H-20332, cultures CPC 13908–13910; Jonkershoek Nature Reserve, “Tweede Waterval”, leaves of Protea sp., 1 Apr. 2007, P.W. Crous, CBS H-20333, cultures CPC 13902–13907; Jonkershoek Nature Reserve, leaves of Protea nitida, 12 Apr. 2008, L. Mostert, CBS H-20334, cultures CPC 15231–15233; Kirstenbosch Botanical Garden, leaves of Protea sp., 13 Jan. 2009, P.W. Crous, CBS H-20335, culture CPC 16338.

Notes: Although Taylor & Crous (1998) reported a Coniothyrium-like anamorph to develop in culture, none of the cultures examined in the present study on MEA, PDA or OA could be induced to sporulate, though spermatogonia and ascomatal initials were commonly observed.

The fact that cultures of Leptosphaeria protearum, which represents a well-known and serious pathogen of Proteaceae, clustered in the Mycosphaerellaceae, was totally unexpected. A further surprise was the fact that this species appears to represent a complex of several cryptic taxa. Whether these taxa can be correlated with differences in host range and geographic distribution can only be resolved once more collections have been obtained for study. Although the genus Sphaerulina, which represents Mycosphaerella-like taxa with 3-septate, hyaline ascospores, is part of the Mycosphaerellaceae (Crous et al., unpubl data), the type species, S. myriadea, clusters in the Septoria clade, and is thus unavailable for the species occurring on Proteaceae. Morphologically Brunneosphaerella is also distinct in that ascospores are always brown at maturity, and anamorphs have brown, percurrently proliferating conidiogenous cells, appearing Phaeophleospora-like. The recognition of Brunneosphaerella as a distinct genus in the Mycosphaerellaceae also raises the intriguing possibility that many phytopathogenic species of the Leptosphaeria-complex with brown, 3-septate ascospores, but lacking paraphyses, actually belong to Brunneosphaerella.

Crous & A.R. Wood, sp. nov. MycoBank MB514697. Fig. 5.

Fig. 5.

Passalora ageratinae. A. Leaf spots. B. Close up of leaf spot with fruiting structures. C–D. Conidiophores. E–J. Conidia. Scale bars = 10 μm.

Etymology: Named after the host on which it occurs, Ageratina adenophora.

Passalorae assamensis similis, sed coloniis amphigenis, sine mycelio externo, conidiophoris brevioribus, 15–40 × 3–4.5 μm.

Leaf spots amphigenous, angular to irregular, 2–8 mm diam, medium brown, frequently with pale to grey-brown central part, and raised, dark brown border; pale to medium brown in reverse, with raised, dark brown border. Mycelium internal, consisting of smooth, branched, pale brown, 2–3 μm wide hyphae. Caespituli fasciculate, amphigenous, medium brown, arising from a brown, erumpent stroma, up to 80 μm wide, 40 μm high. Conidiophores subcylindrical, straight to geniculous-sinuous, unbranched, medium brown, finely verruculose, 1–3-septate, 15–40 × 3–4.5 μm. Conidiogenous cells terminal, pale to medium brown, finely verruculose with terminal, sympodial conidiogenous loci that are 1–2 μm diam, slightly thickened, darkened and refractive, 10–20 × 3–4 μm. Conidia in unbranched chains, pale brown, smooth, finely to prominently guttulate, subcylindrical to narrowly obclavate, apex obtuse, base long obconically subtruncate, (0–)1–3(–5)-septate, (20–)30–60(–80) × (3–)4(–4.5) μm; hila 1–1.5 μm wide, somewhat thickened, darkened and refractive.

Culture characteristics: On MEA erumpent, with uneven, folded surface, lobate margin, and moderate aerial mycelium; centre pale mouse-grey with patches of cinnamon, outer margin olivaceous-grey; reverse olivaceous-grey with patches of cinnamon; reaching 15 mm diam; on PDA spreading, with cinnamon to cream patches in centre, becoming umber towards smooth margins, with diffuse red pigment in agar; reverse olivaceous-grey, with patches of red, reaching 15 mm diam; on OA flat, spreading, up to 30 mm diam, iron-grey, with white, solitary mycelia strands, though aerial mycelium generally absent, reaching 30 mm diam.

Host range and geographic distribution: Ageratina adenophora, Australia, South Africa.

Specimen examined: south Africa, KwaZulu-Natal Province, Hilton, on leaves of Ageratina adenophora, 28 May 2008, A.R. Wood, CBS H-20336 holotype, cultures ex-type CPC 15365 = CBS 125419, CPC 15366, 15367.

Notes: Ageratina adenophora (crofton weed; Asteraceae), which is indigenous to Mexico, has invaded many countries as a rapidly growing weed, forming dense thickets (Morris 1989, Parsons & Cuthbertson 1992, Wagner , Zhu , Muniappan ). It is considered a serious weed in agriculture and forestry (Bess & Haramoto 1958, Sharma & Chhetri 1977, Kluge 1991), often replacing more-desired vegetation or native species.

A leaf spot pathogen, originally misidentified as Cercospora eupatorii (this species is currently known as Pseudocercospora eupatorii), was found to infect plants in Australia where a stem galling fly (Procecidochares utilis; Tephritidae) was introduced from Hawaii as a biological control agent (Dodd 1961). Presumably the fungus was introduced together with the flies originally from Mexico to Hawaii and then to Australia. Subsequently this same fungus was obtained from Australia and released in South Africa after host specificity testing indicated it was restricted to A. adenophora (Morris 1989). The fungus causes partial defoliation of mature plants (Dodd 1961, Auld 1969), though the impact depends on environmental conditions (Dodd 1961). Seedlings are however killed rapidly (Wang ).

This fungus, which has hitherto been known simply as “Phaeoramularia” sp., still lacks a name and proper description. The genus Phaeoramularia is treated as a synonym of Passalora (Crous & Braun 2003), and hence the species is named in the latter genus as P. ageratinae. Interestingly, this species appears to be closely related to Passalora fulva, which is a serious pathogen of tomato (Solanaceae) (Thomma ).

Crous & A.R. Wood, sp. nov. MycoBank MB514698. Fig. 6.

Fig. 6.

Passalora armatae. A. Fruiting in vivo. B–C. Caespituli with prominent basal stroma. D. Sporulation on MEA. E. Conidiogenous cells giving rise to conidia. F–G. Conidia. Scale bars: B = 125 μm, C–E = 10 μm.

Etymology: Named after the host on which it occurs, Dalbergia armata.

Passaloraea dalbergiicolae similis, sed conidiophoris in synnematibus densis, conidiis ad basim obconice truncatis, apice rostrato.

Leaf spots amphigenous, on upper surface visible as red-brown, irregular to subcircular spots with indistinct margins, 0.5–2 mm diam; in reverse indistinct, chlorotic to medium or red-brown. Mycelium internal, consisting of smooth, branched, pale brown, 2–3 μm wide hyphae. Caespituli hypophyllous, fasciculate to synnematous, up to 200 μm high and 250 μm wide, situated on a prominently erumpent, pale brown stroma, up to 100 μm high and wide. Conidiophores subcylindrical, unbranched, flexuous, guttulate, pale to medium brown, smooth, 120–180 × 4–6 μm, 2–6-septate. Conidiogenous cells terminal, subcylindrical, guttulate, pale to medium brown, finely verruculose, becoming somewhat swollen, appearing slightly clavate, 25–70 × 6–8 μm; conidiogenous loci 4–20 per conidiogenous cell, sympodial, round, darkened, thickened, refractive, prominent, 2–3 μm wide, up to 1 μm high. Conidia (27–)30–40(–45) × 9–10(–12) μm, pale to medium brown, smooth to finely verruculose, granular to guttulate, thin-walled, ellipsoidal to obovoid, transversely 2–4-euseptate, widest in middle of basal cell, or middle of conidium, tapering to an obconically truncate base; hilum thickened, darkened and refractive; apical cell conical, elongating to an apical beak up to 20 μm long. When cultivated conidia remain attached to conidiogenous cells, giving conidiophores the appearance of small tufts which is very characteristic, and not commonly observed in Passalora.

Culture characteristics: On MEA slow growing, erumpent, with dense white aerial mycelium, which becomes mouse-grey, reaching 5 mm diam after 1 wk; on PDA mouse-grey (surface), iron-grey (reverse), with diffuse red pigment in agar; on OA similar to PDA, also with diffuse red pigment in agar.

Host range and geographic distribution: Dalbergia armata, South Africa.

Specimen examined: south Africa, KwaZulu-Natal Province, South Coast, Mpenjati Nature Reserve, between Ramsgate and Port Edward, on leaves of Dalbergia armata, 28 May 2008, A.R. Wood, CBS H-20337 holotype, cultures ex-type CPC 15419 = CBS 125420, CPC 15420, 15421.

Notes: Passalora dalbergiae, which occurs on Dalbergia sissoo (Fabaceae) in India, is distinct from P. armatae in having superficial mycelium and solitary conidiophores (Hernández-Gutiérrez & Dianese 2009). The previously described Passalora dalbergiicola is similar to P. armatae in conidial dimensions (3-septate, 25–45 × 7–10 μm; Ellis 1976), but distinct in that conidiophores are not in dense synnemata, conidiogenous cells can have single apical loci, and conidia have a less prominent basal taper, and lack the apical beaks typical of P. armatae (in vivo and in vitro).

Höhn. ex Trotter, Sacc., D. Sacc. & Traverso, In: Saccardo, Syll. Fung. 24(2): 1254. 1928.

Type species: Schizothyrium acerinum Desm., Ann. Sci. Nat. Bot. 11: 360. 1849.

Notes: Members of the Schizothyriaceae are associated with flyspeck symptoms on apples and pear fruit. The fungi grow superficially on the epicuticular wax, thereby reducing the marketability of the fruit, but do not penetrate the cuticle (Belding ). Batzer et al. (2005, 2007) reported a range of diverse fungi to be associated with flyspeck symptoms on apples, the most prominent being species of Schizothyrium.

Crous & de Hoog, fam. nov. MycoBank MB514699.

Ascomata pseudotheciales, immerse, globosa, uniloculares. Sine pseudoparaphysibus. Asci fasciculati, octospori, bitunicati. Ascosporae ellipsoideae-fusiformes, 1-septatae, hyalinae. Conidiophora separata, ex hyphis oriunda, subcylindrica, subulata, lageniformia vel cylindrica, apicem versus attenuata, apice obtuse rotundato vel truncate, recta vel semel geniculata, laevia, modice brunnea, 0–pluriseptata, locis terminalibus vel lateralibus, rhachidi cum cicatricibus leniter incrassates, fuscatis. Conidia solitaria, pallide olivaceo-brunnea, laevia, ellipsoidea, obclavata vel globosa, 0–1-septata, hilis aliquantum fuscatis. Conidia secundaria nulla vel formata ad conidia primaria, pallide olivacea vel subhyalina, aseptata, pyriformia; conidiis impigre vel passive emittentibus.

Ascomata pseudothecial, immersed, globose, unilocular, papillate, ostiolate, canal periphysate; wall consisting of 3–4 layers of brown textura angularis; inner layer of flattened, hyaline cells. Pseudoparaphyses absent. Asci fasciculate, 8-spored, bitunicate. Ascospores ellipsoid-fusoid, 1-septate, hyaline, with or without mucoid sheath. Mycelium internal and external, consisting of branched, septate, smooth, hyaline to pale brown hyphae. Conidiophores separate, arising from hyphae, subcylindrical, subulate or lageniform to cylindrical, tapering to a bluntly rounded or truncate apex, straight to once geniculate, smooth, medium brown, 0–multi-septate; loci terminal and lateral, visible as slightly thickened, darkened scars on a rachis. Conidia solitary, pale olivaceous-brown, smooth, ellipsoid to obclavate or globose, 0–1-septate; hila somewhat darkened. Secondary conidia present or absent; developing adjacent to primary conidia, pale olivaceous to subhyaline, aseptate, pyriform; conidium discharge active or passive.

Type species: Dissoconium aciculare de Hoog, Oorschot & Hijwegen, Proc. K. Ned. Akad. Wet., Ser. C, Biol. Med. Sci. 86(2): 198. 1983.

Notes: Species of Dissoconium have Mycosphaerella-like teleomorphs (Crous ). The genus is characterised by forming conidia in pairs that are forcefully discharged, which is quite unique in the Capnodiales (de Hoog ). Although D. aciculare, the type species of Dissoconium, was originally assumed to be hyperparasitic on powdery mildew (de Hoog ), Jackson et al. (2004) revealed that another species, D. dekkeri, could act as a foliar pathogen of Eucalyptus. Dissoconium dekkeri is, however, most commonly found in leaf spots in association with other species of Teratosphaeria and Mycosphaerella. Species of Dissoconium remain commensalists, and frequently occur asexually on lesions associated with pathogenic species of Capnodiales (Crous unpubl. data). They are ecologically and morphologically quite distinct from other members of the Capnodiales, and hence a separate family, the Dissoconiaceae, is herewith introduced to accommodate them. Ramichloridium forms brown, solitary conidiophores with a rachis and apical loci similar to that observed on Dissoconium, and primary conidia that are pale brown, 0–1-septate, with slightly thickened hila, but lacks secondary conidia (Arzanlou ). Both Dissoconium and Ramichloridium have in the past been reported as hyperparasitic on powdery mildews on various hosts (Hijwegen & Buchenauer 1984), which suggests that they share a similar ecology.

Crous & U. Braun, Stud. Mycol. 58: 8. 2007.

Type species: Teratosphaeria fibrillosa Syd. & P. Syd., Ann. Mycol. 10: 40. 1912.

Notes: Since the family was established by Crous et al. (2007a) it has been shown to be too widely defined, incorporating many diverse genera (Crous et al. 2009b, c), and even families such as the Piedraiaceae (Fig. 1). The node as such is not well supported, suggesting that as more taxa are added, further families remain to be separated from the Teratosphaeriaceae. Presently it incorporates diverse elements, and even lichens such as Cystocoleus ebeneus and Anisomeridium consobrinum. The identity of the latter strain (CBS 101364) needs to be confirmed, as its position in the tree appears doubtful.

The genus Catenulostroma, which is associated with numerous diverse substrates and habitats (Crous ), is typified by C. protearum, for which an epitype is designated in the present study. Several strains isolated from rock surfaces (Guiedan et al. 2008, Ruibal et al. 2008, 2009, this volume) cluster with Catenulostroma (Fig. 1), and appear to represent undescribed species of the latter. Of interest is the fact that the type species of Aulographina, A. pinorum (CBS 302.71, CBS 174.90), which has hysterothecia, clusters in a clade with Catenulostroma microsporum, which has a Teratosphaeria-like teleomorph with pseudothecia (Taylor & Crous 2000, Crous et al. 2004a, 2007a). Isolates of A. pinorum were found to produce a Catenulostroma anamorph in culture. This raises two possibilities, namely that either the incorrect fungus was originally isolated from pine needles (namely Catenulostroma abietis), or that this is a species complex, in which A. pinorum resides. If these strains are indeed confirmed to represent A. pinorum, then it reveals the genus Aulographina to be heterogeneous, as A. eucalypti, which is a major leaf spot pathogen of Eucalyptus (Crous , Park , Carnegie & Keane 2003), clusters distant from A. pinorum. The taxonomy of these taxa is currently being addressed, and will be reported on elsewhere (Cheewangkoon et al., in prep.). During the course of this study some new members of the Teratosphaeriaceae were collected, which are described below: (Crous & M.E. Palm) Crous & U. Braun, Stud. Mycol. 58: 17. 2007. Fig. 7.

Fig. 7.

Catenulostroma protearum. A. Colony on OA. B–G. Sporulating colony, with variable muriform to transversely septate conidia. Scale bars = 10 μm.

Basionym: Trimmatostroma protearum Crous & M.E. Palm, Mycol. Res. 103: 1303. 1999.

Culture characteristics: On MEA spreading, erumpent, with folded surface, and unevenly lobed, smooth margins; aerial mycelium sparse; surface iron-grey to greenish black, reverse greenish black; reaching 15 mm diam after 2 wk; similar on PDA and OA.

Host range and geographic distribution: Protea, Leucadendron and Hakea spp., South Africa.

Specimens examined: south Africa, on leaves of Protea grandiceps, L. Schroeder, 15 Sept. 1986, holotype BPI 1107849; south Africa, Western Cape Province, Stellenbosch, Assegaibos, on leaves of Leucadendron tinctum, F. Roets, 16 Apr. 2008, epitype designated here CBS H-20338, culture ex-epitype, CPC 15369, 15370 = CBS 125421; ditto, on leaves of Hakea sericea, CBS H-20339, single ascospore culture CPC 15368.

Notes: Catenulostroma protearum was originally described from dead leaves of Protea grandiceps collected in South Africa (Crous & Palm 1999). Unfortunately the cultures died before they could be deposited, and hence the phylogenetic position of Catenulostroma remained uncertain. This proved to be problematic, as the genus was later shown to be heterogeneous (Crous ). The designation of the epitype in the present study clarifies the phylogenetic position of the genus, and reveals Catenulostroma s. str. to represent species that occur in extreme environments, on rocks, or on hard, leathery leaves such as Proteaceae and Gymnospermae.

Crous & U. Braun, sp. nov. MycoBank MB514700. Fig. 8.

Fig. 8.

Devriesia hilliana. A. Sporulating colony on OA. B–D. Conidiophores giving rise to catenulate conidia. E–G. Fragmenting conidial segments from aerial hyphae. Scale bars = 10 μm.

Etymology: Named in fond memory of Dr C.F. Hill. “Frank” collected numerous fungi over the years, and sent them to the various international colleagues he knew to be working on these groups. The present species was one of a batch of novel taxa that Frank collected and sent to us for treatment shortly before he had a relapse. Frank's friendship and mycological expertise will be sorely missed.

Devriesiae strelitziae similis, sed conidiis minoribus, (5–)7–10(–12) × (2–)2.5(–3) μm.

Colonies sporulating on MEA. Mycelium consisting of branched, septate, pale brown, smooth, 2–3 μm wide hyphae. Conidiophores solitary, erect on creaping hyphae, unbranched, medium brown, smooth, flexuous, thick-walled, 15–50 × 2–3 μm, 3–11-septate. Conidiogenous cells terminal, medium brown, subcylindrical, smooth, 5–20 × 2–3 μm; proliferating sympodially; hila flattened, unthickened, somewhat darkened, 1–1.5 μm wide. Conidia medium brown, smooth, subcylindrical to narrowly fusoid-ellipsoidal or obclavate, apical conidium with obtuse apex, additional conidia with truncate ends, somewhat darkened, 1–1.5 μm wide; conidia straight to irregularly bent, mostly in unbranched chains, (5–)7–10(–12) × (2–)2.5(–3) μm.

Culture characteristics: On MEA erumpent, spreading, with folded surface, and smooth margins with sparse aerial mycelium; surface mouse-grey, with thin, olivaceous-grey margin; reverse iron-grey, reaching 8 mm diam; on PDA similar, up to 8 mm diam, centre mouse-grey, margin and reverse iron-grey; on OA erumpent with moderate mouse-grey aerial mycelium, and iron-grey margin.

Host range and geographic distribution: Macrozamia communis, Auckland, New Zealand.

Specimen examined: New Zealand, Auckland, Auckland University Campus, Princes Street, on Macrozamia communis, C.F. Hill, 20 Apr. 2008, CBS H-20340 holotype, culture ex-type CPC 15382 = CBS 123187.

Crous & M.J. Wingf., sp. nov. MycoBank MB514701. Fig. 9.

Fig. 9.

Devriesia lagerstroemiae. A. Leaves and flowers of Lagerstroemia indica. B. Leaf spots. C. Colony on OA. D–H. Conidiophores giving rise to branched conidial chains. Scale bars = 10 μm.

Etymology: Named after the host on which it occurs, Lagerstroemia.

Devriesiae strelitziae similis, sed conidiis latioribus, (5–)7–10(–12) × (2–)2.5(–3) μm.

Colonies sporulating on OA. Mycelium consisting of smooth, branched, septate, 2–3 μm wide hyphae. Conidiophores rarely micronematous, predominantly macronematous, erect on creeping hyphae, brown, cylindrical with swollen basal cell, thick-walled, smooth, flexuous, 20–90 × 3–4 μm, 5–20-septate. Conidiogenous cells terminal, cylindrical to clavate, polyblastic, pale to medium brown, 5–10 × 2–3(–4) μm; scars somewhat thickened and darkened, not refractive. Ramoconidia medium brown, smooth, subcylindrical, 9–15 × 3–5 μm, (0–)1(–2)-septate, but with clavate apex and several flattened loci that are somewhat darkened and thickened, 1 μm diam. Conidia in branched chains of up to 10, pale brown, smooth, narrowly ellipsoid, 0–1-septate, (5–)8–12(–15) × 2–3(–4) μm; apical conidium with rounded apex, the rest with flattened loci that are somewhat darkened and thickened, not refractive, 0.5–1 μm diam.

Culture characteristics: On MEA erumpent, spreading, with sparse aerial mycelium and irregular margin; surface olivaceous-grey, with patches of iron-grey; reverse iron-grey, reaching 10 mm diam; on PDA similar, but on OA iron-grey, reaching 15 mm diam.

Host range and geographic distribution: Lagerstroemia indica, U.S.A., Louisiana.

Specimen examined: U.S.A., Louisiana, Baton Rouge, Cod & Cook Centre, N30°24'50.3” W91°10'6.6”, on Lagerstroemia indica, P.W. Crous & M.J. Wingfield, holotype CBS H-20341, culture ex-type CPC 14403 = CBS 125422.

Notes: Devriesia lagerstroemiae clusters close to D. hilliana. As far as we know, neither species is heat-resistant, nor forms chlamydospores, and hence the placement in Devriesia is more due to phylogenetic similarity than their ecology.

Arzanlou & Crous, sp. nov. MycoBank MB514702. Fig. 10.

Fig. 10.

Devriesia strelitziicola. A. Strelitzia sp. with dead leaves. B. Colony on OA. C–G. Conidiophores giving rise to conidia. H–M. Conidia. Scale bars = 10 μm.

Etymology: Named after its host plant, Strelitzia.

Devriesiae strelitziae similis, sed conidiis majoribus, (7–)25–45(–100) × (2–)2.5(–3) μm.

Colonies sporulating on OA. Mycelium consisting of medium brown, smooth, septate, branched, 2–3 μm wide hyphae; chlamydospores not observed. Conidiophores dimorphic. Microconidiophores reduced to conidiogenous cells on hyphae, erect, cylindrical, medium brown, smooth with truncate ends, proliferating sympodially, 4–7 × 2–3 μm. Macroconidiophores erect, cylindrical, straight to geniculate-sinuous, medium brown, smooth, unbranched or branched above, 30–100 × 2.5–3 μm, 3–10-septate. Conidiogenous cells terminal or lateral on branched conidiophores, medium brown, smooth, cylindrical, proliferating sympodially, 7–15 × 2.5–3 μm; loci truncate, inconspicuous, 1–1.5 μm wide. Conidia medium brown, smooth, guttulate, subcylindrical to narrowly obclavate, apex obtuse to truncate, base truncate, occurring in branched chains, widest at the basal septum, (7–)25–45(–100) × (2–)2.5(–3) μm, (0–)3–6(–13)-septate; hila inconspicuous to somewhat darkened and thickened, not refractive, 1–1.5 μm wide.

Culture characteristics: On MEA erumpent, slow growing, with moderate aerial mycelium and smooth margins; surface mouse-grey, reverse iron-grey, reaching 8 mm diam after 2 wk; similar on PDA and OA.

Host range and geographic distribution: Strelitzia sp., South Africa.

Specimen examined: south Africa, KwaZulu-Natal, Durban, Botanical Garden near Reunion, on leaves of Strelitzia sp., 5 Feb. 2005, W. Gams & H. Glen, CBS H-20342, holotype, culture ex-type X1045 = CBS 122480.

Notes: Devriesia strelitziicola is the second Devriesia species to be described from this host (Arzanlou ). The genus Devriesia was originally established to accommodate a group of heat-resistant, Cladosporium-like fungi (Seifert ), and it appears that a different generic name will have to be introduced to accommodate those taxa occurring on plants. Further collections are required, however, to clarify the generic boundaries of Devriesia (Crous ).

Crous & K.D. Hyde, sp. nov. MycoBank MB514703. Fig. 11.

Fig. 11.

Hortaea thailandica. A. Cercosporoid leaf spots on Syzygium siamense, in which H. thailandica occurred. B. Colonies on OA. C–E. Hyphae with conidiogenous loci (arrows). F–H. Conidia. Scale bars = 10 μm.

Etymology: Named after the country where it was collected, Thailand.

Hortaeae werneckii similis, sed conidiis brunneis, verruculosis, majoribus, (9–)10–13(–15) × (4–)5–6(–7) μm.

Colonies sporulating on MEA. Mycelium consisting of pale brown, smooth, septate, branched, 3–4 μm wide hyphae that become darker and thick-walled in the conidiogenous region. Conidiogenous cells integrated, intercalary on hyphae, reduced to short cylindrical loci, 2–2.5 μm wide, 1–4 μm tall; collarettes inconspicuous to minute; proliferating 1–2 times percurrently at apex. Conidia ellipsoid, aseptate, pale to medium brown, (4–)5–7(–9) × (2.5–)3 μm, verruculose, apex obtuse, base subtruncate with minute collarette; becoming swollen and elongate at maturity, with 1–4 transverse and 1–2 oblique septa; (9–)10–13(–15) × (4–) 5–6(–9) μm; hila inconspicuous, up to 2 μm wide, frequently with visible marginal frill; microcyclic conidiation commonly observed on OA, MEA and PDA.

Culture characteristics: On MEA erumpent, spreading; surface irregular, folded, greenish black, with sparse olivaceous-grey aerial mycelium and smooth, lobed, margins; reverse greenish black; reaching 12 mm diam after 2 wk; similar on OA and PDA.

Host range and geographic distribution: Syzygium siamense, Thailand.

Specimen examined: Thailand, Khao Yai National Park, N14°14'42.6” E101°22'15.7”, on leaves of Syzygium siamense, in lesions with a cercosporoid fungus, 27 Mar. 2009, P.W. Crous & K.D. Hyde, holotype in BBH, isotype CBS H-20343, culture ex-type CPC 16652, 16651 = CBS 125423, also in BCC.

Notes: Similar to Hortaea werneckii, which is also frequently isolated from lesions in association with plant pathogenic fungi, H. thailandica occurred in leaf spots in association with a cercosporoid fungus. It is distinct from H. werneckii by forming larger conidia that turn medium brown and verruculose with age. Several other taxa are newly placed in the Teratosphaeriaceae in the present study that require further evaluation. Xenomeris juniperi, a bitunicate ascomycete on Jupinerus with pseudothecia associated with a stroma, and pigmented, 1-septate ascospores, clusters close to Teratosphaeria species occurring on Protea and Eucalyptus, where the ascomata are also associated with stromatic tissue (Taylor & Crous 2000, Crous ). Fresh collections of this fungus would be required, however, to resolve its status. The occurrence of Sporidesmium species in the Teratosphaeriaceae should be interpreted with care, as the genus is polyphyletic, and further studies are required to resolve its status (Shenoy , Crous , Yang et al., in prep.).

C.L. Schoch, Spatafora, Crous & Shoemaker, Mycologia 98: 1048. 2006.

Type species: Davidiella tassiana (De Not.) Crous & U. Braun, Mycol. Progr. 3: 8. 2003.

Notes: The Davidiellaceae was introduced for the genus Davidiella, which has Cladosporium anamorphs. As shown in the present analysis, however, allied genera such as Toxicocladosporium, Verrucocladosporium, Rachicladosporium and Graphiopsis also belong in this family. Of interest is the position of Melanodothis caricis in Cladosporium s. str. This fungus, which infects florets of Carex and Kobresia, forms a stroma that gives rise to several immersed ascomata with bitunicate, oblong asci that are aparaphysate, and 0–(2)-septate, hyaline, 9–14.5 × 2–4 μm ascospores. In culture, a hyaline, Ramularia-like anamorph developed, with sympodial proliferation, catenulate conidia, with thickened, darkened loci (Arnold 1971). Although these characteristics are atypical of the Davidiella/Cladosporium species in this clade, the position of Melanodothis caricis in this family cannot simply be disregarded. However, the ex-type culture of this fungus (CBS 860.72) proved to be sterile.

A further unconfirmed sequence (CBS 354.29, culture sterile, but fast growing, grey-brown, Cladosporium-like), is that submitted as Sphaerulina polyspora. The culture was accessioned in 1929, deposited by A.E. Jenkins, and there is reason to believe that it was derived from BPI 623724!, which is authentic for the species, and collected by F.A. Wolf in May 1924. Wolf (1925) described this fungus from twigs of Oxydendron arboretum with die-back disease symptoms, collected in Raleigh, North Carolina. Sphaerulina polyspora (623723 = Type!) has pseudothecia with aparaphysate, bitunicate asci, and ascospores that are hyaline, 3–5-septate, 20–24 × 6–7 μm. On the host it was linked to a Phoma-like anamorph, which also grew similar in culture (yeast-like budding), and has hyaline conidia which are ellipsoidal, 7–8 × 3.8–4 μm.

Colonies were reported as slow-growing, grey, appressed, with germinating ascospores forming yeast-like budding cells, and rarely having hyphae that extended from the margin of the colonies. The link between Sphaerulina-like species, with Selenophoma and Aureobasidium synanamorphs was recently illustrated by Cheewangkoon et al. (2009). Although members of the Dothideomycetes, these taxa do not cluster in the Davidiellaceae, and hence it seems a fair assumption that CBS 354.29 is not representative of Sphaerulina polyspora.

Crous, sp. nov. MycoBank MB514704. Fig. 12.

Fig. 12.

Rachicladosporium cboliae. A. Front Royal collection site in Virginia. B–E, G. Conidiophores with branched conidial chains. F. Hyphal coil. H–I. Chlamydospores in chains. J. Conidia. Scale bars = 10 μm.

Etymology: Named after the Consortium for the Barcode of Life, CBOL, who organised a Fungal Barcoding Symposium, during which this fungus was collected.

Rachicladosporio americano similis, sed conidiophoris dense fasciculatis et conidiis minoribus.

Colonies sporulating on OA. Mycelium consisting of branched, septate hyphae, pale brown, smooth, 1.5–3 μm wide, frequently constricted at septa, forming hyphal coils, but characteristically also forming intercalary and terminal clusters of chlamydospores that are brown, thick-walled, up to 6 μm diam. Conidiophores forming laterally on creeping hyphae, erect, visible as densely branched tufts on agar surface; conidiophores medium brown, smooth, thick-walled with bulbous base, lacking rhizoids, cylindrical, unbranched, flexuous, up to 250 μm long, 4–6 μm wide, 10–20-septate. Conidiogenous cells terminal, medium brown, smooth, polyblastic, subcylindrical, 10–20 × 3–4 μm; loci terminal, thickened, darkend, refractive, 1 μm diam. Ramoconidia 0(–1)-septate, subcylindrical, medium brown, smooth, 7–12 × 3–4 μm. Conidia 0(–1)-septate, in branched chains of up to 10, ellipsoid, pale brown, smooth, (6–)7–8(–10) × (2–)2.5(–3) μm; hila thickened, darkened and refractive, up to 1 μm diam.

Culture characteristics: On MEA spreading with sparse aerial mycelium and smooth margins; surface folded, centre pale mouse-grey to mouse-grey, margin iron-grey; reverse greenish black, reaching 15–20 mm diam after 2 wk; on PDA spreading with moderate aerial mycelium and smooth margins; surface olivaceous-grey, margin mouse-grey, reverse olivaceous-grey; reaching 30 mm diam; on OA spreading, folded with moderate aerial mycelium; surface pale mouse-grey (centre) to olivaceous-grey at margin, reaching 20 mm diam.

Host range and geographic distribution: Twig litter, Virginia, U.S.A.

Specimen examined: U.S.A., Virginia, Front Royal, N38°53'35” W78°10'50”, on twig debris, 14 May 2007, P.W. Crous, holotype CBS H-20344, cultures ex-type CPC 14034 = CBS 125424, CPC 14035, 14036.

Notes: Rachicladosporium cboliae is a cryptic species close to R. americanum, which was collected at the same site. They can be distinguished on the litter in that R. cboliae has conidiophores with densely branched tufts of conidia, in contrast to the more sparsely branched conidiophores of R. americanum. Furthermore, R. cboliae also forms prominent chains of chlamydospores in culture, which lacks in R. americanum. Finally, R. cboliae has smaller ramoconidia and conidia than those found in R. americanum (ramoconidia 13–23 × 3–4 μm; conidia 10–18 × 3–4 μm; Cheewangkoon ).

DISCUSSION

The class Dothideomycetes incorporates fungal taxa exhibiting a wide range of nutritional modes, and results in these fungi being found in many diverse niches (Fig. 13). The two largest orders Pleosporales (Zhang ; this volume) and Capnodiales encapsulate this diversity. Here we continue to expand sampling within the Capnodiales in order to provide a well founded phylogenetic scaffold for taxonomic classification, informative genomic sampling, ecological studies and evolutionary evaluations.

Fig. 13.

Members of Capnodiales exhibiting different ecological growth habits. A–C. Mycosphaerella marksii (plant pathogen). A. Leaf spot on Eucalyptus. B. Homothallic colony on MEA. C. Asci. D. Conidiophore of Cladosporium sphaerospermum (saprobe). E–G. Ascomata and asci of Davidiella macrocarpa (saprobe). H–J. Dissoconium dekkeri (plant pathogen, commensalist). H. Colony sporulating on MEA, with discharged conidia at the margin. I. Asci. J. Primary and secondary conidia attached to conidiophore. K–L. Dissoconium proteae (commensalist). K. Sporulation on MEA with microsclerotia. L. Two conidial types attached to conidiophore (arrow). M–Q. Conidioxyphium gardeniorum (sooty mold). M. Sporulation on MEA. N–P. Elongated, branched conidiomata with apical ostiolar hyphae. Q. Conidia. R–T. Leaf spot, ascus and verruculose ascospores of Teratosphaeria fibrillosa (plant pathogen). U–X. Schizothyrium pomi (epiphyte). U. Thyrothecia occurring on a Rhus stem. V. Ascomatal initials forming on OA. W. Asci. X. Conidiophore and conidia in vitro. Scale bars: E = 200 μm, M–O = 50 μm, all others = 10 μm.

Capnodiales

The Capnodiales currently contain nine families (Lumbsch & Huhndorf 2007, Kirk ), a selection of which are included in this study, namely Capnodiaceae, Davidiellaceae, Mycosphaerellaceae, Piedraiaceae, and Teratosphaeriaceae. Unfortunately, no cultures were available of the Antennulariellaceae and Metacapnodiaceae, while Coccodiniaceae was again shown to cluster outside the order, in Chaetothyriales (Crous ). Families supported within Capnodiales (Fig. 1) include Capnodiaceae, Davidiellaceae, Teratosphaeriaceae, Dissoconiaceae, Schizothyriaceae and Mycosphaerellaceae. No support was obtained for Piedraiaceae, which appeared to cluster within Teratosphaeriaceae.

One of the main aims of the present study was to resolve the status of the Capnodiales and Mycosphaerellales. Although we were able to distinguish a clear, well resolved node for the Mycosphaerellales (incl. Mycosphaerellaceae), this node was not well supported, and elevating it to ordinal level would mean that additional orders need to be introduced to accommodate several families outside the Capnodiales s. str. This finding led us to conclude that it is best to retain all families within a single, diverse order, namely the Capnodiales.

Evolution of nutritional modes and ecological growth habits

The ancestral state of the present assemblage of taxa is likely to be saprobic, as Phaeotheca (Sigler , de Hoog , Tsuneda ), and Comminutispora (Ramaley 1996) represent the earliest diverging lineages. This was similarly found for a majority of lineages in the larger context of Ascomycota (Schoch et al. 2009a, b). These taxa were not only all isolated from dead materials or substrates, but they also share the same unique mode of conidiogenesis, namely endoconidia, and a “black-yeast” appearance in culture. Phaeotheca, which is strongly halophilic (Zalar ) is closely related to the lichen Racodium rupestre, which forms an association with Trentepohlia algae, in which the filamentous algae is enclosed by melanised hyphae of the fungus. This feature is also shared by another lichen, namely Cystocoleus ebeneus (Teratosphaeriaceae) (Muggia ). The Capnodiaceae (sooty molds) that also cluster in a basal position in the tree are epiphytes, growing on insect exudates (honey dew). The Capnodiaceae are related to the Davidiellaceae, which represent Cladosporium and allied genera. This family contains a wide range of ecological adaptations, from primary plant pathogens, such as Graphiopsis chlorocephala on Paeonia (Schubert , Braun ), “Mycosphaerella” iridis on Iris (David 1997), to taxa opportunistic on humans, Cladosporium bruhnei (Schubert ), to halotolerant taxa, Cladosporium sphaerospermum (Zalar , Dugan ), to saprobes, C. herbarum, C. cladosporioides (Schubert ).

The Teratosphaeriaceae contains several disjunct elements, many of which may still eventually be removed from the family as more taxa and additional sequence data are added, providing a better resolution to some of these clades. In its widest sense, the family contains lichens (Anisomeridium, Cystocoleus), saprobes (Catenulostroma spp.), and halophilic, hyperhydrotic or lipophilic species that have been reported from humans (Piedraia, Hortaea, Penidiella, Stenella) (de Hoog , Bonifaz , Plemenitaš ), with the most derived clades tending to contain plant pathogens (Readeriella, Teratosphaeria).

Dissoconiaceae is an early diverging lineage to the Mycosphaerellaceae and Schizothyriaceae. Whereas most members of Dissoconiaceae appear to be commensalists, there is evidence that some species could be plant pathogenic (Jackson ), while the Schizothyriaceae contains epiphytes (Batzer ). The Mycosphaerellaceae contains species that are biotrophic (Polythrincium; Simon ), necrotrophic plant pathogens (Brunneosphaerella, Cercospora, Dothistroma, Pseudocercospora, Pseudocercosporella, Ramularia, and Septoria), as well as some species that are saprobic (Passalora, Pseudocercospora, Ramichloridium and Zasmidium; Arzanlou ), or endophytic (Pseudocercosporella endophytica; Crous 1998).

Within the Capnodiales, the positioning of saprobes such as Phaeotheca and Comminutispora and the sooty moulds (Capnodiaceae) may represent the more primitive state, from where transitions occurred to more lichenised, saprobic, biotrophic and nectrotrophic, plant pathogenic members of the order (Fig. 13). This appears to mirror the other large and diverse order in the class, the Pleosporales (Zhang ; this volume). Lichenisation, as well as the ability to be saprobic or plant pathogenic evolved more than once, though the taxa in the later diverging clades of the tree tend to be strictly nectrotrophic plant pathogens. This should be interpreted with care, however, as Polythrincium is presently the only biotrophic member included in this analysis, and other biotrophic members of the Capnodiales may end up clustering here, among the presently dominant nectrotropic plant pathogens. One important and recent addition to Capnodiales diversity is the rock-inhabiting fungi (Ruibal et al. 2008, 2009; this volume). Although so far mainly isolated from sources in Antarctica and the Mediterranean area, it is clear that they are a ubiquitous group of fungi likely found throughout the globe. Their genetic diversity is underscored by the fact that rock inhabiting fungi of convergent morphology are also placed in other ascomycotan classes and orders (Gueidan ). The fact that many of these species have reduced morphologies and are slow growers make their taxonomy challenging, but their phylogenetic placement within Teratosphaeriaceae and several other lineages within Capnodiales makes their inclusion in subsequent phylogenetic assessments of this order essential.

For this study, we designed novel primers to supplement primers presently available in literature. Although primers are usually designed for the genus or family of interest, they frequently tend to have a wider application. Therefore, we attempted to design our primers using a wide range of sequences from the GenBank sequence database, in the hope that these primers will eventually find application outside of the Capnodiales as well. Although this remains to be tested, we expect it to be the case. Our sequencing of the complete SSU and LSU for the selected members of the Capnodiales had a surprisingly large number of insertions present for numerous strains. Although some of these insertions were anticipated based on data already present in GenBank's database, the insertions in the LSU were not expected based on the sequences used for primer design. However, this could be a result of the fewer complete LSU sequences available in the database rather than a deviation on the part of members of the Capnodiales. More complete LSU sequences are needed from diverse orders to test whether this is the case or not. Some of the taxa sequenced during this study had insertions present at almost all of the possible insertion positions, e.g. Mycosphaerella latebrosa, Septoria quercicola and Teratosphaeria mexicana. These taxa are distributed throughout the tree, and do not only cluster in a basal position, and therefore it is difficult to predict why so many insertions were present. If these insertions were all present in a basal position, it would have been possible to argue that the higher number of insertions represents the ancestral condition, and that these insertions are lost during evolution. However, this proved not to be the case, and it could be that these taxa accumulated these insertions.

Although the present study adds significantly to our knowledge of the Capnodiales, the Capnodiaceae are still underrepresented, and probably consist of numerous diverse lineages that can be elevated to family level once our phylogenies become more resolved. Regardless of this fact, the Mycosphaerellaceae clade appears to be quite robust. It seems likely that further sampling of the diverse Teratosphaeriaceae will necessitate further taxonomic changes. The fact that the saprobic and plant pathogenic and endophytic modes have evolved several times in different families, suggest that many taxa can still easily adapt to changing environments. A focus on adding more lichenicolous taxa, and taxa occurring on non-plant substrates is crucial to provide further insight into the ecological adaptations occurring in the Capnodiales.