Literature DB >> 19687787

Effect of ovarian hormones on genes promoting dendritic spines in laser-captured serotonin neurons from macaques.

C L Bethea1, A P Reddy.   

Abstract

Dendritic spines are the elementary structural units of neuronal plasticity and the cascades that promote dendritic spine remodeling center on Rho GTPases and downstream effectors of actin dynamics. In a model of hormone replacement therapy, we sought the effect of estradiol (E) and progesterone (P) on gene expression in these cascades in laser-captured serotonin neurons from rhesus macaques with complementary DNA array analysis. Ovariectomized rhesus macaques were treated with either placebo, E or E+P through Silastic implant for 1 month before euthanasia. The midbrain was obtained, sectioned and immunostained for tryptophan hydroxylase (TPH). TPH-positive neurons were laser captured using an Arcturus Laser Dissection Microscope (PixCell II). RNA from laser-captured serotonin neurons (n=2 animals/treatment) was hybridized to Rhesus Affymetrix GeneChips. With E±P treatment, there was a significant change in 744 probe sets (analysis of variance, P<0.05), but 10,493 probe sets exhibited a twofold or greater change. Pivotal changes in pathways leading to dendritic spine proliferation and transformation included twofold or greater increases in expression of the Rho GTPases called CDC42, Rac1 and RhoA. In addition, twofold or greater increases occurred in downstream effectors of actin dynamics, including p21-activated kinase (PAK1), Rho-associated coiled-coil-containing protein kinase (ROCK), PIP5K, IRSp53, Wiskott-Aldrich syndrome protein (WASP), WASP family Verprolin-homologous protein (WAVE), MLC, cofilin, gelsolin, profilin and three subunits of actin-related protein (ARP2/3). Finally, twofold or greater decreases occurred in CRIPAK, LIMK2 and myosin light chain kinase (MLCK). The regulation of RhoA, Rac1, CDC42, ROCK, PIP5k, IRSp53, WASP, WAVE, LIMK2, CRIPAK1, MLCK, ARP2/3 subunit 3, gelsolin, profilin and cofilin was confirmed with nested quantitative reverse transcriptase-PCR on laser-captured RNA (n=3 animals/treatment). The data indicate that ovarian steroids target gene expression of the Rho GTPases and pivotal downstream proteins, that in turn would promote dendritic spine proliferation and stabilization on serotonin neurons of the dorsal raphe nucleus.

Entities:  

Mesh:

Substances:

Year:  2009        PMID: 19687787      PMCID: PMC3910421          DOI: 10.1038/mp.2009.78

Source DB:  PubMed          Journal:  Mol Psychiatry        ISSN: 1359-4184            Impact factor:   15.992


Introduction

The serotonin system modulates a wide range of neural outcomes from emotion to intellect to metabolism and it is a target of pharmacotherapies, steroid hormones, cytokines, neuropeptides and trophic factors, all of which impact the generation and efficacy of serotonin neurotransmission. Recently, it has been suggested that antidepressants and other pharmacotherapies may act by promoting neuronal plasticity (1). The underlying structural element of neuronal plasticity in the adult nervous system is the dendritic spine (2). In addition, dendritic spines are the morphological basis for excitatory neurotransmission (3, 4). Hence, dendritic spine proliferation on serotonin neurons would have a profound effect on serotonergic function and neurotransmission. A significant body of literature has demonstrated that estrogen (E) increases dendritic spines in hippocampal neurons (5, 6). We hypothesized that ovarian steroids support neuronal plasticity by enhancing dendritic spine proliferation on serotonin neurons. In the adult nervous system, this would facilitate excitatory input to the serotonin neurons and in turn, increase serotonin neural activity. The extension of dendrites requires a multiplex intracellular cascade that culminates in dynamic actin reorganization (2). This reorganization requires extension and branching of actin at the cell membrane as well as degradation of actin further back in the spine. Upstream of actin dynamics are effector proteins that are activated by Rho GTPases. The most well accepted of these are CDC42, Rac 1 and Rho A. These small molecules activate cascades that lead to filopodia extension, spine head enlargement and spine shortening, all of which are necessary for the production of a mature dendritic spine. This laboratory has devoted effort toward understanding the actions of ovarian hormones in serotonin neurons and their terminal fields with a macaque model of surgical menopause. Serotonin neurons express estrogen receptor beta (ERβ) and progestin receptors (PR) (7, 8). We found that E, plus or minus P supplementation, regulates the expression of pivotal serotonin-related genes and proteins in the monkey dorsal raphe in a pattern suggestive of increased serotonin production, increased serotonin turnover, increased neural firing and decreased degradation (9–11). We recently reported that ovarian steroids regulate gene expression in laser captured serotonin neurons in a manner that would increase cellular resilience and decrease apoptosis (12). Further examination of the proteins implicated by gene expression showed that in normal, undamaged midbrain, ovarian steroids act through the caspase independent pathway and decrease translocation of apoptosis inducing factor (AIF) from the mitochondria to the nucleus (13). The additional issue of steroid supported dendritic spine proliferation may be extremely important for menopausal women grappling with issues surrounding hormone therapy (HT). Women experience ovarian failure and loss of ovarian steroid production around 50 years of age. Thus, with extended life spans, a woman may live 35–40 years without ovarian steroids. If dendritic spines on serotonin neurons shrink or atrophy due to lack of steroid supported gene expression, then geriatric depression, anxiety, fretfulness, decreased coping skills and increased vulnerability to stress can be predicted outcomes. Therefore, in this study, we sought novel genes related to dendritic spine protrusion that are regulated by estrogen (E) and progesterone (P) in laser captured serotonin neurons of rhesus monkeys using the Rhesus Affymetrix cDNA array and nested quantitative (q) RT-PCR. Fifteen pivotal gene changes predicted by the microarray were confirmed by qRT-PCR.

Materials and Methods

The Oregon National Primate Research Center (ONPRC) Institutional Animal Care and Use Committee approved this study.

Animals and treatments

Nine adult female rhesus monkeys (Macaca mulatta) were spayed (ovariectomized only) by the surgical personnel of ONPRC between 3 and 8 months before assignment to this project according to accepted veterinary surgical protocol. All animals were born in China, were aged between 7–14 years by dental exam, weighed between 4 and 8 kg, and were in good health. Animals were either treated with placebo (ovx-control group; n=3), or treated with estrogen (E) for 28 days (E group; n=3), or treated with E for 28 days and then supplemented with P for the final 14 of the 28 days (E+P group; n=3). The placebo treatment of the spay-control monkeys consisted of implantation with empty Silastic capsules (s.c.). The E-treated monkeys were implanted (s.c.) with two 4.5-cm E-filled Silastic capsules (i.d. 0.132 in.; o.d. 0.183 in.; Dow Corning, Midland, MI). The capsule was filled with crystalline estradiol (1,3,5(10)-estratrien-3,17-b-diol; Steraloids, Wilton, NH). The E+P- treated group received E-filled capsules, and 14 days later, received one 6-cm capsule filled with crystalline P (4-pregnen-3,20 dione; Steraloids). All capsules were placed in the periscapular area under ketamine anesthesia (ketamine HCl, 10mg/kg, s.c.; Fort Dodge Laboratories, Fort Dodge, IA). The monkeys were euthanized at the end of the treatment periods according to procedures recommended by the Panel on Euthanasia of the American Veterinary Association. Each animal was sedated with ketamine, given an overdose of pentobarbital (25 mg/kg, i.v.), and exsanguinated by severance of the descending aorta.

Steroid Hormone Assays

Assays for estradiol and progesterone were performed utilizing a Roche Diagnostics 2010 Elecsys assay instrument and the serum levels achieved by the implants were previously reported (12)

Tissue preparation for Laser Capture Dissection (n=9; 3 animals/treatment group)

The left ventricle of the heart was cannulated and the head of each animal was perfused with 3 liters of 1× cold RNA-later buffer (Ambion Inc., Austin, TX) plus 20% sucrose. The brain was removed from the cranium, dissected into blocks and frozen at −80°C. The pontine midbrain block was placed in a cryostat (Microm HM500OM) and brought to −20°C. Thin sections (7 µm) through the dorsal raphe nucleus were thaw mounted onto plain glass slides and frozen at −80°C. The next morning, the sections were processed in a rapid, RNAse free immunohistochemical assay for tryptophan hydroxylase (TPH). The sections were immersed in cold acetone for 1 minute, cold ethanol for 30 seconds, cold PBS for 3 minutes, and then covered with normal rabbit serum (NRS, 1/500) containing 1% RNAse inhibitor for 10 minutes. The NRS was blotted and the sections were covered with sheep anti-TPH (1/300; Chemicon, Temecula, CA) containing 1% RNAse inhibitor for 30 minutes, then immersion washed in PBS for 3 minutes, and covered with biotinylated rabbit anti-sheep serum (1/120; Vector Laboratories, Burlingame, CA) containing 1% RNAse inhibitor for 20 minutes. The sections were then immersed in PBS for 3 minutes, covered with Vector ABC reagent for 30 minutes, immersed in cold 0.2 M Tris (pH 8.2), immersed in cold diaminobenzidine (DAB) containing H2O2 (30% solution diluted 1/5000) and dehydrated in 100% ethanol for 2 minutes. Finally, the slides were immersed in xylene for 2 minutes and then dried under vacuum for 1 hr prior to laser capture. Serotonin neurons appeared darkly stained and were captured with an Arcturus Laser Dissection Microscope (PixCell II). After capture to the microcap film (Capsure macro-211), the films were removed from the caps and immersed in lysis buffer. Up to 10 films with 1000–3000 pulses each were collected into one microtube containing 200 µl of lysis buffer. Approximately 150,000 laser pulses were conducted for a pool (12–15 microtubes were pooled). Individuals interested in obtaining other areas of the brain for similar studies are encouraged to contact the senior author.

RNA extraction from laser captured neurons

Two pools were prepared from two placebo, two E-treated and two E+P treated animals. One of the pools was used for hybridization to the microarray and one pool was set aside for qRT-PCR. An additional pool was prepared from another placebo, E-treated and E+P treated animal for qRT-PCR. Thus, 2 animals per group were used for hybridization and 3 animals per group were used to confirm gene changes with qRT-PCR. The tubes containing the lysis buffer and films were vortexed to dislodge the captured material from the films. Each tube was adjusted to 350 µl of lysis buffer and then 350 µl of 70% ethanol was added and mixed well. The samples were extracted with the RNAeasy microRNA kit from Qiagen according to the directions. The final eluates were pooled and evaporated in a Speedvac. The RNA was suspended in 12 µl of TE (0.01MTris+0.005M EDTA). The quantity of RNA in the resuspended sample was determined with the Ribogreen Quantitation Kit (Molecular Probes, Eugene, OR) or with a Nanodrop Spectrophotometer (ND 1000 V3.3, Wilmington, DE). The integrity of the RNA was examined with the Agilent Bioanalyzer using the pico-chip according to the directions of the manufacturer.

Affymetrix hybridization

Labeled target cRNA was prepared from 6 pools of laser captured serotonin neurons (n=2 animals/treatment group). The cRNA was hybridized to Rhesus Affymetrix GeneChip arrays. The Affymetrix GeneChip® Rhesus Macaque Genome Array interrogates over 47,000 M. mulatta transcripts. The array contains 52,024 rhesus probe sets and was designed using public data sources including data from the University of Nebraska (R. Norgren), the Baylor School of Medicine’s rhesus macaque whole-genome shotgun assembly (October 1, 2004), and GenBank® STSs, ESTs, and mRNAs up to March 30, 2005. Additionally, probe sets were designed to interrogate rhesus transcripts orthologous to the 3’ end of human transcrips (GeneChip® Human Genome U133 Plus 2.0 Array and RefSeq sequences up to March 2005), sixteen viral sequences from human and other primate species, three different rhesus r(ribosomal)RNAs, and thirteen rhesus mitochondrial genes along with control and reporter sequences. Microarray assays were performed in the Affymetrix Microarray Core of the OHSU Gene Microarray Shared Resource.

Data Analysis with GeneSifter Software

The data was processed with Affymetrix GCOS interface software and compressed into CHP files and uploaded to GeneSifter (VisX Labs, Seattle, WA). The software calculated the mean signal intensity and the standard error of the mean for each treatment group. Probe sets that were undetectable in all treatment groups were eliminated. The remaining probe sets were filtered and those probes sets exhibiting a 2-fold or greater change between the treatment groups were subjected to KEGG analysis. The use of a 2-fold filter was chosen based upon a survey of other microarray studies. Probe sets with robust signal intensities that showed a 2-fold or greater change with E or E+P and that were consistent across multiple representations on the chip were reported. Individuals interested in obtaining the raw data are encouraged to contact the senior author.

Nested Quantitative (q) RT-PCR

A second laser capture pool was made from the 6 animals used for the microarrays, plus an additional 3 animals, yielding 9 laser capture pools (3 animals/treatment group) for qRT-PCR confirmation of 15 pivotal genes which were: RhoA, Rac1, CDC42, ROCK, PIP5k, IRSp53, WASP, WAVE, ARP3, gelsolin, profilin, cofilin, LIMK2, CRIPAK1 and MLCK. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), GUSB and PIAA were measured for reference. GAPDH was used for normalization of the data. Complementary DNA (cDNA) synthesis was performed using Oligo-dT 15 and Random hexamer primer (Invitrogen Life Technologies, Carlsbad, CA) and Superscript III reverse transcriptase (200 U/µg of RNA, Invitrogen Life Technologies) at 42C for 1 hr. cDNA was treated with RNAse H to disintegrate dsDNA. Total RNA (1.4 to 1.8 µg) from each Laser capture pool and from a pool of rhesus tissues was transcribed and stored as cDNA at a concentration of 250 ng/µl. The cDNA (10–20 ng) from each laser capture pool and from the rhesus tissue pool (100ng cDNA) was used in a 50 µl multiplex PCR reaction with Platinum Taq polymerase (Invitrogen Life technology, Carlsbad, CA). Each of the external primer sets (20 µM) was added to the multiplex PCR reaction. Then, 1µl was removed for each of the internal primer sets and the quantitative polymerase chain reaction. qPCR was conducted with Platinum SYBR-Green qPCR Super Mix UDG (Invitrogen Life Technologies). The reaction (final volume 20 µl) contained 1 µl PCR product of external PCR reaction, 10 µM of forward and reverse primers and 1× SYBR-Green ER qPCR mix Invitrogen (11760-500). PCR Mastermix contains a modified Platinum DNA Taq Polymerase, uracil DNA glycosylase (UDG) and SYBR-Green II fluorescent dye, which is specific for double stranded DNA. In addition, 500 nM of ROX was added to control PCR artifacts and to control the baseline of the multiplex reaction. There was a log linear increase in fluorescence detected as the concentration of amplified double stranded product cDNA increased during the reaction. The fluorescence was detected as cycle threshold (Ct) with an ABI 7900 thermal cycler during forty cycles. A standard curve was generated with a pool of RNA from various rhesus tissues and rhesus embryonic stem cells (rhesus standard pool). The PCR product from the multiplex reaction on the rhesus standard pool was diluted to generate a standard curve for each of the internal primer sets. The slope of the curve was used to calculate the relative pg of each transcript in the RNA extracted from the laser captured pools. Then, the ratio of each transcript to GAPDH was calculated.

Validation of Nested PCR

Initially, cold PCR was conducted for all primer sets using cDNA from the rhesus tissue pool to verify that the internal reactions produced one product. To further verify PCR amplification, the product of the internal qPCR reaction was sequenced.

Primer selection

For our genes of interest, the probe set ID was saved as a .txt file. This file was launched to batch query at Affymetrix Netaffix program on the web. This program enabled retrieval of the annotation list of the genes of interest and provides direct access to Genebank sequence at NCBI. Thus, using Netaffix, the oligonucleotide location on each cDNA sequence was identified. Based upon the oligoset distribution, a target area of each gene of interest was selected. The target sequence was then loaded into Primer Express software, which chooses the primers for optimum qRT-PCR. For each gene, two sets of primers were generated; set one was used to generate an external larger PCR product of about 400bp–600bp. The second set was used to amplify internal or nested PCR product of about 250bp–350bp off of the larger product. The primers utilized for qRT-PCR on the RNA extracted from the laser-captured serotonin neurons are shown in Table 1.
Table 1

Sequence of the external and internal primers for nested qRT-PCR on mRNA from laser captured serotonin neurons.

Synaptic Plasticity Primers
NameSequenceTMAmplicon sizeNameSequenceTMAmplicon size
RhoAProfilin
ExtFTGGGGCAGGAAGATTATGATCG65.3436ExtFGGCGCTGCGGTAAGGAG63.05305
ExtRGCAGCTCTCGTAGCCATTTCA62.85ExtRAGCTCTGCCGACAGCAACAT63.44
IntFCCCTCTCCTACCCAGATACCG62.08251IntFCCGCCGCTGGTTAGTCAG62.9251
IntRCCCAAAAAGCACCAATCCTGTT64.37IntRCTCTACCAGCTCTGCCGACAG62.5
Rock2CDC42
ExtFGGTTCGTCATAAGGCATCACA60.09548ExtFACGACCGCTGAGTTATCCACA62.94351
ExtRCCCCCACTAGCATCTCAAAAAG62.1ExtRTTCTTCGGTTCTGGAGGCTC61.81
IntFATGCCTGGTGGAGACCTTGTA61.5298IntFTTTTCAGTGGTCTCTCCATCTTCAT62.4202
IntRAGTAACCATCACCCCCTTGTG61.04IntRGGTCACGGGCCAGCTTTT63.5
MLCKIRSp53
ExtFGCCACGTGAACCTGATCCA63.16551ExtFGGCTTTATCACCAGGATGTCACA63.3463
ExtRCAGCAACCGGGAAACAAAGT62.34ExtRCGGCTTTACCTTGAACTGAGGT61.85
IntFGACCTCAAGCCGGAGAACATATT62.81251IntFTTTGGAAACATCTGTGGACTCTGTT63.2263
IntRTCTGCATCTGTTTCCCCTAGAAAT62.4IntRGGTGCACTCTCCTAGCATGCT61.9
CRIPAKWAVE
ExtFCTCGCTTTGTGCCAATGTG61.431361ExtFTTCAACTCCTCCCCCTCCA62.94456
ExtRCCTCTCCTCTTCCATCTCATCC61.2ExtRTTAGCTTCCTGTTCACGCTGC62.8
IntFTCACACAAAGCCCTGGCAT62.6154IntFACCTGGCATTCGACCATCAT62.6253
IntRCCTACGTTATCTCGAGGTGCAG61.1IntRACGCTGCTCTTCTACTTTGCG62.09
LIMK2WASP
ExtFAGGTGGAGGATGCAATTAGCC62.5356ExtFGACAGAGCAGGCTGGGAGAA63.02463
ExtRCAGGACCTCCCCATGGATTA62.01ExtRTGCTATCAGGCTTTGAGCCC62.6
IntFGTTGATTGAACATGACCCCGT61.9251IntFGGTCTGGGAGGACTGTTCCA62.47208
IntRCAACGAAGGGATTCTGAGCG63.1IntRGGTTCCTCTGAGGCTCTGGG63.56
Cofilin1ARP3
ExtFGAAAAGCGCGCGAGATC63.5451ExtFTGCTAAGGCAGTAAAGGAGCG61.87453
ExtRTGATGGCATCCTTGGAACTG62.02ExtRCGCTGCATGTGGTGTGTAATG63.48
IntFGGTGTGGCTGTCTCTGATGGT62.5259IntFATGATACAGATGGGTCAAAATGGATTA62.7252
IntRGCATCATAGAGGGCGTAGCG63.07IntRTGAACATGGTTGAACCTCCAGA62.7
RAC1GAPDH
ExtFTTGTGGTAGATGGAAAACCGG61.9351ExtFCCCTCCAAAATCGAGTGTGGT60315
ExtRTGTGAGCACCAAACACTCCAG62.3ExtRAGGAAAACTGGCAGTGATGGC60
IntFTGTCCGTGCAAAGTGGTATCC63.1182IntFCTGACACTGAGTACGTCGTGGA57268
IntRTTTTGCAGCACCAATCTCCTT62.03IntRTGGACTGTGGTCATGAGTCCTT58
PIP5PPIA
ExtFTTCAAGCTTTTGAAAGGCCTCAC62.93405ExtFTCGACGGCGAGCCCCT59451
ExtRGCATTGTCATCCTGCACTTCC62.9ExtRGTCCACAGTCAGCAATGGTGAT59
IntFTTCCATCGCCGCCTTAAAAG63.3201IntFTCGTGCTCTGAGCACTGGAG59301
IntRGAAATTGTGGTCGCCAAGGA63.25IntRCATGCCTTCTTTCACTTTGCC58
GelsolinGUSP
ExtFGCCACCCTTCCTCTCCATCT62.8454ExtFTGATCGCTCACACCAAAGCTT59453
ExtRCTGGAAAGGTAGGACAAGCCC62.2ExtRTTTTGGTTGTCTCTGCCGAGT58
IntFTGTGGCTGATGAGAACCCCT63251IntFACTTCGGGCACCTGGAGTT58
IntRCCCGCCAGTTCTTGAAGAACT62.9IntRTCATGAAATCGGCAAATTCC58253

Statistical analysis

The average signal intensities on the microarrays in the E and E+P groups were examined for 2-fold or greater increases or decreases from the ovx-control group (n=2 animals or chips/group). No further statistical test was performed on the signal intensities. The average relative expression of the 3 groups (n=3 animals/group) from the qRT-PCR assay was first compared with ANOVA followed by Student-Newman-Keuls posthoc pairwise comparison. In a few comparisons, the variance within one group hindered the ANOVA analysis. This was not unusual for this type of preparation, and more animals would likely reduce the variance. However, labor and cost were prohibitive. Therefore, a two-tailed t-test was performed in which each treatment group was compared to the ovx-control group. To confirm the variance was significantly different between groups, an F test was performed. Hence, the mean of a treatment group was significantly different from the ovx-control group with Student-Newman-Keul’s or a t-test; or the variance within the treatment group was significantly different from the ovx-control group with an F test. Either result indicates that the groups are different. Comparisons were considered significant when there was greater than a 95% chance that the groups were different (p<0.05). Prism 5.0 from Graph Pad (San Diego, CA) was used for all comparisons.

Results

Expression Changes Related to Dendritic Spines in Laser Captured Serotonin Neurons

Figure 1 illustrates the 2-fold changes in gene expression that were detected on the microarrays. Genes in red increased 2-fold or greater in animals treated with E or E+P. Genes in blue decreased 2-fold or greater in animals treated with E or E+P. There was increase in expression of RhoA, Rac1, and cdc42 in the E or E+P treated animals. Downstream of CDC42, there was an increase in expression of IRSp53, WASP, WAVE and subunits of actin related protein (ARP2/3), which promotes actin enucleation, branching, polymerization and spine head enlargement. Downstream of Rac1, there was an increase in expression of PIP5K and the actin regulatory proteins, cofilin, gelsolin and profilin, which reduce actin dynamics, stabilize actin filaments and thereby stabilize spines. Also downstream of Rac1, there was a decrease in expression of CRIPAK1, LIMK2 and MLCK, which could maintain activation of cofilin. Downstream of RhoA, there was an increase in expression of ROCK2 and MLC, which code for proteins that facilitate actinomysin contractility and spine shortening. MLCK is also known as MYLK. The microarray results were confounding as there were both increases and decreases in probe sets with these acronyms. We show them in red and blue on the figure and performed qRT-PCR for confirmation below. Table 2 contains the average signal intensities for the probe sets corresponding to each of these genes from the duplicate microarray chips in each group. The results of the 6 Affymetrix microarray chips have been submitted to the Gene Expression Omnibus public database and assigned the GEO accession number GSE16169.
Figure 1

Chart illustrating the key Rho GTPases and their downstream effectors for actin and myosin activation leading to dendritic spine protrusion and transformation. RNA extracted from laser captured serotonin neurons was labeled and hybridized to the Rhesus Affymetrix GeneChip (n=2 animals/treatment) and the results were analyzed with GeneSifter. The genes in red increased 2-fold or greater and the genes in blue decreased 2-fold or greater with E or E+P treatment compared to ovariectomized placebo treated controls.

Table 2

Average Signal Intensity of 2 microarray chips per group for selected plasticity probe sets.

OVXEE+P
Probe Sets
Rho A105724361682
Rac (probe set 1)1301570687
Rac (probe set 2)209962423468
cdc42 (probe set 1)187637902682
cdc42 (probe set 2)4611136921
Rock4751110723
CRIPAK365188150
Pak 15272049780
PIP5K1B143390221
IRSp53292831339
WAVE (WASPIP*)5681275881
N-WASP (WASL)83630061619
LIMK286844
MLCK69343447
MYLK5491923730
MLC205778534
Cofilin48722551321
Gelsolin124531821910
Profilin206649323484
ARP2/3 subunit2154799277
ARP2/3 subunit33801366809
ARP2/3 subunit520554268

NWASP/WASL interacting protein

Validation of Expression Changes in Laser Captured Serotonin Neurons

Significant increases in expression of RhoA, Rac1, CDC42, ROCK, PIP5k, IRSp53, WASP, WAVE, cofilin, gelsolin, profilin, and ARP3; and significant decreases in expression of LIMK2, CRIPAK1 and MLCK, were confirmed with nested qRT-PCR and the results are shown in Figures 2–4. In Figures 2 and 3, there were different patterns of increased expression. That is, RhoA, Rac1 and PIP5K increased with E and then returned to placebo levels with supplemental P; whereas CDC42, ROCK2, IRSp53, WASP, ARP3 and cofilin increased with E and remained elevated with supplemental P; and finally WAVE and profilin increased only with E+P. Similarly, MLCK and CRIPAK were decreased with E and E+P whereas LIMK was decreased with E+P only.
Figure 2

Histograms illustrating changes in gene expression obtained with nested qRT-PCR on RNA extracted from laser captured serotonin neurons (n=3 animals/treatment). The Rho GTPases, RhoA, and Rac1 significantly increased with E alone (ANOVA p<0.0002 and 0.00115, respectively) whereas CDC42 increased with E and E+P (ANOVA p<0.05). Downstream effectors ROCK2 increased with E+P (ANOVA p<0.0047) whereas PIP5K and IRSp53 increased with E alone (ANOVA p<0.05 and #t-test p<0.0114, respectively).

The variance in IRSp53 in the E+P treated group was significantly different from the ovx group (F test p<0.0028).

* p<0.05 different from ovx control with Student-Newman-Keuls posthoc pairwise comparison after ANOVA.

Figure 4

Histograms illustrating changes in gene expression obtained with nested qRT-PCR on RNA extracted from laser captured serotonin neurons (n=3 animals/treatment). Downstream of Rac1, MLCK was significantly decreased by E and E+P treatment (ANOVA p<0.0166) whereas LIMK2 was significantly decreased by E+P treatment (#t-test p<0.05; F-test p<0.0001). The endogenous Pak1 inhibitor, CRIPAK, was significantly decreased by E and E+P treatment (ANOVA p<0.0001).

* p<0.05 different from ovx control with Student-Newman-Keuls posthoc pairwise comparison after ANOVA.

Figure 3

Histograms illustrating changes in gene expression obtained with nested qRT-PCR on RNA extracted from laser captured serotonin neurons (n=3 animals/treatment). Intermediaries WAVE and WASP were significantly increased with E treatment, respectively (ANOVA p< 0.0129 and #t-test p<0.0001). The variance in WASP in the E+P treated group was significantly different from the ovx group (F test p<0.0027). The actin regulatory proteins ARP3 and cofilin significantly increased with E and E+P treatment (ANOVA p<0.0329 and p<0.0093, respectively). However, gelsolin and profilin increases only with E+P (ANOVA p<0.0029 and p<0.0001, respectively).

* p<0.05 different from ovx control with Student-Newman-Keuls posthoc pairwise comparison after ANOVA.

Steroid Hormone Verification

The concentration of E and P in a serum sample obtained from each animal at necropsy was obtained to verify the efficacy of the Silastic implants. The concentration of E in the serum of the E and E+P-treated animals was 136.5±15 pg/ml and the concentration of P in the serum of the E+P-treated animals was 8.17±1.15 ng/ml. The concentrations of E and P in the serum of the untreated spayed control animals were 11.0 ± 0.1 pg/ml and 0.16±0.13 ng/ml, respectively (significantly different from treated animals by ANOVA, p <0.01).

Discussion

Dendritic spine extrusion and remodeling is a multi-step process that requires actin reorganization. Actin reorganization is a process of enucleation and branching. Filopodia precede spine formation and glutamate promotes filopodia extensions. When filopodia contact an axon, or glutamatergic buton, they may be transformed into spines. This involves decreased motility, shortening of the neck and growth of the head (2–4). The dynamic organization of the actin cytoskeleton provides the force for filopodia extrusion and spine morphogenesis. It is regulated by small GTPases of the Rho family, in particular RhoA, Rac1 and CDC42. These G-Proteins function as molecular switches in signal transduction pathways by cycling between an active GTP-bound and an inactive GDP-bound state. RhoA controls stress fiber formation and the attachment of contractile bundles of actin and myosin filaments to the cell membrane at points of focal adhesion, where integrin clusters are present. Rac1 and CDC42 signal transduction pathways lead to actin rearrangements in the form of filopodia (microspikes). Rac1 and RhoA bind to and specifically activate their downstream effectors, which are either kinases such as ROCK (Rho-Associated Coiled-Coil-Containing Protein Kinase), PAK (p21-Activated Kinase) and PI5K (Phosphatidylinositol-5-OH Kinase) or scaffolding proteins such as GDIA, WASP (Wiskott-Aldrich syndrome protein) and IRSp53. Constitutively active GDIA lacking Rho-binding domains cooperates with activated ROCK to form stress fibers. PAK activates LIM-kinases (LIMK1 and LIMK2) to phosphorylate cofilins. This allows signals flowing through Rho family GTPases to coordinate the initiation of new filaments through WASP and the ARP2/3 complex. GTP-bound RhoA activates ROCK (Rho-associated kinase), which phosphorylates the myosin-binding subunit of MLCK (Myosin Light Chain Kinase, also known as MYLK), inactivating it and thereby preventing MLC dephosphorylation. As a result, RhoA activation leads to an accumulation of the phosphorylated MLC and, subsequently, to the stimulation of actomyosin ATPase activity. CDC42 and IRSp53 activation of WAVE (WASP-family Verprolin-Homologous Protein), another member of the WASP family, also induces actin alterations in response to upstream signals. In addition, activation of Rac1 can activate PI5K, which stimulates biosynthesis of PIP2 (Phosphatidylinositol-4, 5-Bisphosphate) and leads to promotion of actin assembly from profilin and gelsolin (14–16). We found that E or E+P increased gene expression on the microarray of RhoA, Rac1 and CDC42 and their downstream effectors Pak1, Rock, PIP5K, IrSp53, WASP and WAVE in serotonin neurons. In addition, E or E+P increased gene expression of the actin and myosin regulatory proteins MLC, cofilin, gelsolin, profilin and ARP2/3. MLCK, also known as MYLK, was confounding. Two probe sets increased and three probe sets decreased. We show two probe sets in Table 2, named MLCK and MYLK, but these seem to be the same or similar genes on the microarray. With qRT-PCR primers based upon the decreased probe sets there was a decrease in MLCK expression. Of interest, the decrease in gene expression of CRIPAK and MLCK could act to promote accumulation of phosphorylated MLC and its stimulation of actomyosin ATPase activity. The decrease in gene expression of LIMK2 is puzzling, but it suggests that the Rac/PIP5k/gelsolin:profilin and the CDC42/IRSp53/WASP/WAVE/ARP2/3 pathways may play a more prominent role in dendritic spine proliferation in serotonin neurons. Most of these gene expression changes were confirmed with nested qRT-PCR, which strongly indicates that the microarray reports are accurate. It was noted that some genes responded to E alone, some genes responded similarly to E and E+P and other genes responded to only E+P. These responses indicate that P may have different actions depending on the gene in question. It may reverse the action of E, it may have no effect yielding a similar response in E and E+P treated groups, or it may act solely after E priming. Each of these types of responses has been observed in other systems. However, in order to explain them, a great deal more information is needed such as the steroid receptor response elements in each promoter. It is noteworthy that 31 other guanidine exchange factor (GEF) probe sets were changed 2-fold or greater with E or E+P treatment including Rap GEFs 2,3,6 and 7; Rho rac GEFs 2,7,9, and 17; GEF-T, Kaliren, spectrin and FYVE (CMT4H, RhoGEF and PH containing domain 4). In addition, 36 probe sets with GTPase activating activity (GAPs) were changed 2-fold or greater with E or E+P treatment including RAB GAP1, RAB GAP150, RAB3 GAP, and Rho GAPs 5, 15, 26. These changes in gene expression indicate that E and/or E+P promote dendritic spine proliferation on the dendritic arbor of serotonin neurons. This action would play a central role in governing the excitatory input to the serotonin neurons. Dendritic spines express excitatory glutamate receptors, both ionotroic and metabotropic, and the maintenance of a spine requires continuous glutamate signals from afferent neurons (3, 4). Indeed, AMPA receptors can promote spine formation, transformation, stabilization and maintenance. Moreover, inhibition of synaptic transmission in hippocampal slices causes spine loss and atrophy (17, 18). The ability of E to induce spine proliferation is well documented in the hippocampus (19, 20), hypothalamus (21), cerebellum (22) and cortex (23, 24) so the responses of the serotonin neurons to ovarian hormones may be a general phenomena. However, analysis of gene expression upstream of actin reorganization was lacking in any area. Nonetheless, it is now necessary to demonstrate that the changes observed in gene expression translate to protein expression and spine proliferation on serotonin neurons. The ability of estrogen to increase dendritic spines in the hippocampus involves NMDA receptor activity (19) and CREB activation (25). Additional work has shown that estrogen and NMDA receptor activation increase dendritic spine number in the developing hypothalamus, which is dependent on an increase in presynaptic glutamate release. In turn, the estrogen-enhanced glutamate release occurs via a nongenomic mechanism and activation of PI3 kinase (21). In light of these reports, it is important to speculate whether changes in genes related to dendritic spine proliferation in serotonin neurons are due to a direct action of E or P via nuclear steroid receptors or, are due to an indirect action via increased glutamate release, or both. We have shown that serotonin neurons express ERβ and PR (7, 8, 26), and these receptors are gene transcription factors. Thus, it is reasonable to think that the regulation of gene expression is due to the activity of these transcription factors perhaps causing an increase in filopodia. Nonetheless, an increase in extracellular glutamate may also play a pivotal role and contribute to the transformation of filopodia to mature spines. One would predict glutamate to increase with E or E+P, but as noted above, the gene expression patterns varied. For example, E treatment likely increased glutamate, but some genes increased and others did not. Likewise, glutamate may be increased with supplemental P treatment, however some genes increased, others were equivalent with E treatment, and others were suppressed. It will be hard to test this notion in whole monkeys, or even monkey raphe slices, but with our development of embryonic stem cell-derived serotonin neurons in culture (27), we may begin to unravel the mechanisms involved.

Summary

Altogether, the data indicate that administration of ovarian steroids to ovariectomized monkeys for 1 month alters gene expression in serotonin neurons in a manner that would promote dendritic spine protrusion and an increase in excitatory synapses. This action would enhance serotonin neurotransmission and in turn, improve mood and decrease anxiety.
  27 in total

1.  Glutamate receptors regulate actin-based plasticity in dendritic spines.

Authors:  M Fischer; S Kaech; U Wagner; H Brinkhaus; A Matus
Journal:  Nat Neurosci       Date:  2000-09       Impact factor: 24.884

2.  Rapid enhancement of two-step wiring plasticity by estrogen and NMDA receptor activity.

Authors:  Deepak P Srivastava; Kevin M Woolfrey; Kevin Woolfrey; Kelly A Jones; Cassandra Y Shum; L Leanne Lash; Geoffrey T Swanson; Peter Penzes
Journal:  Proc Natl Acad Sci U S A       Date:  2008-09-18       Impact factor: 11.205

Review 3.  Diverse actions of ovarian steroids in the serotonin neural system.

Authors:  Cynthia L Bethea; Nick Z Lu; Chrisana Gundlah; John M Streicher
Journal:  Front Neuroendocrinol       Date:  2002-01       Impact factor: 8.606

Review 4.  Enhancing neuronal plasticity and cellular resilience to develop novel, improved therapeutics for difficult-to-treat depression.

Authors:  Husseini K Manji; Jorge A Quiroz; Jonathan Sporn; Jennifer L Payne; Kirk Denicoff; Neil A Gray; Carlos A Zarate; Dennis S Charney
Journal:  Biol Psychiatry       Date:  2003-04-15       Impact factor: 13.382

5.  Estrogen receptor beta (ERbeta) mRNA and protein in serotonin neurons of macaques.

Authors:  C Gundlah; N Z Lu; S J Mirkes; C L Bethea
Journal:  Brain Res Mol Brain Res       Date:  2001-07-13

6.  Ovarian steroid regulation of serotonin reuptake transporter (SERT) binding, distribution, and function in female macaques.

Authors:  N Z Lu; A J Eshleman; A Janowsky; C L Bethea
Journal:  Mol Psychiatry       Date:  2003-03       Impact factor: 15.992

7.  Estrogen increases the number of spinophilin-immunoreactive spines in the hippocampus of young and aged female rhesus monkeys.

Authors:  Jiandong Hao; William G M Janssen; Yong Tang; Jeffrey A Roberts; Heather McKay; Bill Lasley; Patrick B Allen; Paul Greengard; Peter R Rapp; Jeffrey H Kordower; Patrick R Hof; John H Morrison
Journal:  J Comp Neurol       Date:  2003-10-27       Impact factor: 3.215

8.  Ovarian steroid regulation of 5-HT1A receptor binding and G protein activation in female monkeys.

Authors:  Nick Z Lu; Cynthia L Bethea
Journal:  Neuropsychopharmacology       Date:  2002-07       Impact factor: 7.853

Review 9.  Cell motility: can Rho GTPases and microtubules point the way?

Authors:  T Wittmann; C M Waterman-Storer
Journal:  J Cell Sci       Date:  2001-11       Impact factor: 5.285

Review 10.  The Rho GTPase family: a Racs to Wrchs story.

Authors:  Matthew Wherlock; Harry Mellor
Journal:  J Cell Sci       Date:  2002-01-15       Impact factor: 5.285

View more
  16 in total

Review 1.  Sex differences and stress across the lifespan.

Authors:  Tracy L Bale; C Neill Epperson
Journal:  Nat Neurosci       Date:  2015-09-25       Impact factor: 24.884

2.  Localization and regulation of reproductive steroid receptors in the raphe serotonin system of male macaques.

Authors:  Cynthia L Bethea; Kenny Phu; Yelena Belikova; Sarah C Bethea
Journal:  J Chem Neuroanat       Date:  2015-04-20       Impact factor: 3.052

3.  Ovarian steroids increase spinogenetic proteins in the macaque dorsal raphe.

Authors:  H M Rivera; C L Bethea
Journal:  Neuroscience       Date:  2012-02-08       Impact factor: 3.590

4.  Ovarian steroids increase PSD-95 expression and dendritic spines in the dorsal raphe of ovariectomized macaques.

Authors:  Heidi M Rivera; Cynthia L Bethea
Journal:  Synapse       Date:  2013-09-12       Impact factor: 2.562

5.  Relationships between androgens, serotonin gene expression and innervation in male macaques.

Authors:  C L Bethea; K Coleman; K Phu; A P Reddy; A Phu
Journal:  Neuroscience       Date:  2014-06-05       Impact factor: 3.590

6.  Ovarian steroid regulation of the midbrain corticotropin releasing factor and urocortin systems in macaques.

Authors:  R L Sanchez; A P Reddy; C L Bethea
Journal:  Neuroscience       Date:  2010-09-15       Impact factor: 3.590

7.  Ovarian steroids increase glutamatergic related gene expression in serotonin neurons of macaques.

Authors:  Cynthia L Bethea; Arubala P Reddy
Journal:  Mol Cell Neurosci       Date:  2011-11-30       Impact factor: 4.314

8.  Ovarian steroids regulate gene expression in the dorsal raphe of old female macaques.

Authors:  Cynthia L Bethea; Steven G Kohama; Arubala P Reddy; Henryk F Urbanski
Journal:  Neurobiol Aging       Date:  2015-10-19       Impact factor: 4.673

9.  The effect of long-term ovariectomy on midbrain stress systems in free ranging macaques.

Authors:  Cynthia L Bethea; Arubala P Reddy
Journal:  Brain Res       Date:  2012-10-01       Impact factor: 3.252

Review 10.  How Studies of the Serotonin System in Macaque Models of Menopause Relate to Alzheimer's Disease1.

Authors:  Cynthia L Bethea; Arubala P Reddy; Fernanda Lima Christian
Journal:  J Alzheimers Dis       Date:  2017       Impact factor: 4.472

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.