Literature DB >> 20151198

Biochemical abnormalities in a patient with thymidine phosphorylase deficiency with fatal outcome.

Jaap A Bakker1, Patrick Schlesser, Hubert J M Smeets, Baudouin Francois, Jörgen Bierau.   

Abstract

Deficiency of the cytosolic enzyme thymidine phosphorylase (TP) causes a multisystem disorder called mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) syndrome. Clinical symptoms are gastrointestinal dysfunction, muscle involvement and neurological deterioration. TP deficiency is biochemically characterised by accumulation of thymidine and deoxyuridine in body fluids and compromised mitochondrial deoxyribose nucleic acid (mtDNA) integrity (depletion and multiple deletions). In this report we describe a patient with the clinical and biochemical features related to the end stage of the disease. Home parenteral nutrition had started to improve the clinical condition and preparations were initiated for stem cell transplantation (SCT) as a last resort treatment. Unfortunately, the patient died during the induction phase of SCT. This report shows that TP deficiency is a severe clinical condition with a broad spectrum of affected tissues. TP deficiency can be easily determined by the measurement of pyrimidine metabolites in body fluids and TP activity in peripheral blood leucocytes. Early detection and treatment may prevent the progress of the clinical symptoms and, therefore, should be considered for inclusion in newborn screening programmes.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20151198      PMCID: PMC3757267          DOI: 10.1007/s10545-010-9049-y

Source DB:  PubMed          Journal:  J Inherit Metab Dis        ISSN: 0141-8955            Impact factor:   4.982


Introduction

In the 1990s thymidine phosphorylase (TP; EC 2.4.2.4 ) deficiency was identified as the most common cause of the clinical syndrome called mitochondrial neurogastrointestinal encephalomyopathy (MNGIE; OMIM 603041) (Nishino et al. 2000). As indicated in this acronym, TP deficiency affects several tissues (Table 1) (Nishino et al. 2001).
Table 1

Clinical features of our patient compared with those in the literature

Clinical symptomProbandLiterature (Nishino et al. 2001)
 Cachexia++
 Gastrointestinal manifestations ++
 Borborygmi++
 Abdominal pain++
 Diarrhoea++
 Diverticulosis++
 Pseudo-obstruction++
 Neurological manifestations ++
 Ptosis++
 Ophthalmoplegia++
 Peripheral neuropathy++
 Hearing loss++
 Depression+Unknown
Clinical features of our patient compared with those in the literature Although TP deficiency is a multisystem disease, the gastrointestinal problems are the most prominent and, in the majority of cases, are the presenting symptoms. Visceral manifestations are caused by mitochondrial dysfunction of the intestinal smooth muscle, and the mitochondrial abnormalities in oesophageal and small intestine biopsies were identical to the aberrations observed in skeletal muscle of patients with other mitochondrial diseases (Blondon et al. 2005; Giordano et al. 2008). Neurological symptoms are often mild, although, initially, magnetic resonance imaging (MRI) of the brain does not always reveal a leucoencephalopathy; ultimately, all patients develop leucoencephalopathy. The clinical picture develops gradually in the course of life, and mild cases can easily be misdiagnosed, especially when the symptoms are not recognised as part of a syndrome (Teitelbaum et al. 2002). When a mitochondrial disease is being considered, biochemical investigations often include measurement of the respiratory chain capacity in a muscle biopsy. A reduction in the overall oxidative phosphorylation (OXPHOS) capacity of the mitochondria can be observed in MNGIE, as well as decreased activity of the enzymes of the respiratory chain having mitochondrial deoxyribose nucleic acid (mtDNA)-encoded subunits (Marti et al. 2003). At the level of mtDNA, a decreased amount (depletion) and a loss of integrity (multiple mtDNA deletions) are observed, indicating a defect in mtDNA maintenance. Additional laboratory investigations show elevated concentrations of thymidine and deoxyuridine in all body fluids (Marti et al. 2003). The TP activity in MNGIE patients with homozygous or compound heterozygous TP mutations is normally barely detectable, whilst the activity is approximately 30% of control values in heterozygous carriers (Marti et al. 2004). Today, over 30 different mutations have been identified in the gene encoding TP, TYMP (GenBank no. NM_001953) (Laforce et al. 2009; Marti et al. 2005; Nishino et al. 2000).

Clinical history

At the age of 16 the patient was investigated because of frequent episodes of diarrhoea. At that time no gastrointestinal (GI) abnormalities were noted. Ten years later his GI symptoms had worsened and his overall clinical condition was poor. His body weight was 58 kg, resulting in a body mass index (BMI) of 16.6. During the following years frequent episodes of (micro)perforation of the intestinal tract resulted in resection of a part of the proximal jejunum. Furthermore, perforation of the sigmoid was diagnosed and was followed by a new resection of the affected part of the intestinal tract. Neurological investigations showed generalised muscle areflexia, bilateral ptosis and the beginnings of ophthalmoplegia. At that time MRI revealed massive supra- and infratentorial demyelinisation, although the leucoencephalopathy was asymptomatic. Investigations of a muscle biopsy showed a predominance of type 1 fibres; type 2 fibres were scarcely visible. Aberrations in the type 1 fibres (accumulation of lipid, glycogen depletion, myophagia), peripheral location of the mitochondria and excessive succinate dehydrogenase (SDH) activity in most fibres supported the diagnosis of a mitochondriopathy. Mutation analysis for TP was initiated and revealed a homozygous A to C transition in exon 7 (A3371C) (Nishino et al. 2000). In the following years the gastrointestinal problems worsened, resulting in chronic intestinal pseudo-obstruction (CIPO) with gastroparesia. Because of a further decrease in the BMI to 14.3, home parenteral nutrition was started. MRI showed cerebral ventriculomegaly, when compared to MRI images made 5 years earlier. Ptosis was still prominent, with decreased eye movements (ophthalmoplegia). Only at this time did the myopathy become clinically relevant. The family history revealed a sister with a clinical history of anorexia, denutrition, neurological problems and depression, who died in her thirties. Most probably this was a case of TP deficiency too. Other family members reported no clinical problems related to TP deficiency. To slow down the progression of the disease, stem cell transplantation (SCT) was considered. Family members were screened for human leucocyte antigen (HLA) genotype, TP activity and the genetic defect in the TYMP gene: both siblings were heterozygous carriers of the TYMP mutation and had TP activities in the heterozygous carrier range, but only one had an HLA genotype compatible with that of the patient. The patient was prepared for SCT, but unfortunately died during the induction phase of the chemotherapy.

Biochemical, enzymological and DNA investigations

Purine and pyrimidine metabolites in body fluids were analysed with liquid chromatography–tandem mass spectrometry (LC-MSMS) (Waters Micromass Quattro Micro). Purines and pyrimidines were detected in both electrospray ionisation (ESI)-positive mode and ESI-negative mode using multiple reaction monitoring (MRM). Thymidine phosphorylase activity was measured in isolated peripheral blood leucocytes, as described before (van Kuilenburg and Zoetekouw 2005). Briefly, lysed leucocytes (2.5—30 µg protein) were incubated with 2 mM thymidine at 37°C , pH 7.4 for 60 min. After termination of the reaction with perchloric acid, the samples were centrifuged, and the supernatant was neutralised and analysed by high-performance liquid chromatography (HPLC). Thymine concentrations were calculated against standard concentrations of thymine. Dihydropyrimidine dehydrogenase (DPD, EC 1.3.1.2.) activity was determined using incubation with 14C-labelled thymine as described before (Van Kuilenburg et al. 1997). Reference values for TP and DPD activity and pyrimidine metabolites in body fluids were established using samples originating from patients without MNGIE (n = 25). Screening for the familial mutation in exon 7 of the TYMP gene in the family members was done as described before (Nishino et al. 2000), with the exception that a different set of primers was used: forward primer TGGCAACCCAGGGTGCAGCA and reverse primer GGGCGGGGACGGGTCTTAG.

Results

Thymidine and deoxyuridine concentrations in the urine and plasma of the patient were strongly elevated (Table 2). In addition, analysis of purine and pyrimidine metabolites revealed an elevated excretion of thymine and uracil: 23 µmol/mmol creatinine and 51 µmol/mmol creatinine, respectively (reference values <1 µmol/mmol creatinine and 1.0–14 µmol/mmol creatinine). Dihydropyrimidines were not detectable. In plasma, uracil and thymine were undetectable. Thymidine and deoxyuridine were not detectable in the plasma of the parents and the siblings.
Table 2

TP activities in leucocytes and metabolite concentrations in body fluids of the proband and family members

SubjectTP activity (nmol/mg protein per hour)Thymidine in plasma (µmol/l)Deoxyuridine in plasma (µmol/l)Thymidine in urine (µmol/mmol creatinine)Deoxyuridine in urine (µmol/mmol creatinine)
Proband1010202951
Father200n.d.n.d.
Mother320n.d.n.d.
Sister300n.d.n.d.
Brother260n.d.n.d.
Reference360–830<0.1<0.1<5<1

n.d., not detectable

TP activities in leucocytes and metabolite concentrations in body fluids of the proband and family members n.d., not detectable Amino acid analysis in the patient showed a mild generalised hyperaminoaciduria; furthermore, the excretion of ethylmalonic acid (EMA) and creatine was slightly elevated (data not shown). TP activity in peripheral white blood cells (WBCs) of the patient was consistent with the diagnosis MNGIE (Table 2). TP activity in the parents and siblings of the patient were in the heterozygous carrier range. The presence of thymine and uracil urged us to measure DPD activity. The specific DPD activity in the patient was in the normal range, at 16.04 nmol/mg protein per hour [reference values (n = 24) 16.54 ± 4.57 nmol/mg protein per hour] in lymphocytes. Sequencing of the TYMP gene revealed that the proband was homozygous for a c.866A > C mutation in exon 7, resulting in the substitution of glutamic acid by alanine at position 289 of the protein (p.E289A). The siblings and both parents were heterozygous carriers for this mutation.

Discussion

Deficiency of thymidine phosphorylase consistently results in elevated concentrations of thymidine and deoxyuridine in body fluids (Marti et al. 2004). The excess availability of, especially, thymidine causes an intracellular (intramitochondrial) imbalance in deoxynucleotide triphosphates, leading to disturbances in mtDNA replication and maintenance. This results in reduced mtDNA copy number (depletion) and multiple deletions in the mtDNA, which affect the enzymes involved in oxidative phosphorylation (Lopez et al. 2009; Pontarin et al. 2006). Investigations of muscle confirmed the presence of a mitochondriopathy. Elevated EMA excretion is suggestive of malfunction of the mitochondrial electron transport system. Proximal tubulopathy, often associated with mitochondrial disease, may be the cause of the mild hyperaminoaciduria in our patient. We observed an increased excretion of thymine and uracil in our patient, which has been described before (Fairbanks et al. 2002). Because of the normal activity of DPD and the absence of dihydropyrimidines and N-carbamoyl amino acids, a defect in pyrimidine degradation does not seem plausible. The bi-directionality of TP might partly explain the elevated excretion of thymine and uracil (Temmink et al. 2007). Therapy for TP deficiency is still not well established. Dialysis and platelet infusions have been used, both unsuccessful in the attempts to lower the circulating concentrations of thymidine and deoxyuridine permanently (la Marca et al. 2006; Lara et al. 2006). Allogenic stem cell transplantation (SCT) has been more successful in correcting the metabolic derangements: restoration of TP activity was observed, and concentrations of thymidine and deoxyuridine in plasma decreased to undetectable levels (Hirano et al. 2006). SCT was the primary goal in the treatment of our patient, despite the poor clinical condition. Both siblings were considered as stem cell donors. Although TP activities were in the heterozygous range, we reasoned that this would be sufficient to correct the metabolic derangements, as individuals with >8% residual activity do not develop MNGIE syndrome (Marti et al. 2005). However, before the SCT procedure could be initiated, the patient died. The underlying mechanism as to why TP deficiency presents in adulthood in most cases remains unclear. The genetic defect and the subsequent metabolic derangement are obviously present from the start of life. In vitro studies with cultured skin fibroblasts of TP patients have shown reduced cytochrome C oxidase (COX) activity (Nishigaki et al. 2003). Immunocytochemical staining for the mtDNA-encoded COX subunit 1 in fibroblasts of TP patients showed a mosaic expression pattern, in contrast to that of control fibroblasts, where the staining was uniform (Taanman et al. 2009). Furthermore, site-specific mtDNA point mutations were detected in cultured skin fibroblasts of TP patients. Multiple deletions and depletions were not detectable (Nishigaki et al. 2003; Taanman et al. 2009). Only when fibroblast were exposed to an excess of thymidine and deoxyuridine over a longer period did the mtDNA content decrease (Pontarin et al. 2006). When the nucleosides were withdrawn, the mtDNA content returned to normal. This phenomenon suggests a dose-accumulation effect in TP deficiency before clinical symptoms occur, caused by depletion or multiple deletions of the mtDNA.

Conclusion

TP deficiency is a multisystem, and ultimately fatal, disease. The most promising cure is SCT and has to be considered for all patients with TP deficiency. Transplantation with stem cells from heterozygous siblings can, in principle, correct the metabolic defect (Hirano et al. 2006). It can be expected that all the reversible clinical symptoms will be resolved, because, so far, no patients with MNGIE-like symptoms and heterozygous TP activities have been described. Early detection of TP deficiency is therefore of utmost importance, and we advocate the inclusion of screening for elevated thymidine and deoxyuridine concentrations as markers for TP deficiency in neonatal screening programmes.
  20 in total

1.  Deoxyuridine accumulation in urine in thymidine phosphorylase deficiency (MNGIE).

Authors:  L D Fairbanks; A M Marinaki; E A Carrey; S R Hammans; J A Duley
Journal:  J Inherit Metab Dis       Date:  2002-11       Impact factor: 4.982

2.  Diagnosis and management of MNGIE syndrome in children: case report and review of the literature.

Authors:  J E Teitelbaum; C B Berde; S Nurko; C Buonomo; A R Perez-Atayde; V L Fox
Journal:  J Pediatr Gastroenterol Nutr       Date:  2002-09       Impact factor: 2.839

Review 3.  MNGIE: from nuclear DNA to mitochondrial DNA.

Authors:  I Nishino; A Spinazzola; M Hirano
Journal:  Neuromuscul Disord       Date:  2001-01       Impact factor: 4.296

4.  The activity of dihydropyrimidine dehydrogenase in human blood cells.

Authors:  A B Van Kuilenburg; M J Blom; H Van Lenthe; E Mul; A H Van Gennip
Journal:  J Inherit Metab Dis       Date:  1997-07       Impact factor: 4.982

5.  Mitochondrial neurogastrointestinal encephalomyopathy: an autosomal recessive disorder due to thymidine phosphorylase mutations.

Authors:  I Nishino; A Spinazzola; A Papadimitriou; S Hammans; I Steiner; C D Hahn; A M Connolly; A Verloes; J Guimarães; I Maillard; H Hamano; M A Donati; C E Semrad; J A Russell; A L Andreu; G M Hadjigeorgiou; T H Vu; S Tadesse; T G Nygaard; I Nonaka; I Hirano; E Bonilla; L P Rowland; S DiMauro; M Hirano
Journal:  Ann Neurol       Date:  2000-06       Impact factor: 10.422

6.  Late-onset MNGIE due to partial loss of thymidine phosphorylase activity.

Authors:  Ramon Martí; Jan J G M Verschuuren; Alan Buchman; Ikuo Hirano; Saba Tadesse; André B P van Kuilenburg; Albert H van Gennip; Ben J H M Poorthuis; Michio Hirano
Journal:  Ann Neurol       Date:  2005-10       Impact factor: 10.422

7.  Determination of thymidine phosphorylase activity by a non-radiochemical assay using reversed-phase high-performance liquid chromatography.

Authors:  André B P van Kuilenburg; Lida Zoetekouw
Journal:  J Chromatogr B Analyt Technol Biomed Life Sci       Date:  2005-06-25       Impact factor: 3.205

8.  Elevated plasma deoxyuridine in patients with thymidine phosphorylase deficiency.

Authors:  Ramon Martí; Yutaka Nishigaki; Michio Hirano
Journal:  Biochem Biophys Res Commun       Date:  2003-03-28       Impact factor: 3.575

9.  Definitive diagnosis of mitochondrial neurogastrointestinal encephalomyopathy by biochemical assays.

Authors:  Ramon Martí; Antonella Spinazzola; Saba Tadesse; Ichizo Nishino; Yutaka Nishigaki; Michio Hirano
Journal:  Clin Chem       Date:  2003-11-18       Impact factor: 8.327

10.  Site-specific somatic mitochondrial DNA point mutations in patients with thymidine phosphorylase deficiency.

Authors:  Yutaka Nishigaki; Ramon Martí; William C Copeland; Michio Hirano
Journal:  J Clin Invest       Date:  2003-06       Impact factor: 14.808

View more
  2 in total

1.  Emergency surgery in chronic intestinal pseudo-obstruction due to mitochondrial neurogastrointestinal encephalomyopathy: case reports.

Authors:  Pablo Granero Castro; Sebastián Fernández Arias; María Moreno Gijón; Paloma Alvarez Martínez; José Granero Trancón; Jose Antonio Álvarez Pérez; Eduardo Lamamie Clairac; Juan José González González
Journal:  Int Arch Med       Date:  2010-12-08

2.  Allogeneic haematopoietic stem cell transplantation for mitochondrial neurogastrointestinal encephalomyopathy.

Authors:  Joerg P Halter; W Michael; M Schüpbach; Hanna Mandel; Carlo Casali; Kim Orchard; Matthew Collin; David Valcarcel; Attilio Rovelli; Massimiliano Filosto; Maria T Dotti; Giuseppe Marotta; Guillem Pintos; Pere Barba; Anna Accarino; Christelle Ferra; Isabel Illa; Yves Beguin; Jaap A Bakker; Jaap J Boelens; Irenaeus F M de Coo; Keith Fay; Carolyn M Sue; David Nachbaur; Heinz Zoller; Claudia Sobreira; Belinda Pinto Simoes; Simon R Hammans; David Savage; Ramon Martí; Patrick F Chinnery; Ronit Elhasid; Alois Gratwohl; Michio Hirano
Journal:  Brain       Date:  2015-08-10       Impact factor: 13.501

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.