| Literature DB >> 19815687 |
Dov Moldovan1, Andrew Spriggs, Jun Yang, Barry J Pogson, Elizabeth S Dennis, Iain W Wilson.
Abstract
Low-oxygen (hypoxia) stress associated with natural phenomena such as waterlogging, results in widespread transcriptome changes and a metabolic switch from aerobic respiration to anaerobic fermentation. High-throughput sequencing of small RNA libraries obtained from hypoxia-treated and control root tissue identified a total of 65 unique microRNA (miRNA) sequences from 46 families, and 14 trans-acting small interfering RNA (tasiRNA) from three families. Hypoxia resulted in changes to the abundance of 46 miRNAs from 19 families, and all three tasiRNA families. Chemical inhibition of mitochondrial respiration caused similar changes in expression in a majority of the hypoxia-responsive small RNAs analysed. Our data indicate that miRNAs and tasiRNAs play a role in gene regulation and possibly developmental responses to hypoxia, and that a major signal for these responses is likely to be dependent on mitochondrial function.Entities:
Mesh:
Substances:
Year: 2010 PMID: 19815687 PMCID: PMC2791121 DOI: 10.1093/jxb/erp296
Source DB: PubMed Journal: J Exp Bot ISSN: 0022-0957 Impact factor: 6.992
Summary of small RNA sequencing data from control and hypoxia treated roots
| Untreated sample | Treated sample | |
| Total reads | 2 550 664 | 2 998 711 |
| Reads containing N | 32 278 | 7 152 |
| Reads without N | 2 518 386 | 2 991 559 |
| Adaptor only sequences | 268 521 | 334 287 |
| Low quality sequences removed | 4 186 | 8 215 |
| Sequences with small insert (<18 nt) | 444 444 | 997 892 |
| Sequences with large insert (>26 nt) | 406 465 | 164 682 |
| Unique sequences | 383 969 | 390 392 |
Fig. 1.Size distribution of sequenced reads from control and hypoxia-treated roots. Small RNAs (16-30 nt) was isolated from untreated (grey bars) and hypoxia-treated (0.1% O2 for 5 h (black bars) root samples and sequenced using a Illumina 1G Genome Analyzer. Sequences were trimmed of their adapter sequence.
Known miRNAs present in hypoxia treated and control roots
| miRNA family | miRNA | Sequence | Untreated reads | Hypoxia reads | Relative change |
| 156 | 156a,b,c,d,e,f | UGACAGAAGAGAGUGAGCAC | 4 382 | 6 958 | 1.35* |
| 156g | CGACAGAAGAGAGUGAGCAC | 17 | 55 | 2.75* | |
| 156h | UGACAGAAGAAAGAGAGCAC | 2 | 5 | 2.13 | |
| 157 | 157a,b,c | UUGACAGAAGAUAGAGAGCAC | 4 119 | 8 409 | 1.74* |
| 157d | UGACAGAAGAUAGAGAGCAC | 58 | 282 | 4.14* | |
| 158 | 158a | UCCCAAAUGUAGACAAAGCA | 2 427 | 7 981 | 2.80* |
| 158b | CCCCAAAUGUAGACAAAGCA | 34 | 69 | 1.73* | |
| 159 | 159a | UUUGGAUUGAAGGGAGCUCUA | 73 | 162 | 1.89* |
| 159b | UUUGGAUUGAAGGGAGCUCUU | 11 | 14 | 1.08 | |
| 160 | 160a,b,c | UGCCUGGCUCCCUGUAUGCCA | 1 | 2 | 1.70 |
| 161 | 161.1 | UGAAAGUGACUACAUCGGGGU | 39 | 65 | 1.42* |
| 161.2 | UCAAUGCAUUGAAAGUGACUA | 20 | 119 | 5.06* | |
| 163 | 163 | UUGAAGAGGACUUGGAACUUCGAU | 2 | 4 | 1.70 |
| 164 | 164a,b | UGGAGAAGCAGGGCACGUGCA | 2 362 | 3 151 | 1.13* |
| 164c | UGGAGAAGCAGGGCACGUGCG | 452 | 550 | 1.04 | |
| 165 | 165a,b | UCGGACCAGGCUUCAUCCCCC | 14 977 | 15 750 | 0.89* |
| 166 | 166a,b,c,d,e,f,g | UCGGACCAGGCUUCAUUCCCC | 79 589 | 84 844 | 0.91* |
| 167 | 167a,b | UGAAGCUGCCAGCAUGAUCUA | 1 429 | 1 709 | 1.02 |
| 167d | UGAAGCUGCCAGCAUGAUCUGG | 1 | 4 | 3.40* | |
| 168 | 168a,b | UCGCUUGGUGCAGGUCGGGAA | 7 584 | 9 932 | 1.11* |
| 169 | 169a | CAGCCAAGGAUGACUUGCCGA | 10 | 3 | 0.26* |
| 169b,c | CAGCCAAGGAUGACUUGCCGG | 1 | 8 | 6.80* | |
| 169d,e,f,g | UGAGCCAAGGAUGACUUGCCG | 92 | 61 | 0.56* | |
| 169h,i,j,k,l,m,n | UAGCCAAGGAUGACUUGCCUG | 3 | 6 | 1.70 | |
| 171 | 171a | UGAUUGAGCCGCGCCAAUAUC | 0 | 2 | NA** |
| 172 | 172a, b | AGAAUCUUGAUGAUGCUGCAU | 15 | 93 | 5.27* |
| 172c,d | AGAAUCUUGAUGAUGCUGCAG | 2 | 2 | 0.85 | |
| 172e | GGAAUCUUGAUGAUGCUGCAU | 4 | 2 | 0.43 | |
| 173 | 173 | UUCGCUUGCAGAGAGAAAUCAC | 213 | 375 | 1.50* |
| 319 | 319a,b | UUGGACUGAAGGGAGCUCCCU | 1 | 0 | NA |
| 390 | 390a,b | AAGCUCAGGAGGGAUAGCGCC | 1 652 | 3 124 | 1.61* |
| 391 | 391 | UUCGCAGGAGAGAUAGCGCCA | 25 | 77 | 2.62* |
| 395 | 395a,d,e | CUGAAGUGUUUGGGGGAACUC | 1 | 2 | 1.70 |
| 395b,c,f | CUGAAGUGUUUGGGGGGACUC | 2 | 5 | 2.13 | |
| 399 | 399a | UGCCAAAGGAGAUUUGCCCUG | 1 | 1 | 0.85 |
| 399b,c | UGCCAAAGGAGAGUUGCCCUG | 4 | 3 | 0.64 | |
| 399d | UGCCAAAGGAGAUUUGCCCCG | 5 | 1 | 0.17 | |
| 399f | UGCCAAAGGAGAUUUGCCCGG | 11 | 12 | 0.93 | |
| 400 | 400 | UAUGAGAGUAUUAUAAGUCAC | 2 | 1 | 0.43 |
| 403 | 403 | UUAGAUUCACGCACAAACUCG | 2 | 4 | 1.70 |
| 408 | 408 | AUGCACUGCCUCUUCCCUGGC | 125 | 138 | 0.94 |
| 447 | 447a,b | UUGGGGACGAGAUGUUUUGUUG | 5 | 3 | 0.51 |
| 775 | 775 | UUCGAUGUCUAGCAGUGCCA | 9 | 27 | 2.55* |
| 780 | 780.1 | UCUAGCAGCUGUUGAGCAGGU | 0 | 1 | NA |
| 822 | 822 | UGCGGGAAGCAUUUGCACAUG | 115 | 121 | 0.89 |
| 823 | 823 | UGGGUGGUGAUCAUAUAAGAU | 6 | 10 | 1.42 |
| 824 | 824 | UAGACCAUUUGUGAGAAGGGA | 20 | 39 | 1.66* |
| 827 | 827 | UUAGAUGACCAUCAACAAACU | 10 | 20 | 1.70 |
| 829 | 829.1 | AGCUCUGAUACCAAAUGAUGGAAU | 1 564 | 1 228 | 0.67* |
| 829.2 | CAAAUUAAAGCUUCAAGGUAG | 1 | 0 | NA | |
| 830 | 830 | UAACUAUUUUGAGAAGAAGUG | 1 | 0 | NA |
| 837 | 837-3p | AAACGAACAAAAAACUGAUGG | 14 | 27 | 1.64* |
| 837-5p | AUCAGUUUCUUGUUCGUUUCA | 1 | 1 | 0.85 | |
| 838 | 838 | UUUUCUUCUACUUCUUGCACA | 0 | 1 | NA |
| 841 | 841 | UACGAGCCACUUGAAACUGAA | 1 | 0 | NA |
| 842 | 842 | UCAUGGUCAGAUCCGUCAUCC | 23 | 24 | 0.89 |
| 843 | 843 | UUUAGGUCGAGCUUCAUUGGA | 0 | 2 | NA |
| 846 | 846 | UUGAAUUGAAGUGCUUGAAUU | 3 | 3 | 0.85 |
| 848 | 848 | UGACAUGGGACUGCCUAAGCUA | 10 | 14 | 1.19 |
| 852 | 852 | AAGAUAAGCGCCUUAGUUCUG | 1 | 2 | 1.70 |
| 860 | 860 | UCAAUAGAUUGGACUAUGUAU | 0 | 2 | NA |
| 861 | 861-5p | CCUUGGAGAAAUAUGCGUCAA | 1 | 0 | NA |
| 862 | 862-5p | UCCAAUAGGUCGAGCAUGUGC | 0 | 3 | NA |
| 869 | 869.2 | UCUGGUGUUGAGAUAGUUGAC | 50 | 57 | 0.97 |
| 1888 | 1888 | UAAGUUAAGAUUUGUGAAGAA | 0 | 2 | NA |
Relative change is the ratio of hypoxia-treated sample to the control and takes into account the differences in total read between samples. *P value ≤0.01. **Relative change was not calculated as they contained 0 reads in one sample.
Known tasiRNA present in control and hypoxia treated roots
| tasiRNA | TAS locus | Sequence | Untreated reads | Hypoxia reads | Relative change |
| 1786 | TAS1a | UGAUAUUUGUAGUAAUGGCG | 1 | 6 | 5.10* |
| 1852 | TAS1a | AUGAUAUUUGUAGUAAUGGCG | 430 | 863 | 1.71* |
| 255 | TAS1a,b,c | UUCUAAGUCCAACAUAGCGUA | 20 | 61 | 2.59* |
| 289 | TAS1a,b,c | UUCUAAGUCCAACAUAGCAUA | 3 | 16 | 4.54* |
| 619 | TAS1c | AUAUUCCAGGAUAUGCAAAAG | 0 | 1 | NA** |
| 850 | TAS1c | UUCUAAGUUCAACAUAUCGAC | 0 | 2 | NA |
| 1413 | TAS1c | UUCUAAGUUCAACAUAUCGACG | 0 | 1 | NA |
| 143 | TAS2 | AUAAUCAAGUGAAUAGUUUAA | 3 | 9 | 2.55* |
| 614 | TAS2 | GAUGGUAGUUCAAGUAUUCCA | 7 | 21 | 2.55* |
| 1511 | TAS2 | UCCAAGCGAAUGAUGAUACUU | 25 | 90 | 3.06* |
| 1767 | TAS2 | UUUGAACUUGUGUAUUUUGAA | 10 | 26 | 2.21* |
| 1940 | TAS2 | GAAUACUUGAACUACCAUCUA | 6 | 4 | 0.57 |
| 2140 | TAS2 | AUAUCCCAUUUCUACCAUCUG | 2 | 14 | 5.95* |
| 2142 | TAS3a | UUCUUGACCUUGUAAGACCCC | 337 | 469 | 1.18* |
Relative change is the ratio of hypoxia-treated sample to the untreated control and takes into account differences in total read between samples. *P value≤0.01; ** Relative change was not calculated as they contained 0 reads in one sample.
Expression levels of selected miRNAs and a tasiRNA under hypoxia stress and mitochondrial inhibitor treatment
| smRNA | Hypoxia | Mitochondrial inhibitor | |
| Sequencing | QRT-PCR | QRT-PCR | |
| miR156g | 2.75 | 3.9 | 2.6 |
| miR157d | 4.14 | 3.2 | 2.5 |
| miR158a | 2.8 | 3.2 | 2.0 |
| miR159a | 1.89 | 3.8 | 2.0 |
| miR172a, b | 5.27 | 2.8 | 1.1 |
| miR391 | 2.62 | 4.0 | 2.0 |
| miR775 | 2.55 | 1.9 | 2.1 |
| tasiR289 (Tas1a,b,c) | 4.54 | 13 | 1.9 |
Average of at least three biological replications performed in triplicate.
Relative change is the ratio of hypoxia-treated sample to the control.
QRT-PCR relative expression of experimentally determined or predicted gene targets of selected smRNAs
| smRNA | Target genes | Relative change by QRT-PCR | Target gene details |
| miR156g | |||
| & | |||
| miR157d | |||
| miR157d | |||
| miR158a | AT1G64100 | 3.01 | Pentatricopeptide repeat-containing |
| AT3G03580 | 1.2 | Pentatricopeptide repeat-containing | |
| miR159a | AT2G26950 | 1.99 | Myb domain 104 |
| miR172a,b | |||
| AT2G39250 | 1.85 | Schnarchzapfen | |
| miR391a | At1g50990 | 6.49 | Protein kinase |
| miR775 | |||
| tasiR289 | At1g15940 | ND | Unknown |
| (TAS1) | At1g51670 | 0.23 | Unknown, contains domain cysteine proteinases |
| At1g68840 | 2.57 | Regulator ATPase of the vacuolar membrane (RAP2.8) | |
| At2g42090 | 6.15 | Actin 9 | |
| At3g27230 | 0.31 | Unknown | |
| At3g61320 | 0.67 | Chloroplast precursor | |
| At4g05360 | 4.65 | Zinc knuckle (CCHC-type) family | |
| At4g29760 | ND** | Unknown, contains domain cysteine proteinases | |
| At5g18065 | 5.13 | Unknown, contains domain cysteine proteinases | |
| At5g42670 | 1.09 | Agenet domain-containing | |
| At5g52070 | 1.25 | Agenet domain-containing |
Targets in bold have been verified experimentally.
Relative change is the ratio of hypoxia-treated sample to the control. The value is an average of at least two biological replications performed in triplicate. *Primers amplified both these genes. **Not detected (ND).
Fig. 2.A hypothetical model of the regulation of hypoxia-responsive miRNAs and tasiRNAs and their potential roles on Arabidopsis root responses. Flooding reduces oxygen levels until it reaches a critical threshold that is sensed by an unknown mechanism either in the nucleus or mitochondria. Once sensed, a HD-ZIP is induced that regulates a suite of miRNAs. These miRNA are potentially involved in halting root growth and developmental responses in the root that occur after hypoxia such as root branching, as well as regulating tasiRNA expression that regulates PPRs involved in mitochondrial function. Impairing mitochondrial function can also regulate a subset of hypoxia-responsive miRNA and tasiRNAs possibly as a result of increased ROS levels and calcium signalling leading to retrograde regulation. Promotive effects are shown by ‘→’; repressive effects by ‘–’.