Literature DB >> 19623263

Rapid and high-throughput pan-Orthopoxvirus detection and identification using PCR and mass spectrometry.

Mark W Eshoo1, Chris A Whitehouse, Aysegul Nalca, Scott Zoll, Joseph A Ecker, Thomas A Hall, Thuy-Trang D Pennella, David D Duncan, Anjali Desai, Emily K Moradi, Karl Rudnick, Brian Libby, Raymond Ranken, Rangarajan Sampath, Steven A Hofstadler, David J Ecker, Lawrence B Blyn.   

Abstract

The genus Orthopoxvirus contains several species of related viruses, including the causative agent of smallpox (Variola virus). In addition to smallpox, several other members of the genus are capable of causing human infection, including monkeypox, cowpox, and other zoonotic rodent-borne poxviruses. Therefore, a single assay that can accurately identify all orthopoxviruses could provide a valuable tool for rapid broad orthopovirus identification. We have developed a pan-Orthopoxvirus assay for identification of all members of the genus based on four PCR reactions targeting Orthopoxvirus DNA and RNA helicase and polymerase genes. The amplicons are detected using electrospray ionization-mass spectrometry (PCR/ESI-MS) on the Ibis T5000 system. We demonstrate that the assay can detect and identify a diverse collection of orthopoxviruses, provide sub-species information and characterize viruses from the blood of rabbitpox infected rabbits. The assay is sensitive at the stochastic limit of PCR and detected virus in blood containing approximately six plaque-forming units per milliliter from a rabbitpox virus-infected rabbit.

Entities:  

Mesh:

Substances:

Year:  2009        PMID: 19623263      PMCID: PMC2710004          DOI: 10.1371/journal.pone.0006342

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The orthopoxviruses (family Poxviridae, genus Orthopoxvirus) are a diverse group of large, enveloped viruses that contain a covalently closed, double-stranded DNA genome of approximately 200 kbp [1]. The genus is comprised of at least 10 recognized species. Several viruses within this group are significant human pathogens, including Variola virus (the causative agent of smallpox), monkeypox virus, cowpox virus, and Vaccinia virus. Other members, including raccoonpox, camelpox, ectromelia (mousepox), taterapox, and volepox viruses have only been isolated from their respective mammalian hosts. Although many orthopoxviruses specifically infect certain animal hosts, others (e.g., monkeypox and cowpox viruses) can also infect humans and are considered zoonotic pathogens. In humans, symptoms of orthopoxvirus infections range from mild skin lesions to fatal systemic disease. For example, smallpox produced a generalized rash that progressed from the papular to vesicular to pustular stages and resulted in a greater than 30% mortality rate in unvaccinated persons [2]. Although naturally-occurring smallpox was eradicated nearly three decades ago [3], official stocks of the virus still remain in two locations, one at the U.S. Centers for Disease Control and Prevention in Atlanta, GA and the other at the State Research Center of Virology and Biotechnology, Novosibirsk, Russia. This, in addition to waning immunity against smallpox within the human population, has led to concerns that Variola virus might be used as a bioweapon [4]. Monkeypox virus causes a disease similar to smallpox in humans, but results in a lower fatality rate [5]. Monkeypox virus is primarily transmitted to humans through direct contact with infected animals, generally various species of rodents or squirrels in the rain forests of central Africa. However, additional attention was brought to bear on this virus when, in the spring of 2003, it emerged for the first time in the Western Hemisphere and caused a cluster of cases in the U.S. Midwest [6]. Vaccinia virus is famous for being the vaccine that was used to eradicate smallpox. It was also the first animal virus to be purified and chemically analyzed and was the first to be genetically engineered [7]. Despite its notoriety, however, its origin and natural history remain obscure. Recent evidence suggests that Vaccinia virus and horsepox virus are very similar phylogenetically and share a relatively recent common ancestor [8]. Vaccinia virus is often confused with cowpox virus; although it is now well established that they are distinct virus species [9]. In fact, cowpox virus is considered a zoonotic pathogen and is seen in a broad range of host species, most notable wild rodents, but rarely in cattle, as its name would imply. Interestingly, wild and domestic cats and elephants appear to be highly susceptible to infection with cowpox virus [9]. Numerous recent studies have uncovered several novel vaccinia-like viruses that have caused zoonotic outbreaks in Brazil [10], [11], [12], [13], [14], [15], [16]. It is likely that as various ecological niches are examined further, even more species of Orthopoxvirus will be identified. Several genus-specific assays have been described for the detecting and discriminating various Orthopoxvirus members that require conventional PCR followed by restriction endonuclease digestion and subsequent gel electrophoresis [17], [18]. More recently, several real-time LightCycler-based PCR assays have been developed for pan-Orthopoxvirus or specific orthopoxvirus species detection [19], [20], [21]. For these assays, differentiation of the various orthopoxvirus species requires the use of different TaqMan probes in separate reactions or melt-curve analysis of hybridization probes. Here, we describe a rapid, high-throughput, multi-locus method for identifying orthopoxviruses based on PCR amplification followed by electrospray ionization mass spectrometry (PCR/ESI-MS) performed on the Ibis T5000 instrument [22], [23], [24], [25]. This technology has been applied to detection and identification of other viral pathogens, including alphaviruses [26], influenza viruses [27], adenovirus [28], and coronaviruses [29]. The assay described here is extremely sensitive and able to detect and identify each species from a diverse collection of orthopoxviruses.

Results

Orthopoxvirus PCR primer pairs

The genus Orthopoxvirus consists of least 10 species. The goal of this work was to develop a simple assay that would allow the detection of all of the diverse members of this group of viruses. Several sets of primers were evaluated for their analytical sensitivity, pan-Orthpoxvirus coverage and performance under uniform PCR conditions. Four primer pairs were chosen for use in the final assay format (Table 1). Several of the primers have non-homologous nucleotides at their 5′ ends to raise the temperature of melting (Tm) of the primers after the first round of amplification as orthopoxviruses have a low GC genome. Primer Pair VIR982 exhibited the greatest analytical sensitivity of the four primers in the assay. Figure 1 shows the alignment of this primer pair against the known sequences of several diverse orthopoxviruses. For each primer region, a database of expected base compositions (A, G, C, and T base counts) from all known orthopoxvirus sequences in GenBank was generated (data not shown) and used in the identification and classification of the test isolates.
Table 1

PCR primers used in this study.

Primer pair IDPrimer codeGene targetPrimer sequence (5′-3′)3′ nt position*
VIR982VIR2545FDNA polymerase TCGGTGACGATACTACGGACGC 46717
VIR2546R TCCTCCCTCCCATCTTTACGAATTACTTTAC 46645
VIR985VIR2550FRNA helicase TGGAAAGTATCTCCTCCATCACTAGGAAAACC 58378
VIR2551R TCCCTCCCTCCCTATAACATTCAAAGCTTATTG 58426
VIR979VIR2539FDNA helicase TGATTTCGTAGAAGTTGAACCGGGATCA 117490
VIR2540R TCGCGATTTTATTATCGGTCGTTGTTAATGT 117560
VIR988VIR2556FRNA polymerase TCCTCCTCGCGATAATAGATAGTGCTAAACG 123174
VIR2557R TGTGTTCAGCTTCCACCAGGTCATTAA 123216

Position of 3′ nucleotide against reference genome: Variola major, Syria 1972, DQ437592.

Figure 1

Alignment of Orthopoxvirus sequences showing conservation of PCR primer VIR982 within this viral family, flanking a region of species-specific variations.

“Dots” in a column represent homology to the reference sequence above. The primer 5 prime sequence shows the addition of non-homlogous nucleotides to increase the Tm of the primers after the first PCR cycles.

Alignment of Orthopoxvirus sequences showing conservation of PCR primer VIR982 within this viral family, flanking a region of species-specific variations.

“Dots” in a column represent homology to the reference sequence above. The primer 5 prime sequence shows the addition of non-homlogous nucleotides to increase the Tm of the primers after the first PCR cycles. Position of 3′ nucleotide against reference genome: Variola major, Syria 1972, DQ437592. Based upon the predicted and experimentally determined amplicons, these primers effectively resolve all known Orthopoxvirus species from one another. All experimentally determined base-count signatures were found to agree with bioinformatically predicted signatures based upon published genomic sequences.

Detection of diverse orthopoxvirus isolates

As shown in Figure 2, all of the four primer pairs produce amplicon that can distinguish Variola virus from any other orthopoxvirus. Primer pair VIR979 could resolve Variola major virus from Variola minor virus and camelpox strain CMS from strain M-96. Primer pairs VIR982, VIR985 and VIR988 could resolve the two strains of monkeypox tested: VR-267 and Zaire-96-1-16. All of the vaccinia isolates tested including rabbitpox and horsepox, which are sub-species of vaccinia, have a common base count signature for primer pair VIR9888 ( 34A, 16G, 19C, 30T). Vaccinia, Copenhagen strain and horsepox (gi|111184167) can be distinguished from each other and other vaccinia isolates based upon their unique base-count signatures for primers pairs VIR985 and VIR979.
Figure 2

Base compositions of the PCR amplicons generated using primer pairs VIR982, VIR985, VIR979, and VIR988.

Within each column, identical base compositions for different isolates for a particular primer pair are shown grouped by the same color. DNP (did not prime) indicates that a PCR amplicon was not generated using the specified primer pair and viral DNA. The numbers in the columns under the primer pair ID indicates the numbers of each base (A, G, C, and T) in the PCR amplicons generated from the target virus. Signature source indicates whether the base composition signatures were determined from sequence or experimentally using viral genomic DNA.

Base compositions of the PCR amplicons generated using primer pairs VIR982, VIR985, VIR979, and VIR988.

Within each column, identical base compositions for different isolates for a particular primer pair are shown grouped by the same color. DNP (did not prime) indicates that a PCR amplicon was not generated using the specified primer pair and viral DNA. The numbers in the columns under the primer pair ID indicates the numbers of each base (A, G, C, and T) in the PCR amplicons generated from the target virus. Signature source indicates whether the base composition signatures were determined from sequence or experimentally using viral genomic DNA. In addition to providing sub-species resolution, the use of four PCR primers in the assay enabled the detection and identification of an orthopoxvirus at the stochastic limit of PCR: 4–8 copies/PCR reaction. For example if only 4–8 genomes/PCR are used in the assay there is a very high probability that at least one of the four primers would detect the virus and provide information sufficient for its identification. The assay is specific to Orthopoxvirus. Nucleic acid extracts from the blood of non-infected rabbits (N = 4) and humans (20 ng and 500 ng/PCR reaction) failed to produce an amplicon other than the internal positive controls. As expected, swinepox, a suipoxvirus (ATCC VR-363), in the family Poxviridae failed produce an amplicon other than the internal positive controls using the assay. We further tested a panel of DNA viruses in the assay to further define specificity including HSV1, adenovirus types 1, 5, 8, 4, 7A, varicella zoster virus (VZV), HPV16 & 18, human parvo virus B19, BK virus and JC virus. None of these viruses cross-reacted using the assay.

Analytical sensitivity and detection of virus in biological samples

To test the analytical sensitivity of the assay for Variola virus we performed a dilution to extinction using the Variola virus derived calibrant. The calibrant was quantified by OD260 and diluted down to determine the limit of detection by the assay. The calibrant is present in every PCR reaction at 100 copies. Blood extract from rabbitpox-infected rabbits was taken six days after exposure to aerosolized rabbitpox virus. The first blood sample evaluated (sample ID: 3E-day 6) was found to have 4×103 plaque forming units (PFU) per mL of blood as determined by a plaque assay on Vero cells. DNA extract from this sample was analyzed by real-time PCR and found to contain 4×106 genomes/mL of blood, assuming 100% extraction efficiency. Blood taken on the 6th day post infection from a second infected rabbit (sample ID: 3D-day6) had 3.3×102 PFU/mL blood and 2.5×105 genomes/mL blood. The most sensitive primer pair, VIR985, detected eight genomic copies of rabbitpox genome isolated from infected rabbit blood with 100% efficiency in 10 out 10 PCR replicates, which is near or at the stochastic limits of PCR detection. The viral PFU in this blood samples was determined prior to DNA extraction and the diluted DNA extract would equate to less than 2 PFU/mL of blood. The three additional primer pairs are sensitive to 30 genomes per PCR reaction, which corresponds to a detection of 6.3 PFU/mL of blood, with 100% detection in 10 out 10 PCR replicates and provide added sub-species information and redundancy to the assay (Figure 3).
Figure 3

Analytical sensitivity of PCR primer pairs VIR982, VIR985, VIR979, and VIR988 in amplification of an extract from rabbitpox-infected rabbit blood (sample ID; 3E-day 6).

Ten replicate detections were performed for each dilution and a score of 100% indicates that viral-derived amplicon was detected in each of ten replicates.

Analytical sensitivity of PCR primer pairs VIR982, VIR985, VIR979, and VIR988 in amplification of an extract from rabbitpox-infected rabbit blood (sample ID; 3E-day 6).

Ten replicate detections were performed for each dilution and a score of 100% indicates that viral-derived amplicon was detected in each of ten replicates.

Discussion

Today, orthopoxviruses are principally rare zoonotic pathogens, but historically Variola was a devastating human pathogen [30]. Though Variola virus has been eradicated there is still the potential for its reintroduction into the human population through an act of bioterrorism. It is also possible that a zoonotic orthopoxvirus could emerge as a variola-like virus of humans or be used as a bioterrorist agent. A single assay that can detect and identify all orthopoxviruses is critical for effective surveillance. Though several methods exist for the detection and surveillance of orthopoxvirus, these assays are limited in their coverage or require large numbers of reactions to identify all Orthopoxvirus species. In this study, we describe an assay using four PCR primer pairs that can identify and distinguish all orthopox species and can provide subspecies level of identification of several important orthopoxviruses. Our primers target the highly conserved core viral DNA and RNA polymerase and helicase genes and thus it is very likely that novel orthopox viruses will also be detected using this strategy. In this study we tested the assay on a diverse panel of orthopoxviruses and also tested detection of rabbitpox from infected rabbits. Rabbitpox is a vaccinia virus but does not infect humans and therefore is an ideal model for studying human smallpox [31]. There was a 1,000-fold difference between PFU and genome levels from the blood samples studied; this also was true for several samples from different animals and probably represents a high level of non-viable or replicating virus in the blood. Similarly high genome to PFU ratios was observed for other viruses [32]. Overall we demonstrated that the pan-Orthopoxvirus assay can detect a wide and diverse range of orthopoxvirus and can be used to accurately speciate orthopoxvirus. The assay is simple and can be performed using premade PCR plates that contain all reaction components except genome. After extraction, the samples can be processed from PCR through analysis and reporting in five hours. Using the described assay, a single 96 well PCR plate can be used to analyze 24 samples and the system can process 16 plates in a 24 hour period for a total throughput of 384 samples per day on a single instrument. Such throughput is essential for surveillance and in times of an epidemic outbreak or acts of bioterrorism.

Materials and Methods

Viral isolates and DNA extraction

The viral strains used in this study were provided by the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID), the American type culture collection (ATCC), or the Biodefense and Emerging Infections Research Resources Repository (BEI Resources) and are listed in Table 2. Samples from BEI resources were supplied as DNA extracts. DNA from viral isolates from USAMRIID and ATCC were extracted using the QiaAmp MinElute Virus spin kit (Third Edition, February 2007 version) according to the manufacturers recommended procedure (Qiagen Inc, Valencia, CA).
Table 2

Orthopoxvirus species/strains used in this study.

Virus speciesStrainYear of isolationOriginSource
Camelpox virus 9031978SomaliaUSAMRIID
Cowpox virus Brighton Red1938Great BritainBEI NR-2641
Ectromelia virus Moscow??ATCC; VR-1374
Monkeypox virus VR-2671962West AfricaUSAMRIID
Zaire-96-I-161996Zaire, AfricaUSAMRIID
Rabbitpox virus Utrecht1941HollandATCC; VR-157
Raccoonpox virus Herman1964Maryland, USAATCC; VR-838
Vaccinia virus Western Reserve1941Cleveland, Ohio, USABEI NR-2640
R1352??USAMRIID
Copenhagen?DenmarkUSAMRIID
Ankara1954Ankara, TurkeyUSAMRIID
RPmuhr23HA+1993Florida, USAATCC; VR-2379
Vtk-79??ATCC; VR-2031
A5??USAMRIID
Modified Vaccinia Ankara (MVA)1971Munich, GermanyBEI NR-2634
Lister1892Elsetree, LondonBEI NR-2635
IHD1954New York City Department of HealthBEI NR-2636
Lederle??BEI NR-2637
NYCBH1856EnglandBEI NR-2638

Rabbitpox virus-infected rabbits

Viral extracts from rabbitpox virus-infected rabbits were obtained from USAMRIID. Rabbits were bled every other day after challenge with aerosolized rabbitpox virus. Blood was collected into EDTA tubes and 100 µL of blood was used to isolate viral DNA with the BioRobot M48 (Qiagen) using the QIAamp blood kit (Qiagen version February 2003) in accordance with manufacturer's instructions. Real-time PCR was carried out with the LightCycler (Roche, Indianapolis, IN) using a pan-Orthopoxvirus assay as previously described [20]. Briefly, the oligonucleotide primers and a minor groove binder (MGB) protein-containing TaqMan probe were designed to hybridize to conserved regions of the orthopoxvirus hemagglutinin (HA) gene; sequences have been published elsewhere [20]. Reactions were performed on a Roche LightCycler. Virus was quantified using standards based on the cloned Orthopoxvirus HA (J7R) gene were calculated using the LightCycler software version 4.0 as described by Kulesh et al[33]. Viral titers were determined by plaque assay on Vero cells grown in Earle's modified Eagle's medium supplemented with 10% fetal calf serum.

Primer design

Four primer pairs were designed to target the DNA and RNA polymerase genes and the DNA and RNA helicase genes in the conserved core region of viruses within the family Poxviridae (Table 1). Each of these primers generated an amplicon from any orthopoxvirus DNA template tested. All primers used in this study had a thymine nucleotide at the 5′-end to minimize addition of non-templated adenosines during amplification using Taq polymerase [34].

PCR

The PCR reaction mix consisted of 2.4 U of Faststart Taq polymerase (Roche Applied Science, Indianapolis, IN), 20 mM Tris (pH 8.3), 75 mM KCl; 1.5 mM MgCl2; 0.4 M betaine; 800 µM equal mix of dCTP, dTTP, dGTP, and dATP; and 250 nM of each primer. The following PCR cycling conditions were used on MJ dyad 96-well thermocyclers (Bio-Rad Inc. Hercules, CA): 95°C for 10 min, followed by 8 cycles of 95°C for 30 s, 48°C for 30 s, and 72°C 30 s, with the 48°C annealing temperature increasing 0.9°C each cycle. The PCR was then continued for 37 additional cycles of 95°C for 15 s, 56°C for 20 s, and 72°C for 20 s. The PCR cycle ended with a final extension of 2 min at 72°C followed by a 4°C hold.

Internal positive control DNA

An internal positive control (calibrant) made from synthetic DNA (BlueHeron Biotechnology, Bothell, WA) was included in each PCR reaction at an experimentally determined concentration (100 copies/PCR reaction). The calibrant was based upon the primer target region of Variola major virus (gi|9627521) and served as our test surrogate for this virus. The calibrant sequence contains a five-base pair (bp) deletion within the amplicon so that the calibrant amplicons could readily be resolved from the viral template-derived amplicon.

Mass spectrometry and base composition analysis

After amplification, 30 µL aliquots of each PCR reaction were desalted and purified by using a weak anion exchange protocol described elsewhere. [22]. Accurate mass (±1 ppm), high-resolution (M/dM>100,000 FWHM) mass spectra were acquired for each sample using high-throughput ESI-MS protocols described previously [24]. For each sample, approximately 1.5 µL of analyte solution was consumed during the 74-second spectral acquisition. Raw mass spectra were post-calibrated with an internal mass standard and deconvolved to monoisotopic molecular masses. Unambiguous base compositions were derived from the exact mass measurements of the complementary single-stranded oligonucleotides [35] . Quantitative results were obtained by comparing the peak heights with the calibrant present in every PCR well at 100 molecules as previously described for other Ibis T5000 assays [24].
  29 in total

1.  Detection of smallpox virus DNA by LightCycler PCR.

Authors:  Mark J Espy; Franklin R Cockerill III; Richard F Meyer; Michael D Bowen; Gregory A Poland; Ted L Hadfield; Thomas F Smith
Journal:  J Clin Microbiol       Date:  2002-06       Impact factor: 5.948

Review 2.  Smallpox in history: the birth, death, and impact of a dread disease.

Authors:  John M Eyler
Journal:  J Lab Clin Med       Date:  2003-10

3.  Detection of orthopoxvirus DNA by real-time PCR and identification of variola virus DNA by melting analysis.

Authors:  Andreas Nitsche; Heinz Ellerbrok; Georg Pauli
Journal:  J Clin Microbiol       Date:  2004-03       Impact factor: 5.948

4.  Rapid detection and molecular serotyping of adenovirus by use of PCR followed by electrospray ionization mass spectrometry.

Authors:  Lawrence B Blyn; Thomas A Hall; Brian Libby; Raymond Ranken; Rangarajan Sampath; Karl Rudnick; Emily Moradi; Anjali Desai; David Metzgar; Kevin L Russell; Nikki E Freed; Melinda Balansay; Michael P Broderick; Miguel A Osuna; Steven A Hofstadler; David J Ecker
Journal:  J Clin Microbiol       Date:  2007-12-19       Impact factor: 5.948

5.  Detection of poxvirus in cattle associated with human cases in the State of Rio de Janeiro: preliminary report.

Authors:  H G Schatzmayr; E R Lemos; C Mazur; A Schubach; S Majerowicz; T Rozental; T M Schubach; M C Bustamante; O M Barth
Journal:  Mem Inst Oswaldo Cruz       Date:  2000 Sep-Oct       Impact factor: 2.743

6.  An emergent poxvirus from humans and cattle in Rio de Janeiro State: Cantagalo virus may derive from Brazilian smallpox vaccine.

Authors:  C R Damaso; J J Esposito; R C Condit; N Moussatché
Journal:  Virology       Date:  2000-11-25       Impact factor: 3.616

7.  Araçatuba virus: a vaccinialike virus associated with infection in humans and cattle.

Authors:  Giliane de Souza Trindade; Flávio Guimarães da Fonseca; João Trindade Marques; Maurício Lacerda Nogueira; Luiz Claudio Nogueira Mendes; Alexandre Secorun Borges; Juliana Regina Peiró; Edviges Maristela Pituco; Cláudio Antônio Bonjardim; Paulo César Peregrino Ferreira; Erna Geessien Kroon
Journal:  Emerg Infect Dis       Date:  2003-02       Impact factor: 6.883

8.  The detection of monkeypox in humans in the Western Hemisphere.

Authors:  Kurt D Reed; John W Melski; Mary Beth Graham; Russell L Regnery; Mark J Sotir; Mark V Wegner; James J Kazmierczak; Erik J Stratman; Yu Li; Janet A Fairley; Geoffrey R Swain; Victoria A Olson; Elizabeth K Sargent; Sue C Kehl; Michael A Frace; Richard Kline; Seth L Foldy; Jeffrey P Davis; Inger K Damon
Journal:  N Engl J Med       Date:  2004-01-22       Impact factor: 91.245

9.  Smallpox and pan-orthopox virus detection by real-time 3'-minor groove binder TaqMan assays on the roche LightCycler and the Cepheid smart Cycler platforms.

Authors:  David A Kulesh; Robert O Baker; Bonnie M Loveless; David Norwood; Susan H Zwiers; Eric Mucker; Chris Hartmann; Rafael Herrera; David Miller; Deanna Christensen; Leonard P Wasieloski; John Huggins; Peter B Jahrling
Journal:  J Clin Microbiol       Date:  2004-02       Impact factor: 5.948

10.  Global surveillance of emerging Influenza virus genotypes by mass spectrometry.

Authors:  Rangarajan Sampath; Kevin L Russell; Christian Massire; Mark W Eshoo; Vanessa Harpin; Lawrence B Blyn; Rachael Melton; Cristina Ivy; Thuy Pennella; Feng Li; Harold Levene; Thomas A Hall; Brian Libby; Nancy Fan; Demetrius J Walcott; Raymond Ranken; Michael Pear; Amy Schink; Jose Gutierrez; Jared Drader; David Moore; David Metzgar; Lynda Addington; Richard Rothman; Charlotte A Gaydos; Samuel Yang; Kirsten St George; Meghan E Fuschino; Amy B Dean; David E Stallknecht; Ginger Goekjian; Samuel Yingst; Marshall Monteville; Magdi D Saad; Chris A Whitehouse; Carson Baldwin; Karl H Rudnick; Steven A Hofstadler; Stanley M Lemon; David J Ecker
Journal:  PLoS One       Date:  2007-05-30       Impact factor: 3.240

View more
  11 in total

1.  Detection, identification, and distribution of fungi in bronchoalveolar lavage specimens by use of multilocus PCR coupled with electrospray ionization/mass spectrometry.

Authors:  Jeong Hwan Shin; Raymond Ranken; Susan E Sefers; Robert Lovari; Criziel D Quinn; Shufang Meng; Heather E Carolan; Donna Toleno; Haijing Li; Jeong Nyeo Lee; Charles W Stratton; Christian Massire; Yi-Wei Tang
Journal:  J Clin Microbiol       Date:  2012-10-24       Impact factor: 5.948

2.  Extraction of total nucleic acids from ticks for the detection of bacterial and viral pathogens.

Authors:  Chris D Crowder; Megan A Rounds; Curtis A Phillipson; John M Picuri; Heather E Matthews; Justina Halverson; Steven E Schutzer; David J Ecker; Mark W Eshoo
Journal:  J Med Entomol       Date:  2010-01       Impact factor: 2.278

3.  Application of the Ibis-T5000 pan-Orthopoxvirus assay to quantitatively detect monkeypox viral loads in clinical specimens from macaques experimentally infected with aerosolized monkeypox virus.

Authors:  Rebecca J Grant; Carson D Baldwin; Aysegul Nalca; Scott Zoll; Lawrence B Blyn; Mark W Eshoo; Heather Matthews; Rangarajan Sampath; Chris A Whitehouse
Journal:  Am J Trop Med Hyg       Date:  2010-02       Impact factor: 2.345

4.  Two novel poxviruses with unusual genome rearrangements: NY_014 and Murmansk.

Authors:  Chad Smithson; Hermann Meyer; Crystal M Gigante; Jinxin Gao; Hui Zhao; Dhwani Batra; Inger Damon; Chris Upton; Yu Li
Journal:  Virus Genes       Date:  2017-07-31       Impact factor: 2.198

5.  Comprehensive biothreat cluster identification by PCR/electrospray-ionization mass spectrometry.

Authors:  Rangarajan Sampath; Niveen Mulholland; Lawrence B Blyn; Christian Massire; Chris A Whitehouse; Nicole Waybright; Courtney Harter; Joseph Bogan; Mary Sue Miranda; David Smith; Carson Baldwin; Mark Wolcott; David Norwood; Rachael Kreft; Mark Frinder; Robert Lovari; Irene Yasuda; Heather Matthews; Donna Toleno; Roberta Housley; David Duncan; Feng Li; Robin Warren; Mark W Eshoo; Thomas A Hall; Steven A Hofstadler; David J Ecker
Journal:  PLoS One       Date:  2012-06-29       Impact factor: 3.240

6.  Simple technique for in field samples collection in the cases of skin rash illness and subsequent PCR detection of orthopoxviruses and varicella zoster virus.

Authors:  Catherine Dumont; Leonid M Irenge; Edmond K Magazani; Daniel Garin; Jean-Jacques T Muyembe; Mostafa Bentahir; Jean-Luc Gala
Journal:  PLoS One       Date:  2014-05-19       Impact factor: 3.240

Review 7.  MASS SPECTROMETRY IN VIROLOGICAL SCIENCES.

Authors:  Aleksandra Milewska; Joanna Ner-Kluza; Agnieszka Dabrowska; Anna Bodzon-Kulakowska; Krzysztof Pyrc; Piotr Suder
Journal:  Mass Spectrom Rev       Date:  2019-12-25       Impact factor: 9.011

Review 8.  [Mass spectrometry in the clinical microbiology laboratory].

Authors:  Elena Jordana-Lluch; Elisa Martró Català; Vicente Ausina Ruiz
Journal:  Enferm Infecc Microbiol Clin       Date:  2012-02-29       Impact factor: 1.731

Review 9.  Molecular methods for pathogen and microbial community detection and characterization: current and potential application in diagnostic microbiology.

Authors:  Christopher D Sibley; Gisele Peirano; Deirdre L Church
Journal:  Infect Genet Evol       Date:  2012-02-09       Impact factor: 3.342

Review 10.  Improving the diagnosis of bloodstream infections: PCR coupled with mass spectrometry.

Authors:  Elena Jordana-Lluch; Montserrat Giménez; M Dolores Quesada; Vicente Ausina; Elisa Martró
Journal:  Biomed Res Int       Date:  2014-04-09       Impact factor: 3.411

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.