An upstream activation sequence controls the expression of AOX1 gene in Pichia pastoris.

Alcohol oxidase I gene (AOX1) promoter (P(AOX1)) is a key promoter in the methylotrophic yeast Pichia pastoris. To identify the cis-acting element in the AOX1 promoter, we constructed expression plasmids in which the green fluorescent protein (GFP) gene coding region was fused to a series of internal deletion mutants of the AOX1 promoter. By analyzing the expression and transcription level of GFP by each plasmid, we identified a positive cis-element, Region D, which is located between positions -638 and -510 of the AOX1 promoter. This region contains an invert repeat-like sequence GTGGGGTCAAATAGTTTCATGTTCCCCAA that is similar to the upstream activation sequence 1 (UAS1) of alcohol dehydrogenase II gene (ADH2) in Saccharomyces cerevisiae. The inverted repeat sequence in the UAS1 is known to contain the binding site for alcohol dehydrogenase II synthesis regulator (Adr1p). When three tandem copies of Region D were inserted into the Region D-deleted AOX1 promoter, the expression of GFP at the protein level and the mRNA level increased to 157% and 135% of the wild type, respectively. An electrophoretic mobility shift assay indicated that Region D could form a DNA-protein complex with cell extracts under methanol-induced and glucose/methanol-repressed conditions. These data suggest that Region D may function as a cis-acting regulatory element in the AOX1 promoter to positively regulate the expression of AOX1.