Literature DB >> 19777065

Lymphocyte display: a novel antibody selection platform based on T cell activation.

Vanesa Alonso-Camino1, David Sánchez-Martín, Marta Compte, Laura Sanz, Luis Alvarez-Vallina.   

Abstract

Since their onset, display technologies have proven useful for the selection of antibodies against a variety of targets; however, most of the antibodies selected with the currently available platforms need to be further modified for their use in humans, and are restricted to accessible antigens. Furthermore, these platforms are not well suited for in vivo selections. We present here a novel cell based antibody display platform, which takes advantage of the functional capabilities of T lymphocytes. The display of antibodies on the surface of T lymphocytes, as a part of a chimeric-immune receptor (CIR) mediating signaling, may ideally link the antigen-antibody interaction to a demonstrable change in T cell phenotype, due to subsequent expression of the early T cell activation marker CD69. In this proof-of-concept, an in vitro selection was carried out using a human T cell line lentiviral-transduced to express a tumor-specific CIR on the surface, against a human tumor cell line expressing the carcinoembryonic antigen. Based on an effective interaction between the CIR and the tumor antigen, we demonstrated that combining CIR-mediated activation with FACS sorting of CD69(+) T cells, it is possible to isolate binders to tumor specific cell surface antigen, with an enrichment factor of at least 10(3)-fold after two rounds, resulting in a homogeneous population of T cells expressing tumor-specific CIRs.

Entities:  

Mesh:

Substances:

Year:  2009        PMID: 19777065      PMCID: PMC2747005          DOI: 10.1371/journal.pone.0007174

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The display of foreign polypeptides and proteins on the surface of viruses or cells provides an important tool for the engineering of biomolecules and the analysis of their interactions with binding partners [1]–[3]. The microbial surface display technologies for screening antibody libraries include phage, yeast and bacteria platforms [4]. Cell-free systems, as ribosomal display, are also available [4]. Although the above mentioned systems have been successfully used for the isolation of antibodies, concerns may rise about the lack of post-translational modifications and proper folding of selected proteins. In order to allow processing of the displayed antibody in a eukaryotic environment, screening systems based on viruses and mammalian cells have been described. The potential of retroviral display for the generation and screening of eukaryotic expression libraries has been demonstrated for small peptides [5], [6] and antibodies [3], [7]. Remarkably, antibodies selected from retroviral libraries exhibit CDR sequences clearly different to those of antibodies selected from phage libraries [3]. We could hypothesize that these differences arise from the adaptation of molecular parameters, such as codon usage, polypeptide folding and resistance to inactivation by mammalian cell proteases. Although other mammalian cell surface display platforms have been developed [8]–[11], such methods, similar to phage and ribosome display, are enrichment techniques based purely on physical interactions and require multiple rounds of selection to be carried out. This is an important drawback; specially taking into account the limited number of antibodies that can be screened in a mammalian cell-based platform In this report, we describe the design and testing of a mammalian cell surface display platform in T lymphocytes. The display of single chain antibodies (scFv) on the surface of T lymphocytes, as a part of a fusion protein mediating signaling, may ideally link the interaction of scFvs with their antigen to a demonstrable change in T cell phenotype, due to subsequent expression of activation molecules. Chimeric immune receptor (CIR) genes are composed of a recognition unit attached to the transmembrane and intracytoplasmic sequences of a signalling molecule derived either from the ζ chain of the TCR/CD3 complex or from the γ chain associated with some Fc receptors (FcR) [12]. CIRs enable us to target various types of effector cells toward any tumor-associated antigen (TAA) for which a suitable mAb exists [13]. These Ag-selective cell therapies have been designed to convert therapeutically important TAAs, expressed on the cell surface, into recruitment points of effector functions, and to address the goal of MHC- and exogenous cytokine-independent activation of effector cells, highly restricted to tumor areas. Upon encountering antigen, the interaction of the grafted CIR triggers effector functions and can mediate cytolysis of tumor cells [14]. The utility and effectiveness of the CIR approach have been demonstrated in a variety of animal models where tumor-specific CIRs drove the adoptive transferred autologous T lymphocytes to accumulate at the tumor site in vivo and prevented tumor growth [13], [14]. The platform presented in this paper allows a positive selection based on both the existence of an effective interaction, and the expression of the early T cell activation marker CD69. The surface level of CD69 can be used both as a “quality control” of antibody interaction, and as a sorting parameter. Using a human T cell line, gene-modified to express a tumor-specific CIR on their surface, and a human tumor cell line we demonstrated that combining CIR-mediated activation with FACS sorting of CD69+ T cells, it is possible to isolate binders to tumor specific cell surface antigen, with an enrichment factor of 103 -fold after two rounds.

Results

Construction of a lentiviral vector encoding a tumor-specific CIR

In order to generate a model for validating a selection platform based on molecular and cellular events associated with T cell activation, we constructed the HIV-1 based lentiviral vector pRRL-αCEA-CIR-IRES-EGFP (Fig. 1A), containing a bicistronic expression cassette encoding a TCRζ-based CIR and EGFP, as reporter gene. The CIR comprises a human immunoglobulin signal peptide, a FLAG epitope, and the anti-carcinoembrionyc antigen (CEA) scFv antibody MFE23 [15], fused to the transmembrane and cytoplasmic regions of the human TCRζ-chain [16].
Figure 1

Schematic representation of lentiviral vector constructs.

(A) Control monocistronic vector (pRRL-IRES-EGFP) containing only the enhanced-green fluorescent protein (EGFP) gene and bicistronic vector (pRRL-αCEA-CIR-IRES-EGFP) containing the chimeric immune receptor (CIR) gene and the EGFP sequence. LTR, long terminal repeats; ΔGAG, ATG-deleted group specific antigen; RRE, Rev-responsive cis-acting element; CMV promoter; ECMV IRES, enceohalomyocarditis virus internal ribosomal entry site. (B) FACS analysis of EGFP expression after transduction of Jurkat cells with EGFP encoding lentiviral vectors at different MOIs, ranging from 0.25 to 10. (C) FACS analysis of EGFP and cell surface CIR expression after transduction of Jurkat cells with CIR-EGFP encoding lentiviral vectors at MOI of 1.

Schematic representation of lentiviral vector constructs.

(A) Control monocistronic vector (pRRL-IRES-EGFP) containing only the enhanced-green fluorescent protein (EGFP) gene and bicistronic vector (pRRL-αCEA-CIR-IRES-EGFP) containing the chimeric immune receptor (CIR) gene and the EGFP sequence. LTR, long terminal repeats; ΔGAG, ATG-deleted group specific antigen; RRE, Rev-responsive cis-acting element; CMV promoter; ECMV IRES, enceohalomyocarditis virus internal ribosomal entry site. (B) FACS analysis of EGFP expression after transduction of Jurkat cells with EGFP encoding lentiviral vectors at different MOIs, ranging from 0.25 to 10. (C) FACS analysis of EGFP and cell surface CIR expression after transduction of Jurkat cells with CIR-EGFP encoding lentiviral vectors at MOI of 1. The human T cell line Jurkat was used as a model system to express the anti-CEA CIR and to test their ability to initiate T cell activation in response to tumor specific cell surface antigen. Jurkat cells were transduced with VSV-G pseudotyped lentiviral vectors encoding EGFP at different MOIs and flow cytometry analysis was used to evaluate the level of EGFP expression (Fig. 1B). Since transduction at low MOIs did not result in a substantial decrease of the EGFP expression, Jukat cells were infected at MOI 1 with VSV-G pseudotyped lentiviral vectors encoding both EGFP alone (EGFP) or anti-CEA CIR and EGFP (αCEA-CIR-EGFP), to ascertain expression of a single antibody species per infected cell. Flow cytometry analysis (Fig. 1C) revealed that in both cases over 95% of the cells were EGFP+. Analysis of cell-surface CIR expression demonstrated than approximately 60% of JurkatαCEA-CIR-EGFP cells expressed the FLAG-tagged anti-CEA CIR at detectable levels, although there was considerable heterogeneity in the absolute levels of expression (Fig. 1C). The difference between the absolute levels of EGFP and CIR expression may be due to the different characteristics and location of both proteins.

Antigen-specific activation of T cells expressing tumor-specific CIRs

We then examinated the activity of the FLAG-tagged anti-CEA CIR as a functional receptor molecule. JurkatαCEA-CIR-EGFP cells could be activated to secrete IL-2, upon antigen-mediated ligation of their binding domain by plastic immobilized CEA (iCEA) or membrane-bound CEA (mCEA) (Fig. 2). We next investigated the expression of the very early activation antigen CD69 in JurkatαCEA-CIR-EGFP and JurkatEGFP cells co-cultured overnight in the presence of CEA-negative (HeLa) or CEA-positive (HeLaCEA) cells (Fig. 3A). The results of a representative experiment are shown in Figure 3B. On average CD69+ cells accounted for 40±10% of JurkatαCEA-CIR-EGFP cells stimulated with CEA-positive cells. This result is similar to that observed after stimulation of JurkatαCEA-CIR-EGFP cells with plastic immobilized anti-CD3 mAb (Fig. 3B). In these conditions the peak expression of cell surface CD69 occurred between 12 and 24 h (data not shown). Stimulation of JurkatαCEA-CIR-EGFP and JurkatEGFP cells with plastic immobilized anti-CD3 mAb or stimulation of JurkatαCEA-CIR-EGFP cells with HeLaCEA cells resulted in a marked increase in EGFP reporter expression as compared to unstimulated cells (data not shown).
Figure 2

IL-2 production by JurkatEGFP and JurkatαCEA-CIR-EGFP cells stimulated either with plastic immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa or HeLaCEA) for 48 hours.

Figure 3

CIR-mediated activation of human T cells.

(A) Cell-surface expression of CEACAM5 (CEA) and NIP-modified molecules on HeLa, HeLaCEA and HeLa cells labeled with 2.5 µg/mL of the hapten (HeLaNIP). (B) FACS analysis of CD69 expression by JurkatEGFP, JurkatαCEA-CIR-EGFP and JurkatαNIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HeLaCEA or HeLaNIP) for 16 hours.

CIR-mediated activation of human T cells.

(A) Cell-surface expression of CEACAM5 (CEA) and NIP-modified molecules on HeLa, HeLaCEA and HeLa cells labeled with 2.5 µg/mL of the hapten (HeLaNIP). (B) FACS analysis of CD69 expression by JurkatEGFP, JurkatαCEA-CIR-EGFP and JurkatαNIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HeLaCEA or HeLaNIP) for 16 hours. We have demonstrated previously that an anti-NIP CIR is able to mediate specific recognition of its cognate antigen, either immobilized (NIP-BSA conjugates) or expressed on a cell surface, resulting in the production of IL-2 by transfected Jurkat T cells [16], [17]. The CIR comprises a human immunoglobulin signal peptide, the anti-NIP scFv antibody B1.8, fused to the transmembrane and cytoplasmic regions of the human TCRζ-chain [17]. In the current study, we found consistently that anti-NIP CIR-expressing Jurkat cells (JurkatαNIP-CIR) could be specifically triggered, after incubation with NIP-modified target HeLa cells (HeLaNIP), to express CD69 (Fig. 3B). The level of CD69 expression was similar than that observed in the same cell population in response to plastic-immobilized anti-CD3 mAb (Fig. 3B). Importantly, T cell activation remained strictly antigen-specific with NIP-negative HeLa or HeLaCEA cells unable to induce CD69 expression in JurkatαNIP-CIR cells (Fig. 3). JurkatEGFP cells or JurkatαNIP-CIR could not be stimulated by HeLa or HeLaCEA cells (Fig. 3). To further demonstrated the specificity of CIR-mediated activation, CIR-negative parental Jurkat cells or CIR-positive Jurkat cells (JurkatαCEA-CIR-EGFP or JurkatαNIP-CIR) were co cultured with a panel of human unmodified tumor cell lines (Fig. 4). Only JurkatαCEA-CIR-EGFP cells expressed CD69 after co culturing with CEA-positive MKN45 cells (Fig. 4). Parental Jurkat cells or anti-NIP CIR-expressing Jurkat cells (JurkatαNIP-CIR) could not be activated to express CD69 with any of the tumor cell lines tested (Fig. 4). Furthermore, the viability of JurkatEGFP, JurkatαCEA-CIR-EGFP and JurkatαNIP-CIR cells was not affected when co-cultured for 16 hours in the presence of different types of target cells (data not shown).
Figure 4

CIR-mediated activation of human T cells.

(A) Cell-surface expression of CEACAM5 (CEA) on HeLa, HT1080, MDA-MB-231 and MKN45 cells. (B) FACS analysis of CD69 expression by Jurkat, JurkatαCEA-CIR-EGFP and JurkatαNIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HT1080, MDA-MB-231 or MKN45) for 16 hours.

(A) Cell-surface expression of CEACAM5 (CEA) on HeLa, HT1080, MDA-MB-231 and MKN45 cells. (B) FACS analysis of CD69 expression by Jurkat, JurkatαCEA-CIR-EGFP and JurkatαNIP-CIR stimulated either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa, HT1080, MDA-MB-231 or MKN45) for 16 hours.

Antigen-specific activation of T cells expressing tumor-specific CIRs in the presence of competitor populations

We next studied the effect of competitor non-transduced Jurkat T cells on T cell activation mediated through the anti-CEA CIR. JurkatαCEA-CIR-EGFP cells were cultured on HeLaCEA monolayers in the presence of increasing amounts of CIR-negative competitor Jurkat cells, and the expression of CD69 was analyzed by flow cytometry (Fig. 5). Our results indicate that in all these conditions the presence of competitor cells did not affect the CIR-mediated induction of CD69 expression (Fig. 5). At effector-to-competitor ratios ranging from 100∶1 to 1∶100 the percentage of the EGFP+ cells that expressed CD69 was kept close to 40% regardless of the number of competitor cells.
Figure 5

Effect of competitor populations on CIR-mediated T cell activation.

CIR-positive JurkatαCEA-CIR-EGFP effector (E) cells were stimulated with CEA-positive target cells for 16 hours in the presence of increasing amounts of CIR-negative Jurkat competitor (C) cells. The expression of CD69 on E∶C ratios ranging from 100∶1 to 1∶100 was measured by FACS on pre-activation (left panels) and post-activation (right panels) mixtures.

Effect of competitor populations on CIR-mediated T cell activation.

CIR-positive JurkatαCEA-CIR-EGFP effector (E) cells were stimulated with CEA-positive target cells for 16 hours in the presence of increasing amounts of CIR-negative Jurkat competitor (C) cells. The expression of CD69 on E∶C ratios ranging from 100∶1 to 1∶100 was measured by FACS on pre-activation (left panels) and post-activation (right panels) mixtures.

Selection and enrichment of T cells expressing tumor-specific CIRs

To determine whether T cells expressing CIRs on their surfaces could serve as a platform for screening and isolating binders to tumor specific cell surface antigen, JurkatαCEA-CIR-EGFP cells and CIR-negative non-transduced Jurkat cells (Fig. 6) or CIR-positive transfected Jurkat cells (JurkatαNIP-CIR) (Fig. 7) were mixed at decreasing concentrations of the former, with a total number of 3×107 and incubated overnight with confluent monolayers of HeLaCEA cells, and the sensitivity of the isolation and enrichment process evaluated. Mixed Jurkat T cells were recovered from the tumor cell monolayer by EDTA treatment, ficoll purified, washed twice with medium and incubated with anti-CD69 PE mAb. At a mixing ratio 1∶1000 a single round of selection by direct FACS sorting of EGFP+CD69+ cells, resulted in a two-log enrichment of anti-CEA CIR expressing JurkatαCEA-CIR-EGFP cells, from the background CIR-negative Jurkat cell population (Fig. 6) or CIR-positive JurkatαNIP-CIR cells. The sorted JurkatαCEA-CIR-EGFP/1S population was propagated and submitted for an additional round of activation/selection on HeLaCEA cell monolayers. After staining with anti-CD69 PE mAb and FACS sorting nearly 100% of the cells expressed EGFP (JurkatαCEA-CIR-EGFP/2S). Overall, CIR-mediated activation of T cells combined with FACS sorting of CD69-expressing activated T cells resulted in a 103 fold-enrichment in a tandem two-step round of selection.
Figure 6

Selection of CIR-activated T cells.

JurkatαCEA-CIR-EGFP effector (E) cells and CIR-negative Jurkat competitor (C) cells at a E∶C mixing ratio 1∶1000 were stimulated with CEA-positive target cells for 16 hours and further sorted on the basis of EGFP and CD69 expression. After a period of cell expansion the activation/selection cycle was repeated.

Figure 7

Selection of CIR-activated T cells.

JurkatαCEA-CIR-EGFP effector (E) cells and CIR-positive JurkatαNIP-CIR competitor (C) cells at a E∶C mixing ratio 1∶1000 were stimulated with CEA-positive target cells for 16 hours and further sorted on the basis of EGFP and CD69 expression. After a period of cell expansion the activation/selection cycle was repeated.

Selection of CIR-activated T cells.

JurkatαCEA-CIR-EGFP effector (E) cells and CIR-negative Jurkat competitor (C) cells at a E∶C mixing ratio 1∶1000 were stimulated with CEA-positive target cells for 16 hours and further sorted on the basis of EGFP and CD69 expression. After a period of cell expansion the activation/selection cycle was repeated. JurkatαCEA-CIR-EGFP effector (E) cells and CIR-positive JurkatαNIP-CIR competitor (C) cells at a E∶C mixing ratio 1∶1000 were stimulated with CEA-positive target cells for 16 hours and further sorted on the basis of EGFP and CD69 expression. After a period of cell expansion the activation/selection cycle was repeated.

Functional and phenotypic characterization of selected T cells expressing tumor-specific CIRs

After the second round of activation/selection, the selected population (JurkatαCEA-CIR-EGFP/2S) was expanded and characterized phenotypic and functionally. JurkatαCEA-CIR-EGFP/2S cells showed higher levels of EGFP and cell surface FLAG-tagged anti-CEA CIRs (with MFI values enhanced ∼2-fold) than the initial JurkatαCEA-CIR-EGFP cells (Fig. 8A). JurkatαCEA-CIR-EGFP/2S cells could be activated to express CD69 or to produce IL-2, upon interaction with membrane-bound CEA (mCEA) or immobilized anti-CD3 mAb (Fig. 8B). Sequence analysis of antibody variable domains of 20 individual clones revealed no differences between the initial JurkatαCEA-CIR-EGFP cells and the selected Jurkat JurkatαCEA-CIR-EGFP/2S cells with the exception of punctual one-nucleotide changes, derived from the PCR amplification (data not shown).
Figure 8

Phenotypic and functional characterization of selected JurkatαCEA-CIR-EGFP cells.

(A) Comparative analysis of EGFP and cell surface CIR expression of the initial (JurkatαCEA-CIR-EGFP) and the selected (JurkatαCEA-CIR-EGFP/2S) cell population after two rounds of activation/selection on CEA-positive target cells. (B) Comparative analysis of CD69 expression by JurkatαCEA-CIR-EGFP and JurkatαCEA-CIR-EGFP/2S cell populations after stimulation either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa or HeLaCEA).

Phenotypic and functional characterization of selected JurkatαCEA-CIR-EGFP cells.

(A) Comparative analysis of EGFP and cell surface CIR expression of the initial (JurkatαCEA-CIR-EGFP) and the selected (JurkatαCEA-CIR-EGFP/2S) cell population after two rounds of activation/selection on CEA-positive target cells. (B) Comparative analysis of CD69 expression by JurkatαCEA-CIR-EGFP and JurkatαCEA-CIR-EGFP/2S cell populations after stimulation either with immobilized anti-CD3 mAb or target cells (E∶T = 1∶1; HeLa or HeLaCEA).

Discussion

In this study, we describe the design and use of a mammalian display platform to select scFv antibodies on complex mixtures of antigens expressed on cell surfaces. A limiting step in the selection by cell panning of phage antibodies is the high background binding of non-specific phages [4]. To overcome this limitation, we designed a positive selection method based on the display of scFv antibodies on the surface of T lymphocytes, in the context of activating molecules. The use of a chimeric scFv-TCRζ receptor as a display fusion partner may result in gene expression in successful cases of interaction. In fact, we demonstrated that upon encountering specific antigen on tumor cell surface, human T cells harboring anti-tumor scFv-TCRζ receptors are able to undergo specific activation, including up-regulation of the early T-cell activation marker CD69. Combining CIR-mediated activation with FACS sorting of CD69+ T cells it is possible to detect and purify tumor-specific T cells with an enrichment factor of at least 103-fold after two rounds. However, the strength of this lymphocyte display platform does not rely only on the enrichment factor, but in rescuing functional scFv antibodies capable of forming a functional immune synapse. Recent studies have established that multidomain constructs comprising the signaling region of CD28 in series with the signaling domain of the TCRζ chain (dual scFv-CD28-TCRζ chimeric receptor) mediated enhanced cytokine production, and preserved cell viability [18]. Dual CIR with optimized spacer sequences, to provide accessibility and extended orientation, are ideal for surface display of antibody libraries in T lymphocytes. In addition to the advantages of all mammalian expression libraries this novel positive selection T cell–surface display system avoids the use of elution procedures so that high affinity antibodies cannot get lost during selection. Furthermore, the interface between the tumor cell and the CIR-expressing T cell might allow selecting human antibodies towards their cognate antigens when present in their natural setup. Antibodies against transmembrane cell surface proteins that are difficult to purify in a native conformation and against epitopes that are not visible with the current display technologies might benefit from this platform. The use of lentiviral-based vectors allows to precisely dose infection rates, ensuring expression of no more than one antibody per cell. However, one major drawback of antibody screening in mammalian cells is the relative small number of cells that can be handled at time. Thus, whereas phage display routinely allows for the screening of 1012 clones in a single panning round [2], the throughput of a mammalian screening procedure in an one-antibody-per-cell format is in the range of 106 to 107 clones that can be analyzed concomitantly [8]. This “repertoire diversity” limitation might be ameliorated thanks to its better fit to specific scenarios, for example in vivo selections. Systemically administered bacteriophages have to survive destruction by immune effector mechanisms [19]―which counts for a fast depletion in vivo―, avoid non-specific adhesion to vessel walls [20] and avoid sequestration by organ systems such as the Kuppfer cells [21], thus, diminishing the actual repertoire size at the “point of selection” (whether a solid tumor, a disease model, organ-specific vasculature, etc). In addition phage particles represent an inert carrier, with void or limited extravasation ability, which allows the recovery of displayed peptides homing preferentially to the target tissue due to their binding to tissue-specific vascular receptors [22], but poses further restrictions for the in vivo selections beyond the luminal surface of the vasculature. The present platform overcomes these limitations: unlike viral particles, immune effector cells can migrate actively and efficiently through microvascular walls, and penetrating the core of solid tumors. In this context, a repertoire of systemically administered CIR-display T lymphocytes can move through the circulatory and lymphatic systems and extravasate actively towards the site of tissue damage. We could select tumor-specific T cells as consequence of a process of extravasation, mediated by cellular adhesion molecules, and of a process of retention and activation, mediated by the CIR.

Materials and Methods

Cells and culture conditions

293T cells (human embryo kidney epithelia; CRL-11268), HeLa cells (human cervix carcinoma; CCL-2), HT-1080 cells (human fibrosarcoma; CCL-121), MKN45 cells (human stomach adenocarcinoma; JCRB-0254), and MDA-MB231 cells (human breast adenocarcinoma; HTB-26) were grown in DMEM supplemented with 10% (vol/vol) heat-inactivated FCS, (Invitrogen Life Technologies, Gaithersburg, MD, USA), referred as to DMEM complete medium (DCM). Jurkat clone E6-1 (TIB-152) cells were maintained in RPMI-1640 (Invitrogen Life Technologies) supplemented with heat inactivated 10% FCS, referred as to RPMI complete medium (RCM). All of these cell lines were obtained from the American Type Culture Collection (Rockville, MD, USA). HeLaCEA cells [23] were grown in RCM supplemented with 750 µg/ml G418 (Invitrogen Life Technologies). All cell lines were routinely screened for the absence of mycoplasm contamination by PCR using the Mycoplasm Plus TM Primer Set (Stratagene, Cedar Creek, TX, USA).

Hapten modification of target cells

HeLa cells were extensively washed in PBS, counted, and adjusted to a concentration of 107/mL. A fresh 50 mg/ml solution of NIP-CAP-Osu (succinimide ester of 3-nitro-4-hydroxy-5-iodophenylacetic acid spaced with caproic acid) (Sigma Biosciences, St. Louis MO, USA) in dry dimethylformamide was added to the cell suspension to give a final concentration of 2.5 µg/mL. The cells were incubated for 1 hour at 37°C and then washed three times with 15 mL of cold PBS supplemented with 10% FCS.

Antibodies and reagents

The monoclonal antibodies (mAbs) used included: M2 (anti-FLAG, Sigma Biosciences); 9E10 (anti-c-myc, Abcam, Cambridge, UK), C6G9 (anti-human CD66e/CEA, Sigma Biosciences); BD1690 (anti-HIV p24, Abcam); SPVT3b (anti-human CD3, Zymed, San Francisco, CA, USA) and BG5 (biotinylated anti-human IL-2, Endogen, Woburn, MA, USA). For direct staining, the PE-conjugated FN50 mAb (anti-human CD69, BD Biosciences, San José, CA, USA) was used. The polyclonal antibodies used included: rabbit anti-human IL2 (Endogen), horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (Fc specific; Sigma Biosciences); PE-conjugated goat F(ab')2 fragment anti-mouse IgG (Fcγ Fragment Specific, Jackson Immuno Research, Newmarket, UK); and biotinylated goat anti-HIV p24 (Abcam). Streptavidin-HRP polymer, human IL-2, and human CEA were from Sigma Biosciences and HIV-p24 core protein was from Jena Bioscience GmbH (Jena, Germany).

Vector construction and preparation of lentiviral vector stocks

The HIV-derived four-plasmid system was kindly provided by D. Trono (Department of Microbiology and Molecular Medicine, University of Geneva, Switzerland). The transfer vector pRRL-IRES-EGFP contains a cytomegalovirus (CMV) promoter that drives an enhanced-green fluorescent protein (EGFP) expression cassette [24]. To construct the vector pRRL-FLAGαCEA-TCRζ-IRES-EGFP, the plasmid pVAC.αNIP-TCRζ was digested with NotI and XbaI to remove a PstI site and religated to form pVAC.αNIP-TCRζ-Not/Xba in which an oligonucleotide carrying the FLAG sequence (Table 1, oligonucleotides 1 and 2) was introduced between XmaI and PstI to generate the plasmid pVAC.FLAGαNIP-TCRζ-Not/Xba. The coding sequence was restored by inserting the HindIII/BstEII fragment from plasmid pVAC.FLAGαNIP-TCRζ-Not/Xba into the HindIII/BstEII digested backbone of plasmid pVAC.αNIP.TCRζ rendering the plasmid pVAC.FLAGαNIP-TCRζ. The MFE-23 scFv gene (αCEA) was PCR amplified from pVAC.αCEA-TCRζ with primers 3 and 4 (Table 1) and the sequence was verified using primers 5 and 6. The NheI/NotI-cleaved PCR fragment was ligated into the NheI/NotI digested backbone of plasmid pVAC.FLAGαNIP-TCRζ to obtain the plasmid pVAC.FLAGαCEA-TCRζ. To aid cloning, a NotI site was removed from pRRL-IRES-EGFP by digestion using NotI, blunting and religation (pRRL-IRES-EGFPNotKO). The FLAGαCEA-TCRζ coding sequence was PCR amplified from plasmid pVAC.FLAGαCEA-TCRζ with primers 7 and 8 (Table 1), digested with BglII and SalI and subcloned into the BamHI/XhoI-digested backbone of the plasmid pRRL-IRES-EGFPNotKO, obtaining the vector pRRL.FLAGαCEA-TCRζ-IRES-EGFP (called from now pRRL-CIR-IRES-EGFP). Lentiviral particles (ACEA-CIR-EGFP and EGFP) were produced by cotransfection of 293T cells by calcium phosphate precipitation as described previously [24].
Table 1

Oligonucleotide sequencesa.

NameSequence (5′-3′)
1 CCGGGGGCCCACTCCGACTACAAAGACGATGACGACAAGGCTAGCCAGGTGCAGCTGCA
2 GCTGCACCTGGCTAGCCTTGTCGTCATCGTCTTTGTAGTCGGAGTGGGCCC
3 GCTAGCCAGGTGCAGCTGCAGCAGTCT
4 CTCTGTAGCGGCCGCCCGTTT
5 CAGGAAACAGCTATGAC
6 TAAAACGACGGCCAG
7 ACAGATCTATGGACTGGACCTGGAGGGT
8 AAATGTCGACTTATTAGCGACGAGGGGGCAG

Sequences of the various oligonucleotides applied for the construction of the vectors, and subsequent verification of vector sequences.

Sequences of the various oligonucleotides applied for the construction of the vectors, and subsequent verification of vector sequences.

Determination of vector titers

An ELISA directed against the p24 capsid protein was performed for tittering the physical particles (PP). PP number was in the range of 1×107–1×108 PP/ml in both lentiviral vector preparations (ACEA-CIR-EGFP and EGFP). Biological titration was performed as previously described [16]. The infective particles (transducing units, TU/ml) were 4×107 TU/ml for the lentivirus ACEA-CIR-EGFP and 2×107 TU/ml for the lentivirus EGFP.

Genetic modification of human T cells

Exponentially growing Jurkat cells (1×105) were incubated overnight in 96-well plates with lentiviral stocksCEA-CIR-EGFP or EGFP) at different multiplicities of infection (MOI), ranging from 0.25 to 10 in a final volume of 200 ml of their appropriate medium. The cells were washed and further cultured for 48 h. Jurkat cells were transfected with the expression vector pCEP4/αNIPCD3ζ [16], using Superfect (Qiagen GmbH, Hilden, Germany) and selected in RCM with 400 µg/ml hygromycin B (Invitrogen Life Technologies). Cells were analyzed for expression of EGFP and CIRCEA or αNIP) by FACS.

Flow cytometry

For phenotypic analysis cells were incubated with appropriate dilutions of PE-conjugated mAbs or PE-conjugated isotype negative control for 30 min at 4°C. The expression of CEACAM5 (CEA) on HeLa, HeLaCEA, HT1080, MDA-MB-231 and MKN45 cells was studied as previously described [25]. Cell-surface expression of amino-terminal FLAG-tagged CIRCEA-CIR) was evaluated after incubation of cells with anti-FLAG mAb followed by incubation with PE-conjugated goat F(ab')2 anti-mouse IgG. Cell-surface expression of α-NIP-CIR was evaluated using a FITC-conjugated goat anti-serum to mouse λ-chain (Southern Biotechnology Associates, Birmingham, AL; USA). The relative amount of NIP bound to hapten-modified HeLa cells (HeLaNIP) was estimated by indirect immunofluorescence using saturating amounts of a purified B1.8 scFv antibody fragment (LAV-17), anti-c-myc mAb and a PE-conjugated goat F(ab')2 fragment anti-mouse IgG. All samples were analyzed using an EPICS XL flow cytometer (Beckman Coulter).

T-cell activation and selection

Non-transduced Jurkat, JurkatαCEA-CIR-EGFP or JurkatEGFP cells (105/well) were incubated with plastic immobilized CEA (1 µg/well) or anti-CD3 mAb (1 µg/well) in round-bottom 96-well plates (BD Biosciences). For small-scale co-culture assays, CIR-positive (JurkatαCEA-CIR-EGFP or JurkatαNIP-CIR), CIR-negative (Jurkat or JurkatEGFP), or mixtures of both effector T cells (5×104/well) were incubated with different types of target cells, at various effector to target ratios. The plates were incubated at 37°C in 5% CO2. After 16 h or 40 h, cells were collected and the surface expression of CD69 examined by FACS analysis. Supernatants were harvested and assayed for IL-2 activity by ELISA. For medium-scale co-cultures, CIR-positive (JurkatαCEA-CIR-EGFP or JurkatαNIP-CIR), CIR-negative (Jurkat), or mixtures of both effector (JurkatαCEA-CIR-EGFP:Jurkat or JurkatαCEA-CIR-EGFP:JurkatαNIP-CIR), T cells (3×107) were incubated on HeLa or HeLaCEA monolayers at a 1∶1 ratio. After 16 h, cells were harvested with EDTA (Sigma Biosciences), washed, and then Jurkat cells isolated by density-gradient centrifugation. Viable cell counts were determined by trypan blue exclusion. The resultant cells were stained with PE-conjugated anti-CD69 mAb and EGFP+CD69+ populations further isolated by FACS using a FACSVantage cell sorter (BD Biosciences)

Molecular characterization

Total RNA was extracted from unselected and selected JurkatαCEA-CIR-EGFP cells with the RNeasy Plus Mini Kit (Qiagen). cDNA synthesis was performed with cDNA Synthesis Kit for RT-PCR (AMV) (Roche Diagnostics GmbH, Mannheim, Germany). The anti-CEA scFv was PCR amplified with primers 4 and 7, and sequenced with primers 5 and 6 (Table 1).
  25 in total

1.  Retroviral vectors displaying functional antibody fragments.

Authors:  S J Russell; R E Hawkins; G Winter
Journal:  Nucleic Acids Res       Date:  1993-03-11       Impact factor: 16.971

2.  Pharmacologic suppression of target cell recognition by engineered T cells expressing chimeric T-cell receptors.

Authors:  L Alvarez-Vallina; R Yañez; B Blanco; M Gil; S J Russell
Journal:  Cancer Gene Ther       Date:  2000-04       Impact factor: 5.987

3.  Autocrine costimulation: tumor-specific CD28-mediated costimulation of T cells by in situ production of a bifunctional B7-anti-CEA diabody fusion protein.

Authors:  Belén Blanco; Philipp Holliger; Luis Alvarez-Vallina
Journal:  Cancer Gene Ther       Date:  2002-03       Impact factor: 5.987

4.  Expression of immunoglobulin-T-cell receptor chimeric molecules as functional receptors with antibody-type specificity.

Authors:  G Gross; T Waks; Z Eshhar
Journal:  Proc Natl Acad Sci U S A       Date:  1989-12       Impact factor: 11.205

5.  Isolation of human monoclonal antibodies by mammalian cell display.

Authors:  Roger R Beerli; Monika Bauer; Regula B Buser; Myriam Gwerder; Simone Muntwiler; Patrik Maurer; Philippe Saudan; Martin F Bachmann
Journal:  Proc Natl Acad Sci U S A       Date:  2008-09-23       Impact factor: 11.205

Review 6.  Genetic approaches for antigen-selective cell therapy.

Authors:  L Alvarez-Vallina
Journal:  Curr Gene Ther       Date:  2001-11       Impact factor: 4.391

Review 7.  Antibodies and gene therapy: teaching old 'magic bullets' new tricks.

Authors:  Laura Sanz; Belén Blanco; Luis Alvarez-Vallina
Journal:  Trends Immunol       Date:  2004-02       Impact factor: 16.687

8.  Expression of carcinoembryonic antigen and its predicted immunoglobulin-like domains in HeLa cells for epitope analysis.

Authors:  L J Hefta; F S Chen; M Ronk; S L Sauter; V Sarin; S Oikawa; H Nakazato; S Hefta; J E Shively
Journal:  Cancer Res       Date:  1992-10-15       Impact factor: 12.701

9.  Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface.

Authors:  G P Smith
Journal:  Science       Date:  1985-06-14       Impact factor: 47.728

10.  Epitope selection from an uncensored peptide library displayed on avian leukosis virus.

Authors:  Pranay D Khare; Ana G Rosales; Kent R Bailey; Stephen J Russell; Mark J Federspiel
Journal:  Virology       Date:  2003-10-25       Impact factor: 3.616

View more
  7 in total

Review 1.  Selection strategies for anticancer antibody discovery: searching off the beaten path.

Authors:  David Sánchez-Martín; Morten Dræby Sørensen; Simon Lykkemark; Laura Sanz; Peter Kristensen; Erkki Ruoslahti; Luis Álvarez-Vallina
Journal:  Trends Biotechnol       Date:  2015-03-26       Impact factor: 19.536

Review 2.  Chimeric antigen receptor-redirected T cells return to the bench.

Authors:  Claudia Geldres; Barbara Savoldo; Gianpietro Dotti
Journal:  Semin Immunol       Date:  2016-01-12       Impact factor: 11.130

3.  Engineering T cell function using chimeric antigen receptors identified using a DNA library approach.

Authors:  Connie P M Duong; Jennifer A Westwood; Carmen S M Yong; Amanda Murphy; Christel Devaud; Liza B John; Phillip K Darcy; Michael H Kershaw
Journal:  PLoS One       Date:  2013-05-07       Impact factor: 3.240

4.  Generation and characterization of monospecific and bispecific hexavalent trimerbodies.

Authors:  Ana Blanco-Toribio; Noelia Sainz-Pastor; Ana Álvarez-Cienfuegos; Nekane Merino; Ángel M Cuesta; David Sánchez-Martín; Jaume Bonet; Patricia Santos-Valle; Laura Sanz; Baldo Oliva; Francisco J Blanco; Luis Álvarez-Vallina
Journal:  MAbs       Date:  2012-12-05       Impact factor: 5.857

5.  Functional comparison of single-chain and two-chain anti-CD3-based bispecific antibodies in gene immunotherapy applications.

Authors:  Marta Compte; Ana Alvarez-Cienfuegos; Natalia Nuñez-Prado; Noelia Sainz-Pastor; Ana Blanco-Toribio; Nuria Pescador; Laura Sanz; Luis Alvarez-Vallina
Journal:  Oncoimmunology       Date:  2014-05-23       Impact factor: 8.110

6.  CARbodies: Human Antibodies Against Cell Surface Tumor Antigens Selected From Repertoires Displayed on T Cell Chimeric Antigen Receptors.

Authors:  Vanesa Alonso-Camino; David Sánchez-Martín; Marta Compte; Natalia Nuñez-Prado; Rosa M Diaz; Richard Vile; Luis Alvarez-Vallina
Journal:  Mol Ther Nucleic Acids       Date:  2013-05-21       Impact factor: 10.183

7.  A cell-based phenotypic library selection and screening approach for the de novo discovery of novel functional chimeric antigen receptors.

Authors:  Julie K Fierle; Johan Abram-Saliba; Vasileios Atsaves; Matteo Brioschi; Mariastella de Tiani; Patrick Reichenbach; Melita Irving; George Coukos; Steven M Dunn
Journal:  Sci Rep       Date:  2022-01-21       Impact factor: 4.379

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.