| Literature DB >> 19642988 |
Lisset Herrera-Isidrón1, Juan Carlos Ochoa-Sánchez, Rafael Rivera-Bustamante, Juan Pablo Martínez-Soriano.
Abstract
The molecular characterization of isolates of citrus tristeza virus (<span class="Species">CTV) from eight locations in Mexico was undertaken by analyzing five regions located at the opposite ends of the virus genome. Two regions have been previously used to study CTV variability (coat protein and p23), while the other three correspond to other genomic segments (p349-B, p349-C and p13). Our comparative nucleotide analyses included CTV sequences from different geographical origins already deposited in the GenBank databases. The largest nucleotide differences were located in two fragments located at the 5' end of the genome (p349-B and p349-C). Phylogenetic analyses on those five regions showed that the degree of nucleotide divergence among strains tended to correlate with their pathogenicity. Two main groups were defined: mild, with almost no noticeable effects on the indicator plants and severe, with drastic symptoms. Mild isolates clustered together in every analyzed ORF sharing a genetic distance below 0.022, in contrast with the severe isolates, which showed a more disperse distribution and a genetic distance of 0.276. Analyses of the p349-B and p349-C regions evidenced two lineages within the severe group: severe common subgroup (most of severe isolates) and severe divergent subgroup (T36-like isolates). This study represents the first attempt to analyze the genetic variability of CTV in Mexico by constructing phylogenetic trees based on new genomic regions that use group-specific nucleotide and amino acid sequences. These results may be useful to implement specific assays for strain discrimination. Moreover, it would be an excellent reference for the CTV situation in México to face the recent arrival of brown citrus aphid.Entities:
Mesh:
Year: 2009 PMID: 19642988 PMCID: PMC2731079 DOI: 10.1186/1743-422X-6-116
Source DB: PubMed Journal: Virol J ISSN: 1743-422X Impact factor: 4.099
Figure 1Unrooted phylogenetic trees of the genomic regions p349-B/C (A), CP (B), p13 (C) and p23 (D) for 14 CTV isolates. The virus isolates that fell in separated groups are shaded and labeled with the group name (MG, mild group; SG, severe group). Trees were constructed by neighbor-joining method using nucleotide sequences aligned with Clustal × program and 1,000 bootstrap replications. Only the values over 400 are shown. The scale bar represents the number of nucleotide replacements per site: 0.01.
Average number of nucleotide distance between CTV isolate groups in different genomic regions.
| CTV region | CTV group | Da |
| P349-B | Mild | 0.008 ± 0.002 |
| Severe | 0.233 ± 0.014 | |
| All | 0.143 ± 0.009 | |
| P349-C | Mild | 0.008 ± 0.002 |
| Severe | 0.278 ± 0.013 | |
| All | 0.170 ± 0.012 | |
| CP | Mild | 0.003 ± 0.001 |
| Severe | 0.066 ± 0.007 | |
| All | 0.054 ± 0.006 | |
| P13 | Mild | 0.002 ± 0.001 |
| Severe | 0.094 ± 0.011 | |
| All | 0.068 ± 0.008 | |
| P23 | Mild | 0.022 ± 0.003 |
| Severe | 0.086 ± 0.008 | |
| All | 0.078 ± 0.007 |
aD, nucleotide diversity (average number of nucleotide substitution per site between pair of sequence).
Within- and between-groups nucleotide diversities for the region spanning the last 400 nucleotides of p349-B region
| Mild | Severe common | Severe divergent | |
| Mild | 0.013 ± 0.003 | 0.136 ± 0.0014 | 0.633 ± 0.066 |
| Severe common | 0.099 ± 0.011 | 0.584 ± 0.06 | |
| Severe divergent | 0.118 ± 0.016 |
Nucleotide variation observed in CTV isolatesa
| P349-B nuc. at position: | ||||||||||||||||
| 81 | 87 | 117 | 177 | 186 | 222 | 258 | 392 | 518 | 638 | 642 | ||||||
| M | T | G | G | G | G | A | G | G | A | T | T | G | A | C | G | A |
| FSC | G | C | T | T | A | G | T | A | G | C | G | A | C | T | A | T |
| T36 | C | T | C | |||||||||||||
| P349-B nuc. at position: | p349-C nuc. at position: | |||||||||||||||
| 700 | 725 | 733 | 31 | 121 | 149 | 156 | 169 | |||||||||
| M | G | G | A | G | C | C | G | A | C | T | A | A | C | A | G | |
| SC | A | A | G | A | T | T | A | G | T | G | S | B | W | K | A | |
| T36 | T | T | G | T | T | G | ||||||||||
| P349-C nuc. at position: | ||||||||||||||||
| 311 | 313 | 355 | 356 | 425 | 557 | 678 | ||||||||||
| M | G | C | T | C | C | T | T | A | T | T | A | A | A | A | T | G |
| SC | T | T | M | R | R | V | S | S | R | S | G | Y | G | G | C | A |
| T36 | G | G | A | C | C | C | A | G | C | |||||||
| p349-C nuc. at position: | CP nuc. at position: | |||||||||||||||
| 797 | 854 | 962 | 1025 | 255 | 336 | 360 | 396 | 435 | 522 | 606 | ||||||
| M | G | A | C | T | A | C | A | C | A | A | T | T | A | |||
| SC | A | G | K | C | G | T | G | W | T | T | C | C | G | |||
| T36 | T | T | ||||||||||||||
| P13 nuc. at position: | P23 nuc. at position: | |||||||||||||||
| 45 | 48 | 114 | 135 | 190 | 192 | 222 | 301 | 70 | 86 | 87 | 117 | |||||
| M | A | A | G | A | T | T | G | C | T | C | A | A | A | A | T | |
| SC | G | G | A | G | A | C | A | T | G | A | G | C | G | T | R | |
| T36 | G | |||||||||||||||
| P23 nuc. at position: | ||||||||||||||||
| 138 | 145 | 150 | 228 | 235 | 237 | 300 | 382 | 459 | ||||||||
| M | T | C | G | C | C | C | G | A | T | A | ||||||
| SC | C | T | A | T | T | G | A | T | A | G | ||||||
| T36 | ||||||||||||||||
a Nucleotide (nuc.) differences in five CTV genomic region among mild isolates (M), severe common isolates (SC) and T36 isolate. Nucleotide positions which resulted in amino acid residue changes are underlined. Only differences between T36 and SC are indicated for T36. S: C or G; M: A or C; B: C or G or T; W: A or T; K: G or T; R: A or G; V: A or C or G; Y: C or T.
Amino acid variation observed in CTV isolatesa.
| p349-B aa at position: | ||||||||||||||
| 9 | 19 | 165 | 214 | 228 | 230 | 246 | 250 | 254 | 259 | 284 | 290 | 291 | 51 | |
| M | L | R | S | A | Q | S | M | G | P | P | R | T | T | T |
| SC | V | P | HNV | T | RG | NI | V | N | SR | S | HW | A | AV | VIMN |
| T36 | N | N | A | D | K | S | H | K | V | V | ||||
| p349-B aa at position: | ||||||||||||||
| 84 | 103 | 119 | 142 | 143 | 169 | 173 | 186 | 205 | 221 | 222 | 233 | |||
| M | R | W | L | F | H | R | S | N | S | K | T | S | ||
| SC | K | YSR | SND | VL | RT | GK | AT | D | RCH | GE | AE | P | ||
| T36 | H | T | L | P | E | N | H | N | A | |||||
| p349-C aa at position: | CP aa at position: | P13 aa at position: | P23 aa at position: | |||||||||||
| 243 | 249 | 277 | 124 | 11 | 81 | 29 | 125 | |||||||
| M | G | G | E | Y | I | S | K | E | ||||||
| SC | KR | S | VA | F | VXM | A | S | D | ||||||
| T36 | R | D | M | |||||||||||
a Predicted amino acid (aa) differences in five CTV genomic region among mild isolates (M), severe common isolates (SC) and T36 isolate. Only differences between T36 and SC are indicated for T36.
Origin and biological characterization of eight Mexican CTV isolates.
| CTV Isolates | Locality (State) | Date sampling | ML/CM | G, ML or SwO/SO | ||
| VC | SP | D | P | |||
| Mx-Yuc | Ticul (Yucatán) | 2000 | 1 | N | 0 | 0 |
| Mx-QR | Chetumal (Quintana Roo) | 2000 | 1 | 1 | 0 | N |
| Mx-Ver | Martínez de la Torre (Veracruz) | 1986 | 1 | 1 | 0 | 0 |
| Mx-Mich | Apatzingán (Michoacán) | 1990 | 2 | 1 | 0 | 0 |
| Mx-NL | Montemorelos (Nuevo León) | 1994 | 2 | 1 | 0 | 0 |
| Mx-Col | Tecomán (Colima) | 1997 | 2 | 1 | 0 | 0 |
| Mx-BC | Mexicali (Baja California Norte) | 1997 | 3 | 2 | 0 | 0 |
| Mx-Tam | Güemez (Tamaulipas) | 1983 | 3 | 3 | 2 | 3 |
aIndicator species: ML, Mexican lime (Citrus aurantiifolia); CV; CM, Citrus macrophylla; SO, sour orange (Citrus aurantium); G, grapefruit (Citrus Paradisi); Sw, sweet orange (Citrus sinensis). bVC, vein clearing and SP, stem pitting, D, decline; P, pinholing or honeycombing of the inner surface of the bark. cSymptom intensity is scored from 1 to 3 with 1 being mild, 2 moderate and 3 severe.
Primers utilized in RT-PCR
| Primer | Genomic region | Nucleotide sequence (5' → 3') | Primer localization (nt)a | Size of product (pb) |
| IRA 9 | P349-Bc | 5'TTGGTTGGTGGTGAGTCTGC3' | 1555–1574 | 876 |
| IRA 10 | 5'GTGCCACTCGGAAAACTGAAAT3' | 2414–2435 | ||
| IRA 11 | P349- Cc | 5'TGAGCAGATCGGAGGTCTTG3' | 6921–6940 | 1050 |
| IRA 12 | 5'ACGTCATCGTCCAAATCCA3' | 7952–7970 | ||
| IRA 1 | CP | 5'ATGGACGACGAAACAAAGAAATTG3' | 16116–16139 | 672 |
| IRA 2 | 5'GC TCAACGTGTGTTAA3' | 16774–16787 | ||
| IRA 5 | P13 | 5'GACTTAGACACGAAGTGACC3' | 17250–17269 | 360 |
| IRA 6 | 5'CTAAAGTAAGCTCGCATATTG3' | 17721–17741 | ||
| IRA 7 | P23 | 5'CGTGTAGGTTAATACGCTTCTC3' | 18267–18288 | 630 |
| IRA 8 | 5'CTTATTCCGTCCACTTCAATCAG3' | 18982–19004 |
a numbering according to full-length of CTV isolate T385.
b + forward primer; - reverse primer
c B and C are the regions of the ORF p349 that were analyzed in this job.