Literature DB >> 19727445

The dif/Xer recombination systems in proteobacteria.

Christophe Carnoy1, Claude-Alain Roten.   

Abstract

In E. coli, 10 to 15% of growing bacteria produce dimeric chromosomes during DNA replication. These dimers are resolved by XerC and XerD, two tyrosine recombinases that target the 28-nucleotide motif (dif) associated with the chromosome's replication terminus. In streptococci and lactococci, an alternative system is composed of a unique, Xer-like recombinase (XerS) genetically linked to a dif-like motif (dif(SL)) located at the replication terminus. Preliminary observations have suggested that the dif/Xer system is commonly found in bacteria with circular chromosomes but that assumption has not been confirmed in an exhaustive analysis. The aim of the present study was to extensively characterize the dif/Xer system in the proteobacteria, since this taxon accounts for the majority of genomes sequenced to date. To that end, we analyzed 234 chromosomes from 156 proteobacterial species and showed that most species (87.8%) harbor XerC and XerD-like recombinases and a dif-related sequence which (i) is located in non-coding sequences, (ii) is close to the replication terminus (as defined by the cumulative GC skew) (iii) has a palindromic structure, (iv) is encoded by a low G+C content and (v) contains a highly conserved XerD binding site. However, not all proteobacteria display this dif/XerCD system. Indeed, a sub-group of pathogenic epsilon-proteobacteria (including Helicobacter sp and Campylobacter sp) harbors a different recombination system, composed of a single recombinase (XerH) which is phylogenetically distinct from the other Xer recombinases and a motif (dif(H)) sharing homologies with dif(SL). Furthermore, no homologs to dif or Xer recombinases could be detected in small endosymbiont genomes or in certain bacteria with larger chromosomes like the Legionellales. This raises the question of the presence of other chromosomal deconcatenation systems in these species. Our study highlights the complexity of dif/Xer recombinase systems in proteobacteria and paves the way for systematic detection of these components in prokaryotes.

Entities:  

Mesh:

Substances:

Year:  2009        PMID: 19727445      PMCID: PMC2731167          DOI: 10.1371/journal.pone.0006531

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

In bacteria, DNA replication of circular chromosomes can generate, by homologous recombination, concatenated chromosomes that affect cell viability. In Escherichia coli, resolution of chromosomal concatenates requires a site-specific recombination system involving two tyrosine recombinases (XerC and XerD) associated with FtsK, the DNA translocase involved in bacterial division [1], [2], [3]. Chromosomal deconcatenation occurs at a specific chromosome site referred to as dif, for the “deletion-induced filamentation”, a phenotype observed in E. coli strains which are either deficient in XerD or XerC recombinases or lack the dif sequence [4], [5]. The 28-nt dif locus is a palindromic motif composed of two inverted repeats (each of which is specifically targeted by one of the two Xer recombinases) separated by a central hexanucleotide. The E. coli dif sequence is located opposite the origin of chromosomal replication, i.e. near the chromosome terminus at the junction of oppositely polarized DNA sequence elements in a 30 kb-region called the dif activity zone (DAZ) [6], [7], [8], [9]. The Xer recombination system was originally described for E. coli plasmids [10], [11] but is not restricted to this bacterial species, since homologous systems have been functionally characterized in Bacillus subtilis, Haemophilus influenzae, Xanthomonas campestris, Caulobacter crescentus and Vibrio cholerae [12], [13], [14], [15], [16]. Xer-related recombinases have also been detected by sequence homology or DNA hybridization in many bacterial taxa and some archaeal species [17], [18], [19], [20]. Homologs to E. coli dif sequences have been found in other proteobacteria, firmicutes and actinobacteria [15], [21], [22], [23], [16], suggesting the universality of the dif/Xer system in the bacterial kingdom. Recently, an unconventional single Xer-like recombinase targeting an atypical dif sequence was described in streptococci and lactococci [23]. In addition to its role in chromosome dimer resolution, the dif locus may be involved in the integration/excision of exogenous DNA. For instance, the filamentous phages CTXΦ and VGJΦ in Vibrio cholerae, f237 in V. parahaemoliticus, CUS-1 in E. coli 018:K1:H7, YpfΦ in Yersinia pestis and Cf16-v1 and ΦLf in Xanthomonas campestris all integrate into the host chromosome at the dif site [24], [25], [26], [27], [28], [29], [30]. The mechanism of prophage genome integration has been described in detail in V. cholerae CTXΦ, the filamentous phage containing the cholera toxin-encoding gene [31], [32]. Recently, Val et al. showed that after appropriate folding, CTXΦ's single-stranded phage DNA forms a dif-like structure that irreversibly recombines with the bacterial dif by using host XerC and XerD recombinases [32]. This clearly demonstrates that dif is a preferential integration site for single-stranded filamentous phages displaying dif-like motifs on their genome. Other large genetic DNA elements also target the dif sequence, as evidenced by integration of the 57-kb gonococcal genetic island (GGI, containing a type IV secretion system) into the Neisseria chromosome [33], [34]. Taken as a whole, these studies strongly suggest that the dif sequence is a preferential site for exogenous DNA integration and thus contributes to genome evolution in general and to virulence gene acquisition in particular. Moreover, dif's natural ability to integrate exogenous DNA has been used to deliver genes of biotechnological interest to the bacterial chromosome [35], [36]. Despite the publication of many bacterial genome sequences (440 had been sequenced as of January 1st, 2007) with over half of these from proteobacteria, no exhaustive analysis of the dif/Xer system has yet been undertaken. As the dif sites do not appear in GenBank's genome annotation, we developed a strategy for systematically identifying dif-related sequences in proteobacteria chromosomes by combining similarity search tools (BLAST and YASS) with genometric methods (cumulative GC-skew analyses). In contrast to initial assumptions in the literature, we found that not all proteobacterial circular chromosomes feature a dif/Xer system and that a ε-proteobacteria sub-group harbors an atypical dif/Xer system, indicating heterogeneity of this recombination system in proteobacteria. This report represents the first comprehensive analysis of the dif motifs and of their associated recombinases and should facilitate the identification of related recombination systems in prokaryotes.

Results

The dif-related sequences are highly conserved among the proteobacteria

To detect dif homologs in proteobacterial chromosomes, we developed an in silico approach based on (i) homology of the candidate with the experimentally characterized proteobacterial dif sequences in E. coli, C. crescentus, X. campestris, V. cholerae and H. influenzae or with a related sequence found in a close taxon, (ii) location of the putative sequence near the chromosome terminus, as defined by the cumulative GC skew analysis, (iii) presence in different strains of the same species, and (iv) presence of a single copy of the dif candidate within the chromosome. Using this strategy, 234 chromosomes from 156 proteobacterial species were analyzed (Table 1 and Table S1). dif homologs were found in 87.2% of the chromosomes (204 out of 234) and in 87.8% (137 out of 156) of the species. A dif-related sequence was detected in all β and δ-species and in 97.7% (44 out of 45) and 82.8% (53 out of 64) of the α and γ-species, respectively. Surprisingly, only 1 out of 8 ε–proteobacterial species (12.5%) harbored a dif-related sequence. Lastly, one unclassified proteobacterium (Magnetococcus sp.) also displayed a dif homolog.
Table 1

Genome and dif features of a representative panel of proteobacteria.

Genome featuresputative dif features
Speciessize (bp)G+C contentMaximum CGC skewNucleotide sequence (1) position on genomeG+C contentdistance from GCG skewintergenic location (2)
α-proteobacteria
Caulobacterales
  Caulobacter crescentus CB1540169470.6721930040 AAGATCGACTTTGT AATTTATGTAAAGT 19463800.25014159yes
Rhizobiales
  Agrobacterium tumefaciens str. C58 chr. circular28414900.5931485983 TAATCGCATAAGATATATTATGGAACTT 14788150.2507168yes
  Bartonella quintana str. Toulouse15813840.387724981 AAATTCCATAATATATATTATGCGATAA 7209060.1794075yes
  Bradyrhizobium japonicum USDA 11091058280.6404893406 GATTCGCATAAGGT ATATTATGGAATAT 49961720.286102766yes
  Brucella melitensis 16M chr. I21171360.571955452 TAATCGCATAAGAT AGATTATGGAACTG 9547400.321712yes
  Brucella melitensis 16M chr. II11777850.573757557 AAATCAGATAATA TGTATTATGGAACAT 7581830.214626yes
  Mesorhizobium loti MAFF30309970360710.627203543 AAGTCGCATAAGAT AGATTATGGAACTT 2996190.32196076yes
Rhodobacterales
  Rhodobacter sphaeroides 2.4.1 chr. 131885990.6901435088 GAGTCGGATAATCTGTATTATGTATTCT 14368430.3211755yes
  Rhodobacter sphaeroides 2.4.1 chr. 29430160.690399979 TTATCTGATAAGC AAGATTATGTAATCA 3715750.25028404yes
Rhodospirillales
  Magnetospirillum magneticum AMB-149671480.6502616185 CGTCGCCATAATAT ACATTATGCGACAA 26103390.3935846yes
Rickettsiales
  Ehrlichia ruminantium str. Welgevonden15163550.274766761 ATATTACATAATGT ATATTATGGAAAAT 7479820.14318779yes
  Rickettsia prowazekii str. Madrid E11115230.290628915 TTGTTCTATAATA TGTATTATGGAAAAT 5961050.17932810yes
Sphingomonadales
  Novosphingobium aromaticivorans DSM 1244435615840.6522030402 AGGATTGATAATAA TCATTATGTAAATA 20481720.17917770yes
β-proteobacteria
Burkholderiales
  Bordetella pertussis Tohama I40861890.6772227724 AATTCGCATAATGT ATATTATGTAAAGT 22290690.2141345yes
  Burkholderia mallei ATCC 23344 chr. 135101480.6811086094 AATGTCGATAATTGATATTATGTCAAAT 10813090.2144785hyp. prot
  Burkholderia mallei ATCC 23344 chr. 223253790.6891077185 AATGTCGATAATTTGCGTTATGTCAAAT 10751350.2862050yes
  Ralstonia solanacearum GMI100037164130.6702009173 CCATCGCATAATTT ATCTTATGTTAAAT 20312190.25022046yes
  Rhodoferax ferrireducens DSM 1523647123370.5982485317 ACTTGATACGATGT ATATTATGTTAAGT 24725500.25012767yes
Hydrogenophilales
  Thiobacillus denitrificans 29098090.6601440104 ACTTCGCATAATGT ATATTATGTTAAAT 14307830.2149321yes
Methylophilales
  Methylobacillus flagellatus KT29715170.5571573478 ACTTCGCATAATGT ATATTATGTAAAAT 15646530.2148825yes
Neisseriales
  Neisseria meningitidis MC5822723510.5151231577 AGTTCGCATAATGT ATATTATGTTAAAT 12293490.2142228hyp. prot
Nitrosomonadales
  Nitrosomonas europaea ATCC 1971828120940.507964528 ATTTCGTATAATGT ATATTATGTTAAAT 9742190.1439691yes
Rhodocyclales
  Dechloromonas aromatica RCB45011040.5922186143 AACGCGCATAATTTGCATTATGTTAAAT 21925080.2866365yes
δ-proteobacteria
Bdellovibrionales
  Bdellovibrio bacteriovorus HD10037829500.5061940732 TCTTCTGATAAGTT ATATTATGTAACGG 19468580.2866126yes
Desulfobacterales
  Desulfotalea psychrophila LSv5435233830.4682260306 TAAGGAGATAAAT TGATTTATGAAAACG 23382410.25077935yes
Desulfovibrionales
  Desulfovibrio vulgaris subsp. Vulgaris str. Hildenborough35708580.6311735879 ATGTCCCATAATGT AAATTATGTTAACT 17542770.25018398yes
Desulfuromonadales
  Geobacter sulfurreducens PCA38141390.6091865942 ACGTCCCATAAGATATATTATGTAAAGT 18918800.28625938yes
Myxococcales
  Anaeromyxobacter dehalogenans 2CP-C50134790.7491906268 ACGTCCGATAATATGGATTATGGTAACT 19064770.357209yes
  Myxococcus xanthus DK 162291397630.6884547166 AGGTCCGATAACATGCGTTATGTAAACT 44896970.39357469yes
Syntrophobacterales
  Syntrophus aciditrophicus SB31793000.5141665473 TTGTCCTATAAGATATATTATGTAAACC 16658610.250388yes
ε-proteobacteria
Campylobacterales
  Sulfurimonas denitrificans DSM 1251 (3) 22015610,341135161 TTTCAATAGAATTT ACATTATGTTAACC 11222640.17512897yes
γ-proteobacteria
Aeromonadales
  Aeromonas hydrophila ATCC796647444480.6152494705 ACCGCGCATAATGT ATATTATGTTAAAT 25149360.28620231yes
Alteromonadales
  Idiomarina loihiensis L2TR28393180.4701411650 (4) ATTGCGTATAATGT ATATTATGTTAAAT 13876230.17924027yes
  Shewanella oneidensis MR-149697950.4592490130 ACTGCGCACAATGT ATATTATGTTAAAT 24769280.28613202yes
Chromatiales
  Nitrosococcus oceani ATCC 1970734816910.5031849931 TGTTCGCATAATA CATATTATGTTAAAT 18504100.214479yes
Enterobacteriales
  Erwinia carotovora subsp. atroseptica SCRI104350640190.5092552458 GGTTCGCATAATGT ATATTATGTTAAAT 25321330.25020325yes
  Escherichia coli K1246396750.5071549688 GGTGCGCATAATGT ATATTATGTTAAAT 15887880.28639100yes
  Sodalis glossinidius str. ‘morsitans’41711460.5462461688 AGTACGCATAATGT AGATTATGTTAAAT 24711480.2509460yes
  Yersinia pestis CO9246537280.4762562641 GGTGCGCATAATGT ATATTATGTTAAAT 25629190.286278yes
Methylococcales
  Methylococcus capsulatus str. Bath33045530.6351531625 TATGCGCATAATGT ATATTATGTTAAAT 14925250.21439100yes
Oceanospirillales
  Hahella chejuensis KCTC 239672152670.5383439027 AGTGCGCATAATATATATTATGTTAAAT 34370610.2141966yes
Pasteurellales
  Haemophilus influenzae Rd KW2018300230.3811474989 ATTTCGCATAATAT AAATTATGTTAAAT 14739750.1431014yes
Pseudomonadales
  Acinetobacter sp. ADP135986210.4041847121 GATTCGTATAATGT ATATTATGTTAAAT 18487330.1791612yes
  Pseudomonas aeruginosa PAO162644030.6652428120 GATTCGCATAATGT ATATTATGTTAAAT 24430820.21414962yes
Thiotrichales
  Francisella tularensis subsp. tularensis Schu 418928190.322950050 CATTCGTATAATATATATTATGTTAAAT 9946890.14344639yes
Vibrionales
  Vibrio cholerae O1 biovar eltor str. N16961 chr. I29611160.4761564264 AGTGCGTATTATGT ATGTTATGTTAAAT 15641180.250146yes
  Vibrio cholerae O1 biovar eltor str. N16961 chr. II10723110.469512448 AATGCGCATTACG TGCGTTATGTTAAAT 5079960.3574452yes
Xanthomonadales
  Xanthomonas campestris pv. campestris str. ATCC 3391350761720.6502442019 TCCTGACATAATAT ACATTATGCGAAAT 24417620.286257yes

The central nucleotide in bold defines the position of the dif sequence on the chromosome. The nucleotides involved in the palindrome are underlined.

hyp.prot.  =  dif inserted into a hypothetical protein-encoding gene.

Sulfurimonas denitrificans strain DSM 1251  = Thiomicrospira denitrificans ATCC 33889.

maximum of the GC skew.

The central nucleotide in bold defines the position of the dif sequence on the chromosome. The nucleotides involved in the palindrome are underlined. hyp.prot.  =  dif inserted into a hypothetical protein-encoding gene. Sulfurimonas denitrificans strain DSM 1251  = Thiomicrospira denitrificans ATCC 33889. maximum of the GC skew. To avoid redundancy, the first-published chromosome sequence in a species was considered to be representative. Thus, of the 204 dif sequences that we characterized, 161 were considered to be representative of the different proteobacterial taxa and were therefore used to define a consensus sequence (Figure 1 and Table S2). The two undecanucleotides (11-mers) corresponding to the XerC and XerD binding sites were designated in this study as dif and dif , respectively, whereas the central hexanucleotide between the two Xer binding sites was named as dif (Figure 1A). Analysis of the consensus revealed that the dif site is better conserved than the dif site and that within both dif boxes, the most conserved region is located in the inner part, near the central region. Regarding dif , the adenine residue at position 25 of the 28-nt dif sequence is highly conserved, whereas the nucleotides at positions 23 and 24 are more variable (Figure 1A). Within the less conserved nucleotides in dif , the residue at position 13 (i.e. the second in the hexanucleotide) is the most variable, compared with the other five. Furthermore, the degree of variability upstream and downstream of the 28-mer consensus sequence is high, indicating that the dif-related sequences are located in different genetic environments (Figure 1A).
Figure 1

Nucleotide variability within dif-related sequences.

(A) Consensus sequence and dif nucleotide variability for 161 dif-related sequences from 137 proteobacterial species. Nucleotide sequence characters in bold represent the dif sequence (28-mer). If the nucleotide frequency represents more than 50%, it is written in upper case letters; if not, the nucleotide is written in lower case letters. The nucleotide variability at each position in the 28-mer was defined as 1–f, where f is the frequency of the most frequent nucleotide. Nucleotide frequencies at each position are given in Table S2. Black bars represent dif XerC and dif XerD nucleotides, whereas grey bars correspond to the the dif cent nucleotides. White bars represent nucleotides outside dif. (B) Degree of variability in the dif sequence in 21 multi-strain species and in 19 multi-chromosome species. The degree of variability was calculated for each nucleotide position, as described in the Methods section.

Nucleotide variability within dif-related sequences.

(A) Consensus sequence and dif nucleotide variability for 161 dif-related sequences from 137 proteobacterial species. Nucleotide sequence characters in bold represent the dif sequence (28-mer). If the nucleotide frequency represents more than 50%, it is written in upper case letters; if not, the nucleotide is written in lower case letters. The nucleotide variability at each position in the 28-mer was defined as 1–f, where f is the frequency of the most frequent nucleotide. Nucleotide frequencies at each position are given in Table S2. Black bars represent dif XerC and dif XerD nucleotides, whereas grey bars correspond to the the dif cent nucleotides. White bars represent nucleotides outside dif. (B) Degree of variability in the dif sequence in 21 multi-strain species and in 19 multi-chromosome species. The degree of variability was calculated for each nucleotide position, as described in the Methods section. Since dif is more variable than dif , we then wondered whether XerC recombinases would be less well conserved than the XerD proteins. To answer this question, a phylogenic analysis based on the amino acid sequences was performed on both recombinases in the 48 species which were held to be representative of the proteobacterial taxa (Table 1 and Figure 2). Firstly, our analysis revealed a clustering of the Xer recombinases that confirms the taxonomic organization proposed by Olsen et al [37] (i.e. clustering of the γ and β groups on one hand and the δ, ε and α groups on the other). Secondly, comparison of the XerC and XerD phylogenic trees revealed greater branch lengths in XerC's phylogeny than in XerD's (Figure 2). This clearly indicates greater divergence between the XerC recombinases than between the XerD proteins. The higher variability of the proteobacterial XerC recombinases might thus explain the higher degree of sequence variability for the dif site. This observation strongly suggests co-evolution of the Xer recombinases and their related-dif sequences. The greater degree of conservation of XerD relative to XerC might be constrained by the direct interaction of XerD (but not XerC) with the highly conserved translocase FtsK [38]. Thus, evolutionary changes in XerD and consequently in dif , might have been limited by the conservation of FtsK.
Figure 2

Phylogeny of proteobacterial XerC and XerD recombinases.

Representative proteobacterial species of each taxon were selected for the analysis (Table 1). β-proteobacterial species are represented in blue, with γ in red, δ in green, α in magenta and ε in black. Amino acid sequence alignments were performed using Clustal W (MEGA 4 [60]). The evolutionary history was inferred by using the Neighbor-Joining method [61] conducted in MEGA4. Similar results were obtained using the Minimum Evolution method (data not shown). Only significant bootstrap values (≥90%) obtained with 1000 runs are indicated next to the branches (white with a grey background). The tree is drawn to scale, with branch lengths (below the branches) in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Branch lengths below the value 0.05 are not shown. The evolutionary distances were computed using the Poisson correction method and are given as the number of amino acid substitutions per site.

Phylogeny of proteobacterial XerC and XerD recombinases.

Representative proteobacterial species of each taxon were selected for the analysis (Table 1). β-proteobacterial species are represented in blue, with γ in red, δ in green, α in magenta and ε in black. Amino acid sequence alignments were performed using Clustal W (MEGA 4 [60]). The evolutionary history was inferred by using the Neighbor-Joining method [61] conducted in MEGA4. Similar results were obtained using the Minimum Evolution method (data not shown). Only significant bootstrap values (≥90%) obtained with 1000 runs are indicated next to the branches (white with a grey background). The tree is drawn to scale, with branch lengths (below the branches) in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Branch lengths below the value 0.05 are not shown. The evolutionary distances were computed using the Poisson correction method and are given as the number of amino acid substitutions per site.

Intra-species variations in dif-related sequences

Although the dif-related sequences are highly conserved within a given species, differences in the dif sequences were observed between strains. To evaluate any intra-species variations, we compared the dif-related sequences in the 21 multi-strain dif + species (Table S1) and calculated the degree of variability at each nucleotide position in the dif locus (Figure 1B). This analysis again revealed that the dif site is best conserved and that intra-species differences are located at the dif and dif outer ends (nucleotides 1 to 4 and 27–28, respectively). Surprisingly, with regard to the high nucleotide variability of the dif in the consensus sequence (Figure 1A), this region displays low intra-species variability. This observation clearly indicates that dif is well conserved within strains of the same species but weakly conserved between species.

Variations in dif-related sequences in multi-chromosome bacteria

In α, β and γ-proteobacteria, some species contain two or three chromosomes, with each (except in Agrobacterium tumefaciens) displaying one dif-related sequence (Table S3). Comparison of the sequences in given species indicated that (i) each chromosome harbors a distinct dif sequence, (ii) the main differences were found in the dif region and (iii) the dif region was less variable than the dif region (Figure 1B). Interestingly, the genes encoding the XerC and XerD tyrosine recombinases were always found as single copies, within the largest chromosome (Table S3) indicating that one couple of Xer recombinases interacts with two (or even three) distinct dif sequences in multi-chromosome bacteria and confirming the recent report by Val et al.[16]. This observation suggests that the recombinase / dif interaction allows some degree of variability - especially for XerC / dif XerC. It is noteworthy that nucleotide positions 5 and 8 to 11 in dif and 18 to 23 in dif do not vary between chromosomes (Figure 1B) and therefore these positions may well be critical for recombinase binding. When scanning the genome of the multi-chromosome A. tumefaciens for dif-related sequences, we found a dif sequence on the larger circular chromosome (2.84 Mb) but none on the smaller linear chromosome (2.07 Mb). This finding is not surprising, as it has been shown that the E. coli dif sequence is dispensable after linearization of the circular chromosome [39]. The origin of the linear chromosome in A. tumefaciens is unknown but some sequence features suggest that it derives from a plasmid [40], [41]. If the plasmid origin of the linear chromosome is confirmed, one can hypothesize that the dif sequence would have been lost after the chromosome became linear. Furthermore, when analyzing the presence of Xer homologs in A. tumefaciens, we observed that the gene coding for the XerD-like recombinase is present on the linear chromosome, whereas the xerC homolog gene was located on the circular chromosome. This distribution of the Xer recombinase genes seems to be specific to A. tumefaciens, since both recombinases are located on the larger chromosome in the recently sequenced genomes of A. vitis and A. radiobacter. Hence, A. tumefaciens is the only known multi-chromosome bacterium in which the XerC and XerD-encoding genes are on different chromosomes. This example suggests a xer gene translocation from the larger, conserved chromosome to the smaller, less conserved one [42].

Low G+C content, palindromicity, close association with the terminus and presence in a non-coding region are conserved features of the dif-related sequences

Nucleotide analysis of the dif-related sequences revealed that for a given species, the G+C content of the dif motif was systematically lower than the G+C content of the corresponding chromosomes (a difference of between 8.3% and 58.4%, median value  = 29.9%) (Table S1). Furthermore, as palindromicity seems to be essential for dif functionality [11], [43], we next searched for palindromes in the dif sequences from the 48 selected species. Of the 28 nucleotides of the dif sequence, 16.3±3.0 are involved in a palindrome. When the analysis was performed with 28-mers randomly generated from the initial dif sequences, the number of nucleotides involved in palindrome was significantly lower (9.3±4.4) (p<0.001; Student's test, n = 48) confirming that palindromicity is a key feature of the dif motif. We then analyzed each nucleotide position in the dif sequences for their involvement in a palindrome. Positions 5, 6, 23, 24 of the 28-mer are rarely involved in a palindromic structure, whereas nucleotides at position 8 to 11 and 18 to 21 (corresponding to the inner part of dif and dif ) are frequently associated (Figure S1). We then compared the dif position on the chromosome relative to the maximum cumulative GC skew. On the 161 chromosomal sequences, the median distance between the dif motif and the replication terminus as defined by the cumulative GC skew method was calculated to be 7277 bp (first quartile = 2055.5; third quartile = 21,445.5), with a distance ranging from 146 bp for chromosome 1 in V. cholerae to 199612 bp for Syntrophus aciditrophicus. The great distance between the location of dif and the peak of the cumulative GC skew curve for a few species can be mainly explained by a noisy GC skew signal blurring the precise location of its maximum value. However, despite this difficulty, we noted a high degree of correlation (R2 = 0.9978) between dif's position and the peak of the cumulative GC skew curve (Figure 3), which confirms the close association previously observed in a smaller number of species [22].
Figure 3

Correlation between the position of the dif sequence and the terminus of replication as defined by cumulative GC skew.

The analysis was performed on the 161 proteobacterial chromosomes from the 137 representative dif + species (Table S1). Chromosome of Wolbachia endosymbiont of Drosophila melanogaster and chromosome 2 of Pseudoalteromonas haloplanktis were not included in the analysis since no terminus of replication could be located for these species by the method of the cumulative GC skew. The equation of the plot and the coefficient of determination (R2) are given.

Correlation between the position of the dif sequence and the terminus of replication as defined by cumulative GC skew.

The analysis was performed on the 161 proteobacterial chromosomes from the 137 representative dif + species (Table S1). Chromosome of Wolbachia endosymbiont of Drosophila melanogaster and chromosome 2 of Pseudoalteromonas haloplanktis were not included in the analysis since no terminus of replication could be located for these species by the method of the cumulative GC skew. The equation of the plot and the coefficient of determination (R2) are given. Furthermore, we analyzed the gene environment of the 161 dif motifs and found that most (96.3%) were located in non-coding regions. This observation clearly indicates that dif intergenicity is another key feature. However, in a few cases (6 sequences out of 161, 3.7%), dif was present within coding sequences, four of which corresponding to hypothetical proteins, plus two associated to characterized open reading frames (ORFs). Whereas the sequence was inserted within a bacteriophage protein-coding sequence in Vibrio parahaemolyticus (chromosome 1), the motif was located in a gene coding for a major facilitator family transporter in the third chromosome of Burkholderia ambifaria (Table S1). Analysis of the flanking coding sequences of the 161 representative dif-related sequences revealed that 10.9% were flanked by proteins of phage origin and 14.2% were associated with insertion sequences or transposase- or integrase-encoding genes. This shows that about a quarter of the dif sequences are associated with ORFs whose products are involved in mobility. This number might even be an underestimate, since 60% of the dif sequences have ORFs with unknown functions in their vicinity (upstream, downstream or both). These results emphasize the propensity of the terminus region in general and dif in particular to facilitate DNA mobility.

Two dif/Xer systems in ε-proteobacteria

During the initial analysis of the ε-proteobacterial chromosomes, we found that only one species (Sulfurimonas denitrificans) out of 8 had a dif sequence (Table 1 and Table S1). In order to understand the apparent absence of a dif-related sequence in the genome of Helicobacter and Campylobacter species, we searched for the presence of the Xer-like recombinases in this subgroup. A XerD homolog was found in all bacteria belonging to this ε-subgroup, although the corresponding protein had a low degree of homology with E. coli XerD and was longer (between 353 and 363 amino acids versus 298 amino acids for E. coli XerD). Surprisingly, we did not detect any other recombinases that unambiguously corresponded to a XerC homolog. Blastp analysis with E. coli XerC showed the presence of XerC-like recombinases but none was ubiquitously found in the Helicobacter and Campylobacter species. Some of these XerC-like recombinases probably correspond to the transposable element-associated recombinases found in Helicobacter and designated “XerT” by Kersulyte et al. [44]. We thus concluded that this ε-proteobacteria sub-group expresses only one ubiquitous Xer recombinase that we designated here as “XerH” because Helicobacter is a major representative of this group. The presence of a single Xer recombinase is not unique in the bacterial kingdom. Indeed, it was recently shown that Streptococcus and Lactococcus species display an unconventional dif sequence (dif) which requires a single 356-amino acid recombinase, XerS [23]. Although XerS and XerH exhibit a similar size, the proteins appear to be phylogenetically unrelated (Figure 4). However, when BLASTing dif on ε-proteobacteria genomes, we discovered a dif SL homolog presenting all key features of a dif motif, i.e. (i) located near to the peak of the cumulative GC skew, (ii) present in non-coding regions and (iii) with a low G+C content (Table 2). Furthermore, this dif–like sequence designated as dif was composed of 2 highly conserved, inverted repeats separated by a central hexanucleotide variable region - another hallmark of dif (Figure 5). A dif sequence was also found in chromosomes of ε-proteobacteria sequenced after January 1st, 2007 (Arcobacter butzleri, C. concisus, C. hominis, C. doylei and Nitratiruptor sp) (Table 2). It is noticeable that in most ε-species, dif is genetically linked to the recombinase-encoding gene, the pair corresponding to an individual genetic module, as defined by Le Bourgeois et al. for dif and xerS (Table 2) [23]. Interestingly, the recently sequenced ε-species Sulfurovum sp did not have a dif sequence but did possess a more classical motif with homology to the dif sequence of the taxonomically-related Sulfurimonas denitrificans. Hence, two distinct groups can now be defined in the ε taxon as a function of their dif/Xer system. One encompasses most of the epsilon species (Campylobacter sps, Helicobacter sps, Wolinella succinogenes, Arcobacter butzleri and Nitratiruptor) with dif sequences similar to the firmicutes' dif and which, in most species, is genetically linked with xerH, a single Xer recombinase-encoding gene. Another group (Sulfurimonas denitrificans and Sulfurovum) displays the classical features of the dif/Xer system i.e. a dif sequence with homology to the canonical dif and two recombinases genes scattered across the chromosome. Interestingly, the two groups belong to two distinct clades [45], suggesting that the dif/Xer recombination systems are associated with specific phylogenic groups. Experimental approaches are now required to test the functionality of the newly discovered ε Xer-like recombination system.
Figure 4

Phylogenetic analysis of XerC, XerD, XerH and XerS recombinases.

XerH from the ε subgroup species (listed in Table 2) were compared with XerD and XerC recombinases from other ε species and representative bacteria from the α, β, δ and γ taxa (Table 1). XerS recombinases of S. pyogenes M1 GAS and L. lactis Il1403 [23] were added for comparison. Amino acid sequence alignment (with Clustal W) and phylogenetic analyses were performed in MEGA4 [60]. The phylogeny was built using the Neighbor-Joining method [61]. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site. The size range of the recombinases (in amino acids) is indicated under the recombinase name, in brackets.

Table 2

Features of the putative dif sequences of ε-proteobacteria.

ε-proteobacteria species (1) chromosomal features (2) putative dif characteristics
size (bp)G+C contentCGC skewsequence (40-mer) (3) G+C contentposition on chromosomedistance from GC skew (bp)distance from xerE (bp)intergenic location (4)
difH
Arcobacter butzleri RM401823412510.2701232417 TTAATTAGTATTGAAAACTATAATTTTCAAATAAAATATA 0.10011977163470166yes
Campylobacter concisus 1382620520060.394971215 ATATTTTGTATTGAAAACTATAATTTTCAAATTGATATTT 0.1259998422862759459hyp. prot
Campylobacter curvus 525.9219712640.4451008113 ATATTTTGTATTGAAAACTATAATTTTCAAATTAATATTT 0.1009917681634568030hyp. prot
Campylobacter fetus subsp. fetus 82-4017736150.333908630 TTATTTTGTATTGAAAACTATAATTTTCAAACTATTATGA 0.1508868422178835968yes
Campylobacter hominis ATCC BAA-38117112720.317875024 TATTTTATTTTTGAAAACTATAATTTTCAAACTTTTTTGT 0.12585102124003214673yes
Campylobacter jejuni subsp. doylei 269.9718451060.306853771 TAATTTTGTATTGAAAACTATAATTTTCAAACTTTTTTAT 0.12589286539094217yes
Campylobacter jejuni RM122117778310.303893799 TAATTTTGTATTGAAAACTGTAATTTTCAAACTTTTTTAT 0.1508883605439215yes
Helicobacter acinonychis str. Sheeba 15539270.382748099 TAGTTTAGTTATGAAAACTGCACTTTTCAAACTTTTAAAT 0.225747275824282yes
Helicobacter hepaticus ATCC 5144917991460.3591794500 (5) TGAATTAGTTATGAAAACTATACTTTTCAAACTTTTTTAT 0.175176579028710125yes
Helicobacter pylori 2669516678670.388813426 TCATTTAGTTATGAAAACTGCACTTTTCAAACTTTTAAAT 0.225723517899091981yes
Nitratiruptor sp. SB155-218779310.397927614 TTTATTAGTATTGAAAACTATAATTTTCAAACTTTTATTT 0.12510013997378552yes
Wolinella succinogenes DSM 174021103550.4841188027 TCATTTAGTATTGAAAACCATAATTTTCAAACTCATAATT 0.20011703841764316yes
consensus sequence (6) ----TT--T--TGAAAAC---A-TTTTCAAA---------
classical dif distance from XerC / XerD (bp)
Sulfurimonas denitrificans DSM 1251 (7) 22015610.3451135161 AAATACTTTCAATAGAATTTACATTATGTTAACCAATATA 0.175112226412897705981/193695yes
Sulfurovum sp. NBC37-125622770.4391189307 TTGCTTTTTTAATAGAATTTATATTATGTTAATCAATAGA 0.150118692923781109695/758085yes
consensus sequence (6) ------TTT-AATAGAATTTA-ATTATGTTAA-CAATA-A

One representative per species.

All genomes are circular.

The position of the putative dif motif on the chromosome corresponds to the nucleotide in bold type, located between the two inverted repeats.

hyp. prot.  =  hypothetical protein.

maximum of the GC skew.

Underlined nucleotides correspond to the inverted repeats.

Sulfurimonas denitrificans strain DSM 1251  = Thiomicrospira denitrificans ATCC 33889.

Figure 5

Alignment of dif and dif.

The dif sequence corresponds to the putative dif motif of H. pylori 26695 (Table 2), whereas dif was described by Le Bourgeois et al. [23]. Asterisks indicate the common nucleotides and arrows designate inverted repeats.

Phylogenetic analysis of XerC, XerD, XerH and XerS recombinases.

XerH from the ε subgroup species (listed in Table 2) were compared with XerD and XerC recombinases from other ε species and representative bacteria from the α, β, δ and γ taxa (Table 1). XerS recombinases of S. pyogenes M1 GAS and L. lactis Il1403 [23] were added for comparison. Amino acid sequence alignment (with Clustal W) and phylogenetic analyses were performed in MEGA4 [60]. The phylogeny was built using the Neighbor-Joining method [61]. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site. The size range of the recombinases (in amino acids) is indicated under the recombinase name, in brackets.

Alignment of dif and dif.

The dif sequence corresponds to the putative dif motif of H. pylori 26695 (Table 2), whereas dif was described by Le Bourgeois et al. [23]. Asterisks indicate the common nucleotides and arrows designate inverted repeats. One representative per species. All genomes are circular. The position of the putative dif motif on the chromosome corresponds to the nucleotide in bold type, located between the two inverted repeats. hyp. prot.  =  hypothetical protein. maximum of the GC skew. Underlined nucleotides correspond to the inverted repeats. Sulfurimonas denitrificans strain DSM 1251  = Thiomicrospira denitrificans ATCC 33889.

The dif/Xer system is not present in all proteobacteria

Our approach revealed that 12.2% of the studied proteobacterial species do not contain a dif motif. Most of them lack the XerC, XerD, XerH or XerS recombinases, justifying the absence of dif (Table S4). It seems that genome size should be taken into account when considering the absence of the dif/Xer system. Indeed, insect endosymbiont bacteria (Buchnera sp, Blochmannia sp, Carsonella ruddii, Ruthia magnifica, Baumannia cicadellinicola and Wigglesworthia glossinidia) have a genome size ranging from 0.159 to 1.1 Mb and lack the dif/Xer system (Table S4). During their co-evolution with their host, the endosymbiotic bacteria have lost a large part of their genome and have retained only genes that are essential for survival [46]. The absence of the dif/Xer system in these bacteria indicates that this recombination system is not required for microbial symbiosis. Likewise, the marine α-proteobacteria Pelagibacter ubique has the smallest known genome of a free-living microorganism (1.3 Mb) [47] and, like the endosymbiotic bacteria, does not possess a dif/Xer system. This confirms that genome fitting can affect non-vital systems, such as the Xer machinery. However, low chromosome size is not always associated with the absence of the dif/Xer system, since the Rickettsiales (α-proteobacteria with a genome ranging from 0.85 to 1.52 Mb in size) do harbor dif/Xer recombination machinery (Table 1 and Table S1). Furthermore, the absence of the dif/Xer system cannot only be explained by chromosome fitting, since bacteria with a larger chromosome (like the Legionellales, Colwellia psychrerythraea or Saccharophagus degradans: genome size ranging from 2 Mb to 5 Mb) also lack this machinery. Surprisingly, a dif/Xer system was not found in Aromatoleum aromaticum str EbN1 (also designated as Azoarcus sp EbN1) whereas the complete system was revealed in Azoarcus BH72. This difference could be attributed to the low degree of synteny seen for the genomes of these two phylogenetically similar species [48]. Chromosome dimerization is a prerequisite for dif/Xer activity and requires the presence of RecA, RecBC, and RecF pathways for homologous recombination between sister chromosomes, RecA being the most efficient for this function [49], [4]. Except for Candidatus Ruthia magnifica which does not display RecA, RecB or RecF homologs, all other dif-deficient species encode at least one enzyme that may be responsible for chromosome dimerization (Table S4). This observation raises the question of the fate of bacterial cells in which dimerization occurs without the rescue by the dif/Xer system.

Discussion

In the present study, 234 chromosomes from 156 proteobacterial species were analyzed for the presence of a dif-related sequence by using a strategy mainly based on homology with experimentally-defined dif sequences and a close association with the chromosome terminus defined by the cumulative GC skew. We now have an overview of the features of the dif/Xer systems present in proteobacteria. Most species display a “classical” dif sequence composed of two undecanucleotides, a conserved dif and a more variable dif separated by an hexanucleotide region (dif ). These dif motifs (i) contain inverted repeats forming a palindrome, (ii) are located intergenically, with no apparent specific genetic environment, (iii) have a lower G+C content than the chromosomal G+C content and (iv) are located near the replication terminus as identified in GC skew analyses. These sequences are found in bacteria harboring XerD- and XerC-like recombinases. Other proteobacteria, notably a subgroup of ε-proteobacteria, display a sequence (dif) which is homologous to dif SL from streptococci and lactococci [23]. As the canonical dif motif, dif (i) exhibits a low G+C content (ii) is located intergenically, near the terminus defined by the GC skew, (iii) is not associated with specific genetic elements or open reading frames, (iv) displays a palindromic structure and, (v) like dif, can be located in the immediate vicinity of its recombinase. Furthermore, as for the streptococci and lactococci, a single Xer-like recombinase (XerH) was found in species displaying a dif sequence. However, no phylogenic association between XerS and XerH could be found, which strongly suggests the existence of two unrelated dif/Xer systems. Taken as a whole, these data demonstrate that at least two types of dif/Xer systems exist in proteobacteria: the classical machinery found in most species and an atypical system present in a sub-group of ε proteobacteria. Exhaustive analysis of the dif/Xer systems in other bacterial taxa is now required to evaluate the distribution of these systems in the bacterial kingdom. The general features of dif defined in our study should facilitate this investigation. Our analysis also demonstrated that the dif/Xer system is not as universal as initially thought. Indeed, 12.2% of the studied proteobacterial species do not harbor this recombination machinery - an absence that could be explained by genome fitting for small genome microorganisms but not for bacteria with large chromosomes (like the Legionellales, Saccharophagus degradans or Colwellia psychrerythraea). It is presently unclear whether the large chromosome in these microorganisms lost the Xer recombination system, never acquired it or developed a substitutive system to deconcatenate the chromosomes. The consequences of this absence are also intriguing, as most of these dif-deficient species seem to possess the enzymatic machinery (RecA, RecBCD and RecF) potentially responsible for chromosome dimerization by homologous recombination (Table S4) [49], [4]. In the absence of dif and Xer recombinase, how do bacterial cells handle chromosome deconcatenation? Can these bacteria survive without the need to resolve chromosome dimers or does an alternative recombination system replace the dif/Xer system? It has already been shown that the loxP/Cre resolvase system (but not res/Tn3) can suppress the filamentation phenotype of a dif-deficient E. coli but only when loxP is located at the chromosome terminus [6]. This demonstrates that the dif/Xer machinery can be replaced by other recombination systems. However, there is presently no evidence to suggest that dif/Xer-deficient proteobacteria harbor loxP/Cre resolvase-like systems. In the case of Legionella, the absence of dif/Xer agrees with an early observation showing filamentous cells in Legionella cultures [50]. Experimental evidence is now required in order to establish whether the filamentous phenotype in L. pneumophila results from the absence of dif/Xer recombination. This question could be answered by reintroducing a functional dif/Xer system into Legionella and then checking for the filamentous phenotype. Compared with other recombination targets, the dif motif harbors a particular structure in view of the presence of two recombinases. It is composed of two recombinase–specific outer regions and two inner regions with dyad symmetry, close to the central hexanucleotide. Our analysis of nucleotide variability in proteobacteria species revealed that the inner regions of dif and dif are highly conserved, whereas the outer regions are much more variable (Figure 1A). Nucleotides at position 23 and 24 (located in the outer part of dif ) are highly variable and are rarely part of the palindrome. Interestingly, these positions were experimentally defined in E. coli as major contributors to the XerD binding specificity [43] and analysis of the crystal structure of XerD predicted that the dif nucleotide at position 24 interacts directly with the highly conserved amino acid residue Q221 of XerD [51]. Furthermore, this position is much less variable in multi-strain species and multichromosome species (Figure 1B). This observation shows that the variability of the nucleotide at position 24 is primarily inter-species variability and could even be considered as a species marker. Lastly, an adenine residue is highly conserved at position 25 within the outer part of dif and could represent a general feature of the dif in proteobacteria. As for dif , the variable outer region of dif corresponds to the recombinase binding site, since positions 2 and 5 have been described as major contributors to XerC binding [43]. For the outer dif region, our study shows that nucleotides in position 2 of dif display the highest variability, whereas the residue located in position 5 is the least variable. It would be interesting to know whether the most conserved position in dif (position 5) is associated with a conserved amino acid residue in XerC. Unfortunately, structure/function analysis of XerC is prevented by the lack of structural data. The dif was a hexamer in all the proteobacterial genomes that we analyzed, suggesting that the size of the central region separating the recombinase binding sites is a critical feature. In E.coli, it has been demonstrated that the 6 bp-distance between the XerC and XerD binding sites was optimal for chromosomal recombination activity and cleavage [52], [53]. A 8-bp central region is found in natural plasmids like ColE1 but is always associated with adjacent DNA sequence and accessory proteins [54], [55], [56]. The presence of a 6-bp central region in proteobacteria thus suggests that chromosomal recombination at dif in these species does not require accessory elements. Furthermore, positions in the central hexamer do not appear to be equivalent. Indeed, our overall analysis suggests that the nucleotide at position 13 within dif is highly variable (Figure 1A), whereas it is the least variable residue of the hexanucleotide in the genomes of multi-chromosome bacteria (Figure 1B). Hence, this position may represent an important feature for species discrimination. Moreover, in multi-chromosome species, dif is more variable than the dif or dif regions (Figure 1B). This observation agrees with the study by Val et al. [16] and confirms that the central hexanucleotide is a key region for discriminating between chromosomes within the same bacterium and for avoiding chromosome fusion. This study represents the first comprehensive analysis of the dif motif and its recombinases; it revealed a new dif/Xer recombination system in proteobacteria and constitutes an important step toward the characterization of the dif/Xer-like systems in bacteria with circular chromosomes.

Methods

Identification of dif-like motifs in proteobacteria

The dif-related sequences were identified by using genomic similarity search tools, such as the Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi) [57] and the YASS DNA pairwise alignment tool (http://bioinfo.lifl.fr/yass/yass.php) [58]. Sequences of the experimentally characterized dif elements from E. coli, B. subtilis, C. crescentus, X. campestris, V. cholerae, streptococci and lactococci [13], [14], [15], [16], [23] were used as query sequences. Given that previous studies had revealed conservation of the dif sequence, we used this feature to develop an approach for characterizing dif homologs in phylogenetically related species. Our analysis of dif-related motifs was performed on all the 234 completed proteobacterial chromosome sequences released before January 1st, 2007 (Table S1). This corresponds to 156 species and represents 53.1% (234 out of 440) of all the bacterial chromosomes sequenced as of that date. The nucleotide sequences were downloaded from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov). Forty-eight species were selected as being representative of the different proteobacterial taxa (Table 1). Information on the coding sequences flanking the dif-related sequence was obtained from the protein tables (.ptt file) summarizing the genome annotation at NCBI.

Skew analysis

The position of the candidate dif sequences was compared with that of the DNA replication terminus, as defined by the maximum of cumulative GC nucleotide (CGC) skew obtained by nucleotide skew analyses of the chromosome sequences [59]. When the maximum of CGC skew was undetectable, we chose the maximum of GC skew (GC) of the chromosome or at the first position of the codon (GC1).

Determination of the dif consensus sequence

To define the dif consensus sequence for proteobacteria, we aligned the dif-related sequences extracted from the available chromosomes. To avoid redundancy when several genome sequences were available for one bacterial species, only the information on the first-published chromosome (according to the NCBI release date) was used. In the end, 161 bacterial chromosomes were selected for determination of the dif consensus sequence; since some species have several chromosomes, the number of chromosomes is higher than the number of species. The degree of nucleotide variability (v) at each position of the 28-mer was defined as v = 1–f, where f is the frequency of the most frequent nucleotide.

Measurement of the degree of variability

The intra-species nucleotide variability of the dif sequence was measured in the 21 dif +species represented by at least two strains (termed “multi-strain species” in this study). Intra-species variability was measured at each position of the 28-nucleotide dif sequence. A score of 1 was attributed to the position when the nucleotides differed between strains of the same species; if not, the score at this position was 0 (i.e. conservation). For each position of the 28-nucleotide dif sequence, the scores obtained for all the species were added and normalized against the number of species (n = 21). This value obtained corresponds to the degree of variability at each position and, hence, a low value corresponds to low nucleotide variability at the position. A similar approach was adopted for analyzing the nucleotide variability of dif in 19 out of 20 multi-chromosome species (listed in Table S3). Multi-chromosome Agrobacterium tumefaciens was not included in the analysis since only one of its two chromosomes display a dif sequence. Within the same strain, chromosomes were compared in terms of dif sequence. A score of 1 was attributed to the position if the nucleotides differed for the 2 or 3 chromosomes in the same strain; if not, the position was scored as 0. Next, for each position, the scores were added and normalized against the number of species (n = 19) to obtain a value representing the degree of variability in multi-chromosome species, a low value being associated with a low nucleotide variability at the position.

Palindromicity

Palindromicity was analyzed by comparing the 28-nt dif sequence with its inverted complementary counterpart in the 48 selected proteobacterial species (Table 1). The palindrome was defined as the conserved nucleotide sequence between dif and its inverted, complementary strand. When a nucleotide was found both in dif and in the reverse complementary sequence, a value of 1 was given to the position. Next, the values for the 48 dif sequences for each position were added together to give the n value. The palindromicity frequency (fpal) was then estimated as: fpal = n/48, with 48 being the number of dif sequences analyzed. A fpal value of 1 to a nucleotide position means that the nucleotide is always part of a palindrome. In order to demonstrate that the presence of a palindrome is a key feature of dif motifs, we compared each dif sequence with a randomly generated 28-mer obtained by shuffling the nucleotide of the original dif. Next, the nucleotides involved in the palindrome were counted in both dif and the randomized 28-mers and the average numbers of nucleotide involved in a palindrome were calculated and compared.

BLASTp analysis and the phylogeny of the Xer recombinases

BLASTp analysis were performed using reference amino acid sequences from E.coli K12 XerC and XerD recombinases (protein reference on NCBI: NP_418256 and NP_417370, respectively), from Lactococcus lactis Il1403 XerS (NP_267388) and from E. coli K12 RecA, RecB and RecF (NP_417179, NP_417297.1 and NP_418155.1, respectively). Phylogenetic analysis of the Xer recombinases was performed with MEGA version 4 [60]. Sequences were aligned with ClustalW, whereas phylogeny was build using the Neighbor-Joining method [61]. Palindromicity of the dif-related sequences. The frequency of palindromicity was calculated from the 48 representative dif sequences (Table 1), as described in the Methods section. Black bars represent dif XerC and dif XerD nucleotides, whereas grey bars correspond to dif cent nucleotides. White bars represent nucleotides outside dif. (6.24 MB TIF) Click here for additional data file. Genome, dif, and Xer recombinase features of 234 protobacteria (0.17 MB XLS) Click here for additional data file. Nucleotide frequency (%) of the dif-related sequences from 161 proteobacterial chromosomes. (0.07 MB DOC) Click here for additional data file. dif-related sequences in multi-chromosome proteobacteria (0.15 MB DOC) Click here for additional data file. Xer recombinases and RecA, RecB and RecF homologs in dif-deficient proteobacteria (0.03 MB XLS) Click here for additional data file.
  60 in total

1.  Conservation of xer site-specific recombination genes in bacteria.

Authors:  G D Recchia; D J Sherratt
Journal:  Mol Microbiol       Date:  1999-12       Impact factor: 3.501

2.  Functional polarization of the Escherichia coli chromosome terminus: the dif site acts in chromosome dimer resolution only when located between long stretches of opposite polarity.

Authors:  K Pérals; F Cornet; Y Merlet; I Delon; J M Louarn
Journal:  Mol Microbiol       Date:  2000-04       Impact factor: 3.501

3.  The genome of the natural genetic engineer Agrobacterium tumefaciens C58.

Authors:  D W Wood; J C Setubal; R Kaul; D E Monks; J P Kitajima; V K Okura; Y Zhou; L Chen; G E Wood; N F Almeida; L Woo; Y Chen; I T Paulsen; J A Eisen; P D Karp; D Bovee; P Chapman; J Clendenning; G Deatherage; W Gillet; C Grant; T Kutyavin; R Levy; M J Li; E McClelland; A Palmieri; C Raymond; G Rouse; C Saenphimmachak; Z Wu; P Romero; D Gordon; S Zhang; H Yoo; Y Tao; P Biddle; M Jung; W Krespan; M Perry; B Gordon-Kamm; L Liao; S Kim; C Hendrick; Z Y Zhao; M Dolan; F Chumley; S V Tingey; J F Tomb; M P Gordon; M V Olson; E W Nester
Journal:  Science       Date:  2001-12-14       Impact factor: 47.728

4.  FtsK Is a DNA motor protein that activates chromosome dimer resolution by switching the catalytic state of the XerC and XerD recombinases.

Authors:  Laurent Aussel; François Xavier Barre; Mira Aroyo; Andrzej Stasiak; Alicja Z Stasiak; David Sherratt
Journal:  Cell       Date:  2002-01-25       Impact factor: 41.582

5.  Genetic characterization of gram-positive homologs of the XerCD site-specific recombinases.

Authors:  A F Chalker; A Lupas; K Ingraham; C Y So; R D Lunsford; T Li; A Bryant; D J Holmes; A Marra; S C Pearson; J Ray; M K Burnham; L M Palmer; S Biswas; M Zalacain
Journal:  J Mol Microbiol Biotechnol       Date:  2000-04

6.  Plasmids carrying cloned fragments of RF DNA from the filamentous phage (phi)Lf can be integrated into the host chromosome via site-specific integration and homologous recombination.

Authors:  N T Lin; R Y Chang; S J Lee; Y H Tseng
Journal:  Mol Genet Genomics       Date:  2001-11       Impact factor: 3.291

7.  Identification and characterization of the dif Site from Bacillus subtilis.

Authors:  S A Sciochetti; P J Piggot; G W Blakely
Journal:  J Bacteriol       Date:  2001-02       Impact factor: 3.490

8.  Genome sequence of the plant pathogen and biotechnology agent Agrobacterium tumefaciens C58.

Authors:  B Goodner; G Hinkle; S Gattung; N Miller; M Blanchard; B Qurollo; B S Goldman; Y Cao; M Askenazi; C Halling; L Mullin; K Houmiel; J Gordon; M Vaudin; O Iartchouk; A Epp; F Liu; C Wollam; M Allinger; D Doughty; C Scott; C Lappas; B Markelz; C Flanagan; C Crowell; J Gurson; C Lomo; C Sear; G Strub; C Cielo; S Slater
Journal:  Science       Date:  2001-12-14       Impact factor: 47.728

9.  Helicobacter Pylori's plasticity zones are novel transposable elements.

Authors:  Dangeruta Kersulyte; Wookon Lee; Dharmalingam Subramaniam; Shrikant Anant; Phabiola Herrera; Lilia Cabrera; Jacqueline Balqui; Orsolya Barabas; Awdhesh Kalia; Robert H Gilman; Douglas E Berg
Journal:  PLoS One       Date:  2009-09-03       Impact factor: 3.240

10.  FtsK-dependent dimer resolution on multiple chromosomes in the pathogen Vibrio cholerae.

Authors:  Marie-Eve Val; Sean P Kennedy; Meriem El Karoui; Laetitia Bonné; Fabien Chevalier; François-Xavier Barre
Journal:  PLoS Genet       Date:  2008-09-26       Impact factor: 5.917

View more
  50 in total

1.  Single-molecule imaging of DNA curtains reveals mechanisms of KOPS sequence targeting by the DNA translocase FtsK.

Authors:  Ja Yil Lee; Ilya J Finkelstein; Estelle Crozat; David J Sherratt; Eric C Greene
Journal:  Proc Natl Acad Sci U S A       Date:  2012-04-09       Impact factor: 11.205

2.  XerCD-mediated site-specific recombination leads to loss of the 57-kilobase gonococcal genetic island.

Authors:  Nadia M Domínguez; Kathleen T Hackett; Joseph P Dillard
Journal:  J Bacteriol       Date:  2010-11-12       Impact factor: 3.490

3.  Single-molecule imaging of FtsK translocation reveals mechanistic features of protein-protein collisions on DNA.

Authors:  Ja Yil Lee; Ilya J Finkelstein; Lidia K Arciszewska; David J Sherratt; Eric C Greene
Journal:  Mol Cell       Date:  2014-04-24       Impact factor: 17.970

4.  FtsK translocation permits discrimination between an endogenous and an imported Xer/dif recombination complex.

Authors:  Florian Fournes; Estelles Crozat; Carine Pages; Catherine Tardin; Laurence Salomé; François Cornet; Philippe Rousseau
Journal:  Proc Natl Acad Sci U S A       Date:  2016-06-17       Impact factor: 11.205

5.  Helicobacter pylori from Peruvian amerindians: traces of human migrations in strains from remote Amazon, and genome sequence of an Amerind strain.

Authors:  Dangeruta Kersulyte; Awdhesh Kalia; Robert H Gilman; Melissa Mendez; Phabiola Herrera; Lilia Cabrera; Billie Velapatiño; Jacqueline Balqui; Freddy Paredes Puente de la Vega; Carlos A Rodriguez Ulloa; Jaime Cok; Catherine C Hooper; Giedrius Dailide; Sravya Tamma; Douglas E Berg
Journal:  PLoS One       Date:  2010-11-29       Impact factor: 3.240

6.  Evidence for a Xer/dif system for chromosome resolution in archaea.

Authors:  Diego Cortez; Sophie Quevillon-Cheruel; Simonetta Gribaldo; Nicole Desnoues; Guennadi Sezonov; Patrick Forterre; Marie-Claude Serre
Journal:  PLoS Genet       Date:  2010-10-21       Impact factor: 5.917

7.  Strain-specific genes of Helicobacter pylori: genome evolution driven by a novel type IV secretion system and genomic island transfer.

Authors:  Wolfgang Fischer; Lukas Windhager; Stefanie Rohrer; Matthias Zeiller; Arno Karnholz; Reinhard Hoffmann; Ralf Zimmer; Rainer Haas
Journal:  Nucleic Acids Res       Date:  2010-05-16       Impact factor: 16.971

8.  Superantigenic Yersinia pseudotuberculosis induces the expression of granzymes and perforin by CD4+ T cells.

Authors:  Agathe Goubard; Caroline Loïez; Jun Abe; Caroline Fichel; Stéphanie Herwegh; Christelle Faveeuw; Rémi Porte; Delphine Cayet; Florent Sebbane; Sylvie Penet; Benoit Foligné; Pierre Desreumaux; Hirohisa Saito; Jean-Claude Sirard; Michel Simonet; Christophe Carnoy
Journal:  Infect Immun       Date:  2015-03-09       Impact factor: 3.441

9.  The Xer/dif site-specific recombination system of Campylobacter jejuni.

Authors:  Maxime Leroux; Zoulikha Rezoug; George Szatmari
Journal:  Mol Genet Genomics       Date:  2013-07-17       Impact factor: 3.291

10.  Helicobacter Pylori's plasticity zones are novel transposable elements.

Authors:  Dangeruta Kersulyte; Wookon Lee; Dharmalingam Subramaniam; Shrikant Anant; Phabiola Herrera; Lilia Cabrera; Jacqueline Balqui; Orsolya Barabas; Awdhesh Kalia; Robert H Gilman; Douglas E Berg
Journal:  PLoS One       Date:  2009-09-03       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.