Literature DB >> 19500374

A human glomerular SAGE transcriptome database.

Jenny Nyström1, Wolfgang Fierlbeck, Anna Granqvist, Stephen C Kulak, Barbara J Ballermann.   

Abstract

BACKGROUND: To facilitate in the identification of gene products important in regulating renal glomerular structure and function, we have produced an annotated transcriptome database for normal human glomeruli using the SAGE approach. DESCRIPTION: The database contains 22,907 unique SAGE tag sequences, with a total tag count of 48,905. For each SAGE tag, the ratio of its frequency in glomeruli relative to that in 115 non-glomerular tissues or cells, a measure of transcript enrichment in glomeruli, was calculated. A total of 133 SAGE tags representing well-characterized transcripts were enriched 10-fold or more in glomeruli compared to other tissues. Comparison of data from this study with a previous human glomerular Sau3A-anchored SAGE library reveals that 47 of the highly enriched transcripts are common to both libraries. Among these are the SAGE tags representing many podocyte-predominant transcripts like WT-1, podocin and synaptopodin. Enrichment of podocyte transcript tags SAGE library indicates that other SAGE tags observed at much higher frequencies in this glomerular compared to non-glomerular SAGE libraries are likely to be glomerulus-predominant. A higher level of mRNA expression for 19 transcripts represented by glomerulus-enriched SAGE tags was verified by RT-PCR comparing glomeruli to lung, liver and spleen.
CONCLUSION: The database can be retrieved from, or interrogated online at http://cgap.nci.nih.gov/SAGE. The annotated database is also provided as an additional file with gene identification for 9,022, and matches to the human genome or transcript homologs in other species for 1,433 tags. It should be a useful tool for in silico mining of glomerular gene expression.

Entities:  

Mesh:

Substances:

Year:  2009        PMID: 19500374      PMCID: PMC2709617          DOI: 10.1186/1471-2369-10-13

Source DB:  PubMed          Journal:  BMC Nephrol        ISSN: 1471-2369            Impact factor:   2.388


Background

Renal glomeruli are highly specialized capillary tufts that produce a nearly protein-free ultrafiltrate of plasma at a rate of about 30 plasma volumes daily. Several hereditary, immune-mediated and metabolic disorders cause glomerular injury, proteinuria, and can lead to renal failure. The three intrinsic glomerular cell types, podocytes, mesangial cells, and glomerular endothelial cells (EC) are highly specialized. Podocytes extend an elaborate array of actin-rich foot processes around the exterior of the glomerular capillary loops, forming a scaffold with nephrin-based filtration slit diaphragms spanning the space between adjacent foot processes [1]. Mesangial cells are pericyte-like cells that, unlike most other pericytes, form an interstitium within the intracapillary space [2]. Glomerular EC are packed with transcellular fenestrae ringed by actin [3,4]. The fenestrae serve the high glomerular capillary wall hydraulic conductivity [5], while a glycocalyx covering the glomerular EC and podocytes together with the podocyte filtration slit diaphragm impede the movement of plasma proteins [6-8] across the glomerular capillary wall. Transcriptome and proteomic approaches are helping to define genes highly expressed and/or enriched in glomeruli [9-12]. For instance, Sau3A-anchored SAGE databases have been built with RNA extracted from microdissected nephron segments, and enrichment of several glomerular transcripts relative to other nephron segments has been reported [9]. Furthermore, many proteins uniquely expressed by, or enriched in podocytes have been identified over the past decade and their specific functions are increasingly well defined [13]. Finally, by analysis of ESTs enriched in glomeruli, ehd3 was shown to be the first transcript expressed exclusively by glomerular EC [12]. The current study sought to extend previous transcriptome-based work by building a human glomerular LongSAGE database that can be interrogated directly online. SAGE is based on the principal that a small (here 17 bp) tag sequence immediately 3' of an "anchoring" restriction site is a unique identifier of each transcript [14]. The frequency of specific SAGE tags relative to the total pool of tags reflects their abundance in the source mRNA. In silico comparison of SAGE libraries from diverse tissues can then be used to discover differential expression of transcripts [15]. The level of expression of any specific transcript can also be probed in silico by interrogating SAGE libraries with the transcript's unique SAGE tag sequence. We report here the gene expression profile of transcripts for human glomeruli and compare them to pooled SAGE libraries for non-glomerular tissues and cells. Many of the most highly enriched glomerular transcripts reported here were previously found in a Sau3A-anchored glomerular library [9]. Nonetheless, the current SAGE database contains additional glomerulus-enriched transcript tags, and since it is NlaIII-anchored it now allows direct comparison with many non-renal SAGE libraries. The data should serve as a useful resource for investigators studying glomerular gene expression.

Construction and content

Cells and Tissues

Human kidney tissue was obtained from the uninvolved portion of tumor nephrectomy specimens (Human Subjects Protocols: #6196 University of Alberta and #155/97 University of Frankfurt). Patient 1 was a 45 year old Caucasian female, patient 2 a 72 yo Caucasian male. Renal tissue was collected only from patients in whom the serum creatinine was within normal limits, and in whom diabetes mellitus, hypertension, and proteinuria were absent. Specific parameters were not collected for individual patients. The relative purity of isolated glomeruli and the normal histological appearance of kidney cortex used in this study are shown in Figure 1. That the cDNA template used for SAGE contained mRNA representing glomerular capillary endothelium is shown by RT-PCR amplification of PECAM-1 (836 bp) and the non-integrin laminin receptor LAMR1 (256 bp). Greater synaptopodin transcript abundance in glomerular, compared to whole kidney cortex mRNA from the same specimen also shows appropriate enrichment of the source mRNA in glomerular podocyte transcripts (Figure 1). Amplification of the long PECAM-1 sequence furthermore shows that the source mRNA was intact. Sufficient mRNA for construction of the SAGE library was only obtained from patient 2. The integrity of this source material was also verified by Agilent 2100 microfluidics analysis (data not shown).
Figure 1

Human Kidney Source Material. Isolated glomeruli (A, D), Hematoxylin & Eosin Stain (B, E) and Masson Trichrome Stain (C, F) for patient 1 (A, B, C) and patient 2 (D, E, F). RT-PCR for PECAM-1 and the 67 kDa non-integrin laminin receptor LAMR1 for patient 1 (pt 1) and patient 2 (pt2) (G). Enrichment of the synaptopodin mRNA abundance, determined by RT-PCR, in glomeruli relative to whole kidney cortex from patient 2 (H).

Human Kidney Source Material. Isolated glomeruli (A, D), Hematoxylin & Eosin Stain (B, E) and Masson Trichrome Stain (C, F) for patient 1 (A, B, C) and patient 2 (D, E, F). RT-PCR for PECAM-1 and the 67 kDa non-integrin laminin receptor LAMR1 for patient 1 (pt 1) and patient 2 (pt2) (G). Enrichment of the synaptopodin mRNA abundance, determined by RT-PCR, in glomeruli relative to whole kidney cortex from patient 2 (H).

Human Glomerular SAGE Library Construction

For SAGE, human glomeruli were isolated by sieving in ice-cold phosphate buffered saline (PBS) from the kidney of a 72-year old male using minor modifications of the protocol for rat glomeruli [16,17]. Glomeruli were immediately placed into RNA-Protect (Qiagen, Valencia, CA) followed by isolation of 4.7 μg total RNA with the RNeasy kit (Qiagen). A SAGE library was then custom-constructed by Genzyme Corporation (Framingham, MA) using the "long" SAGE protocol, producing 17 bp SAGE tags with the CATG (NlaIII) anchoring restriction site [18]. A total of 2304 clones containing concatenated ditags were sequenced, resulting in 48,926 tags. Of these, 1,361 were derived from duplicate ditags. Tags from duplicate ditags were not removed [19]. Twenty-one tags were removed as they contained ambiguous (N) nucleotides leaving 48,905 tags and 22,907 unique long SAGE tags for analysis. Tag sequences and their absolute counts in 115 distinct "long" SAGE libraries were retrieved from cgap.nci.nih.gov/SAGE (98,944,923 tags). All "long" SAGE Libraries available before July 1, 2008 were included without selection. Tissues and cells represented include normal brain, breast, skin, pancreas, bladder, gallbladder, uterus, vein, testis, white blood cells, lung macrophages, embryonic stem cells as well as malignant tumors including colon and lung adenocarcinoma, melanoma, among others. The frequency of each tag (count/total tag number) was calculated for each of the 115 libraries and expressed as tags per million (TPM). The mean TPM for the non-glomerular libraries (Pool TPM) is reported. The frequency ratio of the glomerular: Pool TPM was then calculated to establish degree of enrichment of specific tags in glomeruli (Ratio G: P). Statistical comparison of the pooled libraries with the current glomerular SAGE library was based on Chi-square analysis using absolute tag counts [20]. Comparison to a human kidney SAGE library (SAGE_Kidney_normal_B_1, from cgap.nci.nih.gov/SAGE) was based on the short (10 bp) tag sequences. For each SAGE tag, identification was based on the "Hs_long.best_gene.gz" database found at ftp://ftp1.nci.nih.gov/pub/SAGE/HUMAN/. The SAGE Genie algorithm for identifying the best gene match for SAGE tags was reported by Boon et al. [21]. For some tags, the Blast n algorithm at http://blast.ncbi.nlm.nih.gov/Blast.cgi, was used to match tag sequences that could not be assigned by the "Hs_long.best_gene.gz" database. For these, the SAGE tag had to be in the +/+ orientation with the corresponding mRNA or EST, and fully match the 17 bp sequence immediately 3' of the NlaIII site nearest the Poly(A)+ tail or a stretch of > 8 A's as previously reported [22]. Positive identification based on this latter search strategy is indicated in additional file 1 by asterisks.

RT-PCR Analysis

For quantitative RT-PCR, glomeruli were microdissected from distinct pre-transplant kidney biopsy specimens obtained from three separate donors aged 57, 59 and 63 at the University of Göteborg (Human Subjects Protocol #653-05). Immediately after biopsy, one half of one biopsy core was placed into 0.5 ml of ice-cold PBS containing 100 U RNAse inhibitor (RNAsin) (Applied Biosystems, Foster City, CA, USA). Four to fifteen glomeruli were isolated using a stereomicroscope (Zeiss, Jena, Germany) followed by extraction of total RNA. cDNA was generated from glomerular RNA with SuperScript™ III RT (Invitrogen, Carlsbad, CA, USA). Human kidney, spleen, lung and liver mRNA was purchased from Invitrogen/Ambion (Carlsbad, CA). Reactions without RT for each primer set served as controls. PCR cycling was performed with 100 ng template (94°C – 3 min; 35 cycles: 94°C – 30 sec; 55°C – 30 sec; 68°C – 30 sec plus 1 min for each kilobase pair (kbp) of PCR product to be amplified; 72°C – 7 min). Quantification of gene expression was performed according to the delta Ct method (DeltaCt2/DeltaCt1), as described by others [23], and by this laboratory [22].

Human Glomerular SAGE Database Content

The complete human glomerular SAGE library was deposited in the Gene Expression Omnibus http://www.ncbi.nlm.nih.gov/geo/ repository (record GSE8114, Accession # GSM199994) and in the SAGE Genie collection http://cgap.nci.nih.gov/SAGE as "LSAGE_Kidney_Glomeruli_Normal_B_bjballer1". It consists of 22,907, unique 17 bp tag sequences and the absolute tag count for each sequence. The total tag count in the library is 48,905. The library is also appended in spreadsheet format with tag identification (additional file 1).

Utility

Retrieval of Highly Enriched Glomerular Transcripts

The transcripts most highly enriched in human glomeruli identified by this study are shown in Tables 1 and 2 and Additional files 3 and 4. Of the 22,907 tags, 291 were observed with an absolute count of 4 (81 TPM) or greater and enriched more than 10-fold relative to pooled non-kidney SAGE libraries. For 84 of these no reliable match to a known cDNA sequence was found, and a match to incompletely defined ESTs was observed for 8 others. The tags representing Aldolase B, uromodulin, glutamyl aminopeptidase, glutathione peroxidase, and SLC25A45 were excluded from this set because they were not enriched relative to whole kidney. They likely represent transcripts expressed at very high levels in contaminating tubules. Several highly expressed transcripts produced more than one unique tag, which is common and usually reflects priming from internal poly A(+) runs or alternatively spliced transcripts. After removal of such redundant tags, 133 well-characterized tags highly enriched in glomeruli were established (Tables 1 and 2 and Additional files 3 &4).
Table 1

Transcripts represented by SAGE tags enriched 30 fold or more in glomeruli

SymbolGene NameNlaIII long TagSau3A TagG:TPMSau3AG:TPMNlaIIIP:TPMNlaIIIK:TPMNlaIIIRatioG: PRatioG: KLinkSAGE GenieLinkRef
NPHS2Nephrosis 2, idiopathic, steroid-resistant (podocin)TTTCCGTGACTCATCTACCTCACTGAA1,5342,287048Infinity48NPHS2Ref:NPHS2
SOSTSclerosteosisACATATGAAAGCCTGCATCGAGGAGAC1588200InfinitySOST
MMEMembrane metallo-endopeptidaseCTGCAGTGTTCGAGTGGTATAAAGCGA271102004446MMERef:MME
CLIC5Chloride intracellular channel 5AATCTGAACCAATTACCCAGTCATCTG1,0383,593524719150CLIC5Ref:CLIC5
NPHS1Nephrosis 1, congenital, Finnish type (nephrin)TAAACATAAGTATGCTC1,04120549NPHS1Ref:NPHS1
TCF21Transcription factor 21CGAGTGCTGAGCAAGGCATAGGATAGC45181720514TCF21Ref:TCF21
CDKN1CCyclin-dependent kinase inhibitor 1C (p57, Kip2)CCGCTGCGGGGCCCTGGAGCGCCTGAG38349010506CDKN1CRef:CDKN1C
DDNDendrinTGAACTTGGCCACATCA30610373DDNRef:DDN
THYMU2010816CDNA FLJ36413 fis, clone THYMU2010816TATCACTGGGGAGGGAAATTAGTCAAT20344920285THYMU2010816
FLJ22271CDNA: FLJ22271 fis, clone HRC03191GCTTTGTCGCAACGCTC8200263FLJ22271
PTPROProtein tyrosine phosphatase, receptor type, OGATATACAACAGAAAACAACTGTGTAA22675540215PTPRORef:PTPRO
FGF1Fibroblast growth factor 1 (acidic)TAAAGGCCTTTAATAAGTTCTTAGAAG4741020242104FGF1Ref:FGF1
PTHR1Parathyroid hormone receptor 1TGACCAGGCGCTGGGGG1,14389614112PTHR1Ref:PTHR1
CLDN5Claudin 5GTAGGCGGCTGCCTCTT8210127CLDN5
LRRC2Leucine rich repeat containing 2GGACTGCACTCCAGCCT8210108LRRC2
AL049990MRNA; cDNA DKFZp564G112 (from clone DKFZp564G112)ACTTGGAAATAAACAAA14310105AL049990
HTRA1HtrA serine peptidase 1ACCGACAGGCCAAAGGACGCAGGCAGA1,39814310105HTRA1
FAM65AFamily with sequence similarity 65, member AGCTGCTGTCAGCACCCAAGGCTGTTGT3162042099FAM65A
SEMA3GSemaphorin 3GACTGCCCCTGAGCTCTG6747249428SEMA3G
SPOCK1Sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1AGAATACCTTAATACTGTTTAATACTT2261221092SPOCK1
CRB2Crumbs homolog 2 (Drosophila)TGCAGCAGTGGCAGCCT3674089CRB2
ENPEPGlutamyl aminopeptidase (aminopeptidase A)GCCTGGAATTGGATACAATATGAATTA632143296791ENPEPRef:ENPEP
SLC45A1Solute carrier family 45, member 1GGCGTGGACATCTCTCT1432077SLC45A1
TNNT2Troponin T type 2 (cardiac)ATGCATTTTGGGGGTTATGCTCCTCGC338184224768TNNT2
CD34CD34 moleculeGGACCAGGTCTTGGAGC102124754CD34Ref;CD34
EFNB1Ephrin-B1AGGGAAGAGGAAAGTGC1022068EFNB1Ref:EFNB1
IL1RL1Interleukin 1 receptor-like 1 (ST2 Protein)AGGGCAGGGACATCATCTTTGTAGACT158821064IL1RL1
ST6GALNAC3ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-TGATGCCCTTGAACACC2865063ST6GALNAC3Ref:ST6GALNAC3
acetylgalactosaminide alpha-2,6-sialyltransferase 3
NTNG1Netrin G1TGTAACAGCCCCCTCTA1022063NTNG1
SPOCK2Sparc/osteonectin, cwcv and kazal-like domains proteoglycan 2CATAAAGGAAATCAAATTGGTAGGTTG2481,12318061SPOCK2
ABLIM2Actin binding LIM protein family, member 2ACACGCCAAGTCCCGTT1222060ABLIM2Ref:ABLIM2
MGC16291Hypothetical protein MGC16291TGGGTCAAACTCTGAAA122224585MGC16291
BCAMBasal cell adhesion molecule (Lutheran blood group)CCCGCCCCCGCCTTCCCACGTGGTATC6323,20555788584BCAMRef:BCAM
TPPP3Tubulin polymerization-promoting protein family member 3GTGACCCCAAGGCCAGT821057TPPP3
C4orf31Chromosome 4 open reading frame 31TACATAAAATTAAAGAGTAATCTAAGT2264298057C4orf31
GJA5Gap junction protein, alpha 5, 40kDaGACCATTCCTCGGAGTAAATCTTTGAT203122224555GJA5RefGJA5
ITGB8Integrin, beta 8TCTTGTATCAATGGCAG63312052ITGB8Ref:ITGB8
TSPAN2Tetraspanin 2CCAAGGCACTGAATTAA1433049TSPAN2
WT1Wilms tumor 1CTGGTATATGGCTTCAATTACAAGATA4061433049WT1Ref:WT1
COL4A3Collagen, type IV, alpha 3 (Goodpasture antigen)TGCATTATTTTCCAGAT1223048COL4A3REF:COL4A3
ALS2CLALS2 C-terminal likeCGATGCTGACGGGACCC79617047ALS2CL
PLCE1Phospholipase C, epsilon 1AACGAACGTGGCTGTAT1634046PLCE1Ref:PLCE1
WFS1Wolfram syndrome 1 (wolframin)ACCCTCCTGTCCAGCAG2044046WFS1
PCOLCE2Procollagen C-endopeptidase enhancer 2ATGGAGGTATGAGGCCTTATGTTCTCT2714089244517PCOLCE2
MRGPRFMAS-related GPR, member FAGGACCCACTGGGCAGCCTCTTAAGGC3163278043MRGPRF
SPTBSpectrin, beta, erythrocyticCAATCTGGGGCTGGCCC822042SPTBRef:SPTB
ATP10AATPase, class V, type 10ATCCTCTGCGCCAGGGGA2045041ATP10A
USHBP1Usher syndrome 1C binding protein 1TCATAAACTGTCCTGGA1223040USHBP1
MAP6Microtubule-associated protein 6TACAGTAGTCTTGCTGG3278039MAP6
NFASCNeurofascin homolog (chicken)AGCAATGAAAAGGCCAA1845039NFASC
PLA2R1Phospholipase A2 receptor 1, 180kDaAATTTTGCAAAAAGGAA822039PLA2R1
C1QL1Complement component 1, q subcomponent-like 1CGCGGCGGCGACGGCAC184524398C1QL1
TMEM178Transmembrane protein 178CTTGTTAAATTTTAATG102324394TMEM178
TP53I11Tumor protein p53 inducible protein 11TACCCCAAGGCCTGATG1023037TP53I11
SYNPOSynaptopodinATATTAGGAAGTCGGGGCATTTCTACC51959216037SYNPORef:SYNPO
DACH1Dachshund homolog 1 (Drosophila)TAGGACCTATGAAAATT822037DACH1
TTMATwo transmembrane domain family member ACTTTATTGAGTGTTATC2256037TTMA
FABP1Fatty acid binding protein 1, liverACATTGGGTGACATTGT102324354FABP1
RAMP3Receptor (G protein-coupled) activity modifying protein 3AGCTTGTGGCCTCTATC1,00029034RAMP3
EMCNEndomucinCTACTTTGTACATATAATTTTCTTTAA36144913034EMCN
RAPGEF3Rap guanine nucleotide exchange factor (GEF) 3AGGAGGGGCTGGGACTG184672333RAPGEF3
FAM20BMajor histocompatibility complex, class I, BTCCCGGCCCGGCCGCGG822033FAM20B
NPNTNephronectinGTAAAGGTATAAGCCTTCATTTTTAAT3832869032NPNTRef:NPNT
UACAUveal autoantigen with coiled-coil domains and ankyrin repeatsAGTTCTGTTTCACAAGT823032UACA
KLK7Kallikrein-related peptidase 7AGCCACCACGGCCAGCC5921996316KLK7
LIMS2LIM and senescent cell antigen-like domains 2CAGATGGAGGCCTCTGG77625243132LIMS2
TYRO3TYRO3 protein tyrosine kinaseGGGCGGGTCCTAGCTGT1,14337723116TYRO3

Transcripts represented by SAGE tags enriched 30 fold or more in glomeruli compared to pooled SAGE libraries from diverse tissues and cells. The gene symbol and gene name are shown for each tag sequence. Where available, the corresponding short Sau3A SAGE tag (Ref 9) is shown. SAGE tag frequencies are shown as Tags per Million (TPM). Sau3A TPM is derived from Ref 9. Enrichment in glomeruli relative to pooled libraries (G:P) and relative to whole kidney (G:K) is shown for each tag. This table with embedded links to SAGE Genie and links to references showing expression and/or function in glomeruli is provided as additional file 3

Table 2

Transcripts represented by SAGE tags enriched 10 – 30 fold in glomeruli

SymbolGene NameNlaIII long TagSau3A TagG:TPMSau3AG:TPMNlaIIIP:TPMNlaIIIK:TPMNlaIIIRatioG: PRatioG: KLinkSAGE GenieRefLink
COL4A4Collagen, type IV, alpha 4TAACTTTTGCAAGATGC1224029COL4A4Ref:COL4A4
AQP1Aquaporin 1AGCTCCTGATCAGAGGC1024027AQP1AQP1
NPR1Natriuretic peptide receptor A/guanylate cyclase AAGCAGAGACAATTAAAA163624277NPR1NPR1
PTGDSProstaglandin D2 synthase 21kDaACGGAACAATAGGACTCCCGGCCAGCC5,3232,36888242799PTGDS
CRHBPCorticotropin releasing hormone binding proteinAATAAATACATTCAGAAATAGTTCTAA6542861127CRHBP
TNNI1Troponin I type 1 (skeletal, slow)AGGCACCTGGGGCTTCTTGCGGGCCAA158204824269TNNI1
ODZ2Odz, odd Oz/ten-m homolog 2ACAGTCACCACGAGGAG122526ODZ2
EPAS1Endothelial PAS domain protein 1GAACTTTTCTGTAATGG82348242EPAS1
PODXLPodocalyxin-likeGAGGACACAGATGACTCATATATGTCT2,3233,369141482470PODXLRef:PODXL
TMEM204Transmembrane protein 204CGTGCGAGACACGTGTG204923TMEM204
SMAD6SMAD family member 6TCTCCGGACGCCACCAA163723SMAD6Ref:Samd6
CLEC3BC-type lectin domain family 3, member BACCGGCGCCCGCATCGCGTGTAGCCGG3613671672235CLEC3B
IFITM3Interferon induced transmembrane protein 3AACCCCTGCTGCCTGGG102423IFITM3
HOXA7Homeobox A7GTATGTTGTCTTGAGTT82421HOXA7
CHI3L1Chitinase 3-like 1 (cartilage glycoprotein-39)GTATGGGCCCTGGACCTCCCAAGCCTG5641,0214821CHI3L1
FRYFurry homolog (Drosophila)TGAACTTGTTGCACTGC4081921FRY
PEA15Phosphoprotein enriched in astrocytes 15TCTGCCCTTTTTTGTGG125624215PEA15
ZNF250Zinc finger protein 250TGGAACCACAAGCAGCC143720ZNF250
TGFBR3Transforming growth factor, beta receptor IIIGCAAATCCTGTCGGTCTCTCCTGTCTA180122620TGFBR3
IGFBP5Insulin-like growth factor binding protein 5GAGTACGTTGACGGGGATTTGTCTTTT3,4963671820IGFBP5Ref:IGFBP5
FCN3Ficolin (collagen/fibrinogen domain containing) 3GACACCGAGGGGGGCGGGTCAGCCACC18071536482015FCN3
LRRC32Leucine rich repeat containing 32 (GARP gene)TTGCATACCCTGACCCCTTTGAAAACA18020119LRRC32
NOSTRINNitric oxide synthase traffickerCCACACGCAGATTCACTTTTGAATGGG15861319NOSTRINRef:Nostrin
HTRA1HtrA serine peptidase 1TTTCCCTCAAAGACTCT1,40974241959HTRA1
ITGA1Pelota homolog (Drosophila)TGCCAGGTGCAGTCACA122624195ITGA1
TNNC1Troponin C type 1 (slow)TCCTCAACCCCAAATCC1841117TNNC1
DOPEY2Dopey family member 2AGAATTGCTTGAACCCA1,34779263175DOPEY2
FOXC1Forkhead box C1AGCCTGTACGCGGCCGGATTGTTAAAG51924515241710FOXC1
CEP3CDC42 effector protein (Rho GTPase binding) 3ATGCTTCTGCAGAGACTTTGGGCCCTC2261631017CEP3
BGNBiglycanGCCTGTCCCTCCAAGACGAGAACGGGA15877648721611BGNRef:BGN
MAGI2Membrane associated guanylate kinaseTATTAATAGTCACAGAA102716MAGI2
AIF1LAllograft inflammatory factor 1-likeGGAGTGTGCGTGGACTG1,572102334155C9orf58
KCNH3Potassium voltage-gated channel, subfamily H, member 3TGCCCCTGCCTCTACCT1631115KCNH3
PARD6GPar-6 partitioning defective 6 homolog gamma (C. elegans)TCGTTCAGTGCCCCAGC82515PARD6G
TM4SF18Transmembrane 4 L six family member 18CAAGTATACCACCCTTC82515TM4SF18
TENC1Tensin like C1 domain containing phosphatase (tensin 2)AATAGGGGAAAAAAGAGACATGAATAG5195313715TENC1Ref:TENC1
DPP6Dipeptidyl-peptidase 6ACATTTGGTTAAAAAAA82614DPP6
NESNestinTGCTGACTCCCCCCATC2,001138721428NESRef:NES
ADORA1Adenosine A1 receptorTGACTAATAAAAAACTG82614ADORA1Ref:ADORA1
VEGFAVascular endothelial growth factor ATTTCCAATCTCTCTCTCCCCTGGCTCC2481,450109241361VEGFARef:VEGFA
ZNF135Zinc finger protein 135GGGAAACTCCATCTCTA102813ZNF135
SLC48A1Solute carrier family 48 (heme transporter), member 1GTGCATCAGAGCGGGAA82613SLC48A1
FARP1FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1GGGTAGTGTCAGTCGGA1221072132FARP1
C1orf115Chromosome 1 open reading frame 115TCGAAGATTCACTGGGA102824124C1orf115
DAG1Dystroglycan 1 (dystrophin-associated glycoprotein 1)CAGAGACGTGGCTGGCC1,286104481227DAG1Ref:DAG1
PPAP2APhosphatidic acid phosphatase type 2AAAACACCAACAACTGGGCAGATTGGTC2482862312PPAP2ARef:PPA2A
SEMA3BSemaphorin 3BTGCCGCCCGCAGCCTGC6125072129SEMA3B
CDC14ACDC14 cell division cycle 14 homolog A (S. cerevisiae)TATTTTGTTATGAATAG1431224126CDC14A
CIRBPCold inducible RNA binding proteinTGCCCGGGGAATGTTCC82712CIRBP
CSRP1Cysteine and glycine-rich protein 1CAGGCGGGGTCCTAGGA82712CSRP1
FAM20CFamily with sequence similarity 20, member CCGCCCGTCGTGAATTCA36731119123FAM20C
CLEC16AC-type lectin domain family 16, member ACTTCGTGGGTACTGAAC1221024125CLEC16A
INF2Inverted formin, FH2 and WH2 domain containingTCCAGCCCCTGAAGTTG1841648124INF2
BMP7Bone morphogenetic protein 7TGGAACCCGGTCTTGTG2041812BMP7Ref:BPM7
ZDHHC6Zinc finger, DHHC-type containing 6, transmembrane protein 4TGGTACTTCTCTTTTCCAATGGATGTT1,1285925112ZDHHC6
PPAP2BPhosphatidic acid phosphatase type 2BATGTAGGTGCCACCCACAACCACATGC65418416119112PPAP2BRef:PPA2B
TXNIPThioredoxin interacting proteinAGAAACTAGAGGGCAGG102911TXNIP
ITGA3Integrin, alpha 3GTACTGTAGCAGGGGAACTCCACAGAG18081772241134ITGA3Ref:ITGA3
C19orf63Chromosome 19 open reading frame 63AAAGAGTCGGGGCTGGA82748112C19orf63
IGFBP2Insulin-like growth factor binding protein 2, 36kDaGCCTGTACAACCTCAAACAGGGAGCCC8801,797161961119IGFBP2Ref:IGFBP2
PTGER4Prostaglandin E receptor 4 (subtype EP4)TTTTGTTGCTCAGTGTT3062811PTGER4
FLRT3Fibronectin leucine rich transmembrane protein 3TATTTTTCTAGGCATAA82824113FLRT3
VWA1Von Willebrand factor A domain containing 1CCCAGGACACCAGCTGG53149241122VWA1
LARGELike-glycosyltransferaseAAAGCCCAGTTCTGAAG82824113LARGE
LINGO1Leucine rich repeat and Ig domain containing 1AAGATGATATGAGGCCG1221210LINGO1
MYO1EMyosin IETATGAATGTACTAAGTAATATACTGTA248245269MYO1ERef:MYO1E

Transcripts represented by SAGE tags enriched 10 – 30 fold in glomeruli compared to pooled SAGE libraries. The gene symbol and gene name are shown for each unique NlaIII-anchored long SAGE tag sequence. Where available, the corresponding short Sau3A SAGE tag (Ref 9) is shown. SAGE tag frequencies are shown as Tags per Million (TPM). Sau3A TPM is derived from Ref 9. Enrichment in glomeruli relative to pooled libraries (G:P) and relative to whole kidney (G:K) is shown for each tag. This table with embedded links to SAGE Genie and links to references showing expression and/or function in glomeruli is provided as additional file 4

Transcripts represented by SAGE tags enriched 30 fold or more in glomeruli Transcripts represented by SAGE tags enriched 30 fold or more in glomeruli compared to pooled SAGE libraries from diverse tissues and cells. The gene symbol and gene name are shown for each tag sequence. Where available, the corresponding short Sau3A SAGE tag (Ref 9) is shown. SAGE tag frequencies are shown as Tags per Million (TPM). Sau3A TPM is derived from Ref 9. Enrichment in glomeruli relative to pooled libraries (G:P) and relative to whole kidney (G:K) is shown for each tag. This table with embedded links to SAGE Genie and links to references showing expression and/or function in glomeruli is provided as additional file 3 Transcripts represented by SAGE tags enriched 10 – 30 fold in glomeruli Transcripts represented by SAGE tags enriched 10 – 30 fold in glomeruli compared to pooled SAGE libraries. The gene symbol and gene name are shown for each unique NlaIII-anchored long SAGE tag sequence. Where available, the corresponding short Sau3A SAGE tag (Ref 9) is shown. SAGE tag frequencies are shown as Tags per Million (TPM). Sau3A TPM is derived from Ref 9. Enrichment in glomeruli relative to pooled libraries (G:P) and relative to whole kidney (G:K) is shown for each tag. This table with embedded links to SAGE Genie and links to references showing expression and/or function in glomeruli is provided as additional file 4 A previously published Sau3A-anchored SAGE library [9] prepared from microdissected human glomeruli contained 184 SAGE tags that were enriched in glomeruli relative to other micro-dissected nephron segments. These represented 156 well-characterized transcripts. As expected, the corresponding NlaIII SAGE tag for 143 of these was also observed in the current glomerular SAGE library (Tables 1 and 2 and Additional files 3 and 4 and additional file 2). For 47 transcripts represented in both libraries a 10-fold or greater enrichment of the NlaIII tag relative to non-glomerular cells and tissues was observed and is shown in Tables 1 and 2 and Additional files 3 and 4. The NlaIII tag corresponding to the remaining 96 transcripts identified in the Sau3A library was enriched relative to whole kidney, in keeping with the previous report [9], but less than 10 fold relative to non-renal tissues (additional file 2). Many of the highly expressed and highly enriched transcripts observed in this library are encoded by genes already known to be unique or highly enriched in glomerular podocytes, for instance Podocin (NPHS2), Nephrin (NPHS1), transcription factor 21 (Pod1, FLJ35700), Protein Tyrosine Phosphatase Glepp 1 (PTPRO), Synaptopodin (SYNPO), indicating that this SAGE database appropriately represents glomerular transcripts and that it identifies transcripts enriched in glomeruli. Some of the SAGE tags enriched in glomeruli represent known endothelial cell-predominant genes, for instance Endomucin (EMCN), claudin 5 (CLDN5), NOSTRIN and CD34, consistent with abundant EC in glomeruli. To independently demonstrate the utility of this database in defining enrichment of transcripts in glomeruli, RT-PCR comparing the level of expression of 19 transcripts enriched in the glomerular SAGE library with that in lung, spleen and liver was performed. Lung, liver and spleen were not represented in the pooled SAGE libraries used here. For each, glomeruli microdissected from the kidneys of three distinct donors were used. The source mRNA used for RT-PCR was distinct from that used for generation of the SAGE library. Transcripts were chosen to represent a spectrum of glomerular enrichment, and some well-known podocyte-predominant transcripts (TCF21, VEGFA) were included as internal controls. Overall, the degree of glomerular transcript enrichment observed by RT-PCR compared to lung, liver and spleen was similar to that observed by SAGE, though there was variation between lung, spleen and liver (Table 3). The wide range of expression observed in the three non-glomerular tissues was expected, as the pooled SAGE-based comparison does not take into account tissue-to-tissue variation in gene expression.
Table 3

Ratio of mRNA abundance in glomeruli compared to lung, spleen and liver.

SAGERT-PCR
SymbolNameLongTagG: TPMP: TPMRatio G: PG: LuG: SpG: Li
SOSTSclerosteosisACATATGAAAGCCTGCA820.00Infinity130 ± 4813007 ± 48277969 ± 2957
TCF21Transcription factor 21CGAGTGCTGAGCAAGGC8171.5951449 ± 1627 ± 9384 ± 123
FGF1Fibroblast growth factor 1 (acidic)TAAAGGCCTTTAATAAG1020.49210490 ± 70166 ± 232565 ± 367
SPOCK2sparc/osteonectin, cwcv and kazal-like domainsTGTGGAGTGTACTTGTT2451.4417045 ± 1339 ± 12258 ± 75
PTHR1Parathyroid hormone receptor 1TGACCAGGCGCTGGGGG11438141196 ± 5551 ± 1430 ± 8
EFNB1Ephrin-B1AGGGAAGAGGAAAGTGC1021.506820 ± 417 ± 330 ± 6
CDKN1CCyclin-dependent kinase inhibitor 1C (p57, Kip2)TAGCAGCAACCGGCGGC1021462251 ± 1745 ± 15198 ± 66
IGFBP5Insulin-like growth factor binding protein 5GAGTACGTTGACGGGGA367182010 ± 422 ± 943 ± 17
CLDN5Claudin 5GACCGCGGCTTCCGCCG71538195 ± 127 ± 724 ± 6
FAM65AFamily with sequence similarity 65, member AGGTTCCTGGTGCCCCTT755431718 ± 511 ± 351 ± 15
FOXC1Forkhead box C1AGCCTGTACGCGGCCGG245151725 ± 6302 ± 74452 ± 110
C9orf58Chromosome 9 open reading frame 58GGAGTGTGCGTGGACTG15721021536 ± 32 ± 0171 ± 16
NESNestinTGCTGACTCCCCCCATC20011381422 ± 623 ± 6339 ± 84
VEGFAVascular endothelial growth factor ATTTCCAATCTCTCTCTC14501091316 ± 453 ± 1222 ± 5
ZDHHC6Zinc finger, DHHC-type containing 6TGGTACTTCTCTTTTCC5925112Infinity60 ± 18Infinity
MYO1EMyosin IETATGAATGTACTAAGTA24526911 ± 321 ± 613 ± 3
MYL9Myosin, light chain 9, regulatoryGGAGTGTGCTCAGGAGT328745474 ± 115 ± 445 ± 11
ITM2BIntegral membrane protein 2BTCACCTTAGGTAGTAGG332850874 ± 14 ± 15 ± 1
MYO1DMyosin IDATTGTAGACAATGAGGG3278243 ± 07 ± 17 ± 1

The SAGE tag frequency in glomeruli (G: TPM) and SAGE library pool (P: TPM) as well as the relative SAGE tag enrichment in glomeruli (Ratio G: P) is shown. The transcript abundance relative to lung (G: Lu), spleen (G: Sp) and liver (G: Li) was determined by RT-PCR using distinct sets of microdissected glomeruli from kidneys of three different donors. G: glomeruli, Lu: lung, Sp: spleen, Li: liver. Mean ± SEM.

Ratio of mRNA abundance in glomeruli compared to lung, spleen and liver. The SAGE tag frequency in glomeruli (G: TPM) and SAGE library pool (P: TPM) as well as the relative SAGE tag enrichment in glomeruli (Ratio G: P) is shown. The transcript abundance relative to lung (G: Lu), spleen (G: Sp) and liver (G: Li) was determined by RT-PCR using distinct sets of microdissected glomeruli from kidneys of three different donors. G: glomeruli, Lu: lung, Sp: spleen, Li: liver. Mean ± SEM. Finally, it is of note that 117 transcript tags observed 2 or more times and enriched > 500 fold in this glomerular library remain unidentified or poorly characterized (additional file 1). At least some of these will likely prove to be currently unknown glomerulus-predominant transcripts.

In Silico Interrogation of the Glomerular SAGE Database

The current database can be retrieved directly or interrogated in silico. It may be used to determine whether any specific gene is highly expressed in glomeruli, and to define transcripts that are highly enriched relative to other tissues for which SAGE libraries are available. To assess whether a specific transcript is expressed in glomeruli, the SAGE tags uniquely identifying the transcript can be found at http://cgap.nci.nih.gov/SAGE/ using the "SAGE Anatomic Viewer" [21]. The "Digital Northern" tool is then used to evaluate the level of expression in the SAGE libraries of the collection, which includes the current library. The collection can also be interrogated using specific NlaIII SAGE tags of cDNA sequences for which a gene symbol may not yet have been assigned. The tag can be retrieved from any cDNA sequence by identifying the 17-nt sequence immediately 3' of the last NlaIII site (CATG) prior to the poly(A+) tail. Its frequency in the glomerular database is an indicator of the level of expression in human glomeruli. The 95% confidence interval for observing any tag with a true count of 4 is ± 3.96. Hence, any transcript producing a tag frequency of 4 per 48,905 (81.8 TPM) or greater has a 95% probability of being represented in this library. Failure to find the SAGE tag representing any specific transcript in this library indicates that its expression level is lower than the limit of detection, or that the transcript does not contain an NlaIII restriction site from which a SAGE tag could be generated. The "LSAGE_Kidney_Glomeruli_Normal_B_bjballer1" database can also be compared directly to a single, or sets of other SAGE databases in the SAGE Genie collection using the "SAGE Digital Gene Expression Displayer (DGED)" tool at http://cgap.nci.nih.gov/SAGE/. This type of analysis will return data similar to those in additional file 1, though comparison can also be restricted to specific libraries rather than the pool of libraries evaluated here. Finally, this SAGE library with matching transcript identification, glomerulus to pool ratio and glomerulus to kidney ratio is supplied as additional file 1, where the order is based on tag abundance. This data set contains only 18,152 SAGE tags, as any tag found only once and not in any other library was removed. The table can be retrieved without restriction and, if desired, sorted based on the degree of tag enrichment.

Discussion

This study established a human glomerular SAGE library that can be used for data mining by investigators with an interest in glomerular cell biology and pathophysiology. The library was appropriately enriched in SAGE tags representing transcripts known to be restricted to glomerular podocytes, including nephrin [24], podocin [25], synaptopodin [26], podocalyxin [27], transcription factor 21 [28], the protein tyrosine phosphatase receptor type O GLEPP1 [29], the cyclin dependent kinase inhibitor C1 [30] and nestin [31]. It is therefore likely that other transcripts whose SAGE tags are much more highly represented in this library compared to SAGE libraries from other tissues and cells are also expressed predominantly in glomeruli. A SAGE library that used Sau3A as the anchoring restriction enzyme was previously produced from human glomerular mRNA [9]. It identified 155 highly expressed transcripts in glomeruli that were enriched in glomeruli when compared to microdissected non-glomerular nephron segments. Since the previously published glomerular SAGE library is based on the Sau3A anchoring restriction site, it does not allow in silico comparison of tag frequencies with the much greater collection of NlaIII-based SAGE libraries. All except 12 transcripts reported to be enriched in glomeruli by Chabardes-Garonne [9] were observed in the current glomerular SAGE library. The corresponding NlaIII tag for a subset of these (47 tags) was enriched > 10 fold when compared to non-renal tissues and cells (Tables 1 and 2 and Additional files 3 &4), providing independent evidence that these represent glomerulus-predominant transcripts. The current study also identified 86 transcript tags that were enriched more than 10 fold in glomeruli, but which were not represented in the previous Sau3A anchored library (Tables 1 and 2 and Additional files 3 &4). Failure to find a Sau3A SAGE tag for known glomerulus-restricted genes like nephrin, or an NlaIII SAGE tag for endoglin and VCAM1, suggests either that the tag frequency was too low to be detected or that the required restriction site was absent from the transcript. The current study also shows that that several transcripts more highly expressed in glomeruli compared to other nephron segments [9] are not restricted to glomeruli when compared to non-renal tissues or cells (additional file 2). This is not surprising since some transcripts that are not shared between nephron epithelium and glomerular capillary tuft nevertheless may be highly expressed in other tissues. Several transcripts not previously shown to have a specific function in glomeruli were highly expressed and enriched in glomeruli when compared to non-glomerular tissues. Among these, the tag for the chloride intracellular channel 5 (CLIC5) is very abundant in the glomerular transcript pool, and its frequency in glomeruli was more than 800 fold greater than in other tissues. The transcript "DKFZp564B076" whose SAGE tag was previously shown to be enriched in microdissected glomeruli [9] and later in cultured glomerular EC in this laboratory [22] is identical to the 3' end of CLIC5. CLIC5 is an ezrin-binding protein involved in maintaining actin-based microvilli in the placenta and actin-based stereocilia in the inner ear [32]. Its role in glomerular cell function is as yet undefined. The transcript for the basal cell adhesion molecule (BCAM) is also very abundant in glomeruli and enriched approximately 58 fold. BCAM is a glycoprotein that functions as a receptor for alpha5 laminin. BCAM immunoreactivity is observed in both, glomerular podocytes and glomerular EC, and mice deficient in BCAM have significant structural abnormalities of glomeruli [33]. Glomerular expression of the parathyroid hormone receptor 1 (PTHR1) was not expected. PTHR1 is very abundant in renal proximal tubule cells and could therefore represent proximal tubule contamination. However, since the PTHR1 SAGE tag was less abundant in renal cortex than in glomeruli (Table 1 and Additional file 3), its enrichment in this library cannot be due to proximal tubule contamination. Indeed, mesangial cells express PTHR1 [34]. More work is required to define the function of PTHR1 in mesangial cells. In this regard, it is of great interest that Sclerostin, an inhibitor of bone matrix formation whose expression is regulated by PTH, is also expressed at much higher levels in glomeruli than in most non-renal tissues and cells (Table 1 and Additional file 3) or in other nephron segments [9]. While we have no comparison with a bone SAGE library where sclerostin is likely expressed at high levels, the finding nonetheless suggests that it could be involved in regulating extracellular matrix depositon in glomeruli. Nephronectin, a ligand for integrin alpha8beta1 is known to be essential for renal development, and is expressed in renal epithelium. Enrichment of the nephronectin SAGE tag in the glomerular library relative to kidney cortex is in keeping with the observation by Brandenberger et al [35], who observed very strong nephronectin immunoreactivity in differentiating glomeruli. The secreted glycoprotein testican 2 SPARC (SPOCK2) belongs to in the osteonectin/SPARC family [36] is also highly expressed and enriched in glomeruli. Members of this family of proteins regulate cell-cell and cell-matrix interactions, and SPOCK2 is induced after glomerular injury [37]. The other protein in this family is connective tissue growth factor (CTGF). The SAGE tag for CTGF was observed at a high frequency in glomeruli (additional file 1) but it was not highly enriched relative to other tissues. Nonetheless, both SPOCK2 and CTGF likely play a critical role in regulating glomerular remodeling. In 2006 Lakhe-Reddy and coworkers [38] described the localization of beta 8 integrin to glomerular mesangial cells and observed that its expression may suppress mesangial cell dedifferentiation via Rac1 activation. The SAGE tag for integrin beta 8 was highly expressed and enriched in this glomerular library. While several semaphorins are expressed in renal glomeruli, so far a role for semaphorin 3G, whose SAGE tag is abundant and enriched in this database, has not been described. Still, semphorin 3G, which has repulsive function via neuropilin 2 binding in the CSN neuronal guidance, is also highly expressed in kidney [39], begging the question whether it serves an important function is in glomeruli. Based on this study many other transcripts are highly enriched in glomeruli. It is hoped that other investigators will use this database as a tool to further define the transcriptome of glomerular cells in health and disease. We did not observe the NlaIII SAGE tag for EHD3, a transcript previously shown to be unique for glomerular endothelial cells [12], in this library. A SAGE tag for EHD3 also is not observed in the previously published Sau3A-anchored library [9]. Failure to observe this tag does not detract from the previous observations but only suggests that the EHD3 transcript abundance was too low to generate a SAGE tag in the two glomerular SAGE libraries. Finally, not all tags observed in this SAGE library have as yet been matched to a specific gene. For some of these unidentified SAGE tags, matching sequences within the human genome are observed, but whether they represent specific transcripts is currently not known.

Conclusion

We have constructed a new human glomerular SAGE library, based on the NlaIII anchoring restriction site. The database can be searched to determine whether specific transcripts are highly expressed and/or enriched in glomeruli and it can be used a resource to further study transcripts that appear to be glomerulus-enriched but whose function in glomeruli has not been investigated so far.

Availability and requirements

The SAGE database (GEO Accession #GSM199994) described here is available for download from http://www.ncbi.nlm.nih.gov/geo/. It can also be downloaded from, or interrogated in silico at http://cgap.nci.nih.gov/SAGE/ without restriction. The annotated database containing Tag sequences, glomerular frequencies, gene identification, as well as frequency ratios to pooled and kidney libraries is available as additional file 1.

Abbreviations

SAGE: Serial Analysis of Gene Expression; TPM: Tags per million; RT-PCR: Reverse Transcriptase Polymerase Chain Reaction; WT-1: Wilms Tumor 1; EC: Endothelial Cell(s); EST: Expressed Sequence Tag; cDNA: Complementary DNA; bp: base pair.

Authors' contributions

WF, JN and BJB developed the conceptual design of the study. Contributions by WF and JN were equivalent. WF isolated human glomeruli and prepared RNA from glomeruli for construction of the SAGE library, and performed work shown in Figure 1. AG microdissected human glomeruli for RT-PCR analysis. JN performed RT-PCR on microdissected human glomeruli. SK performed immunofluorescence analysis. BJB performed the bioinformatics work and wrote the manuscript. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2369/10/13/prepub

Additional file 1

Annotated NlaIII-anchored human glomerular long SAGE library. Additional file 1 contains all (18,152) NlaIII-anchored long SAGE tags observed in the current glomerular library and at least twice in this + currently reported long SAGE libraries. The SAGE tags are sorted by frequency (a measure of expression of the corresponding transcript). Genes matched to each tag, chromosomal localization, absolute SAGE tag count in the glomerular library, frequency (TPM) in the glomerular and the pooled libraries and the ratio of glomerular: pooled frequencies are shown. Absolute counts and TPM for the corresponding short NlaIII-based SAGE tag in whole kidney and the ratio of SAGE tag TPM in glomeruli: kidney are shown. The dataset can be downloaded without restriction. Click here for file

Additional file 2

SAGE tags observed NlaIII and Sau3A glomerular libraries but enriched less than 10 fold. This dataset represents all Sau3A tags reported by Chabardes-Garonne (9) to be enriched in glomeruli when compared to microdissected nephron segments that were also observed in the current NlaIII anchored library, but for which the corresponding NlaIII tags were enriched less than 10 fold when compared to pooled non-renal tissues and cells. Click here for file

Additional file 3

Transcripts identfied for SAGE tags enriched 30 fold or more in Glomeruli compared to pooled SAGE libraries from diverse tissues and cells. The gene symbol and gene name are shown for each tag sequence. Where available, the corresponding short Sau3A SAGE tag (Ref 9) is shown. SAGE tag frequencies are shown as Tags per Million (TPM). Sau3A TPM is derived from Ref 9. Enrichment in glomeruli relative to pooled libraries (G:P) and relative to whole kidney (G:K) is shown for each tag. Click here for file

Additional file 4

Transcripts name for SAGE tags enriched 10 - 25 fold in Glomeruli compared to pooled SAGE libraries. The gene symbol and gene name are shown for each unique NlaIII-anchored long SAGE tag sequence. Where available, the corresponding short Sau3A SAGE tag (Ref 9) is shown. SAGE tag frequencies are shown as Tags per Million (TPM). Sau3A TPM is derived from Ref 9. Enrichment in glomeruli relative to pooled libraries (G:P) and relative to whole kidney (G:K) is shown for each. tag. Click here for file
  39 in total

1.  POWER_SAGE: comparing statistical tests for SAGE experiments.

Authors:  M Z Man; X Wang; Y Wang
Journal:  Bioinformatics       Date:  2000-11       Impact factor: 6.937

2.  Real-time detection of gene promoter activity: quantitation of toxin gene transcription.

Authors:  K Jeyaseelan; D Ma; A Armugam
Journal:  Nucleic Acids Res       Date:  2001-06-15       Impact factor: 16.971

3.  Glomerulus-specific mRNA transcripts and proteins identified through kidney expressed sequence tag database analysis.

Authors:  L He; Y Sun; J Patrakka; P Mostad; J Norlin; Z Xiao; J Andrae; K Tryggvason; T Samuelsson; C Betsholtz; M Takemoto
Journal:  Kidney Int       Date:  2007-02-28       Impact factor: 10.612

4.  NPHS2, encoding the glomerular protein podocin, is mutated in autosomal recessive steroid-resistant nephrotic syndrome.

Authors:  N Boute; O Gribouval; S Roselli; F Benessy; H Lee; A Fuchshuber; K Dahan; M C Gubler; P Niaudet; C Antignac
Journal:  Nat Genet       Date:  2000-04       Impact factor: 38.330

Review 5.  SPARC and the kidney glomerulus: matricellular proteins exhibit diverse functions under normal and pathological conditions.

Authors:  A Francki; E H Sage
Journal:  Trends Cardiovasc Med       Date:  2001-01       Impact factor: 6.677

Review 6.  The glomerular transcriptome and proteome.

Authors:  Christer Betsholtz; Liqun He; Minoru Takemoto; Jenny Norlin; Ying Sun; Jaakko Patrakka; Karl Tryggvason
Journal:  Nephron Exp Nephrol       Date:  2007-06-06

7.  Genetic inactivation of the laminin alpha5 chain receptor Lu/BCAM leads to kidney and intestinal abnormalities in the mouse.

Authors:  Cécile Rahuel; Anne Filipe; Léa Ritie; Wassim El Nemer; Natacha Patey-Mariaud; Dominique Eladari; Jean-Pierre Cartron; Patricia Simon-Assmann; Caroline Le Van Kim; Yves Colin
Journal:  Am J Physiol Renal Physiol       Date:  2007-11-21

Review 8.  A prototypic matricellular protein in the tumor microenvironment--where there's SPARC, there's fire.

Authors:  Clancy J Clark; E Helene Sage
Journal:  J Cell Biochem       Date:  2008-06-01       Impact factor: 4.429

9.  The basic-helix-loop-helix protein pod1 is critically important for kidney and lung organogenesis.

Authors:  S E Quaggin; L Schwartz; S Cui; P Igarashi; J Deimling; M Post; J Rossant
Journal:  Development       Date:  1999-12       Impact factor: 6.868

10.  Identification and characterization of a novel extracellular matrix protein nephronectin that is associated with integrin alpha8beta1 in the embryonic kidney.

Authors:  R Brandenberger; A Schmidt; J Linton; D Wang; C Backus; S Denda; U Müller; L F Reichardt
Journal:  J Cell Biol       Date:  2001-07-23       Impact factor: 10.539

View more
  14 in total

1.  CLIC5A, a component of the ezrin-podocalyxin complex in glomeruli, is a determinant of podocyte integrity.

Authors:  Binytha Wegner; Abass Al-Momany; Stephen C Kulak; Kathy Kozlowski; Marya Obeidat; Nadia Jahroudi; John Paes; Mark Berryman; Barbara J Ballermann
Journal:  Am J Physiol Renal Physiol       Date:  2010-03-24

2.  Mesangial cell integrin αvβ8 provides glomerular endothelial cell cytoprotection by sequestering TGF-β and regulating PECAM-1.

Authors:  Shenaz Khan; Sujata Lakhe-Reddy; Joseph H McCarty; Christine M Sorenson; Nader Sheibani; Louis F Reichardt; Jane H Kim; Bingcheng Wang; John R Sedor; Jeffrey R Schelling
Journal:  Am J Pathol       Date:  2011-02       Impact factor: 4.307

3.  Systematic analysis of a novel human renal glomerulus-enriched gene expression dataset.

Authors:  Maja T Lindenmeyer; Felix Eichinger; Kontheari Sen; Hans-Joachim Anders; Ilka Edenhofer; Deborah Mattinzoli; Matthias Kretzler; Maria P Rastaldi; Clemens D Cohen
Journal:  PLoS One       Date:  2010-07-12       Impact factor: 3.240

Review 4.  Membranous nephropathy: from models to man.

Authors:  Laurence H Beck; David J Salant
Journal:  J Clin Invest       Date:  2014-06-02       Impact factor: 14.808

5.  The Prediction of Key Cytoskeleton Components Involved in Glomerular Diseases Based on a Protein-Protein Interaction Network.

Authors:  Fangrui Ding; Aidi Tan; Wenjun Ju; Xuejuan Li; Shao Li; Jie Ding
Journal:  PLoS One       Date:  2016-05-26       Impact factor: 3.240

6.  Dual involvement of growth arrest-specific gene 6 in the early phase of human IgA nephropathy.

Authors:  Kojiro Nagai; Masashi Miyoshi; Takei Kake; Naoshi Fukushima; Motokazu Matsuura; Eriko Shibata; Satoshi Yamada; Kazuhiro Yoshikawa; Hiro-Omi Kanayama; Tomoya Fukawa; Kunihisa Yamaguchi; Hirofumi Izaki; Akira Mima; Naoko Abe; Toshikazu Araoka; Taichi Murakami; Fumi Kishi; Seiji Kishi; Tatsuya Tominaga; Tatsumi Moriya; Hideharu Abe; Toshio Doi
Journal:  PLoS One       Date:  2013-06-24       Impact factor: 3.240

7.  Identification of nephropathy candidate genes by comparing sclerosis-prone and sclerosis-resistant mouse strain kidney transcriptomes.

Authors:  Ashraf El-Meanawy; Jeffery R Schelling; Sudha K Iyengar; Patrick Hayden; Shrinath Barathan; Katrina Goddard; Fatima Pozuelo; Essam Elashi; Viji Nair; Matthias Kretzler; John R Sedor
Journal:  BMC Nephrol       Date:  2012-07-19       Impact factor: 2.388

8.  Digital gene expression analysis of two life cycle stages of the human-infective parasite, Trypanosoma brucei gambiense reveals differentially expressed clusters of co-regulated genes.

Authors:  Nicola J Veitch; Paul C D Johnson; Urmi Trivedi; Sandra Terry; David Wildridge; Annette MacLeod
Journal:  BMC Genomics       Date:  2010-02-22       Impact factor: 3.969

9.  Renal Mechanisms of Association between Fibroblast Growth Factor 1 and Blood Pressure.

Authors:  Maciej Tomaszewski; James Eales; Matthew Denniff; Stephen Myers; Guat Siew Chew; Christopher P Nelson; Paraskevi Christofidou; Aishwarya Desai; Cara Büsst; Lukasz Wojnar; Katarzyna Musialik; Jacek Jozwiak; Radoslaw Debiec; Anna F Dominiczak; Gerjan Navis; Wiek H van Gilst; Pim van der Harst; Nilesh J Samani; Stephen Harrap; Pawel Bogdanski; Ewa Zukowska-Szczechowska; Fadi J Charchar
Journal:  J Am Soc Nephrol       Date:  2015-04-27       Impact factor: 10.121

10.  Plasma Proteomics of Renal Function: A Trans-ethnic Meta-analysis and Mendelian Randomization Study.

Authors:  Pamela Matías-García; Rory Wilson; Qi Guo; Shaza Zaghlool; James Eales; Xiaoguang Xu; Fadi Charchar; John Dormer; Haifa Maalmi; Pascal Schlosser; Mohamed Elhadad; Jana Nano; Sapna Sharma; Annette Peters; Alessia Fornoni; Dennis Mook-Kanamori; Juliane Winkelmann; John Danesh; Emanuele Di Angelantonio; Willem Ouwehand; Nicholas Watkins; David Roberts; Agnese Petrera; Johannes Graumann; Wolfgang Koenig; Kristian Hveem; Christian Jonasson; Anna Köttgen; Adam Butterworth; Marco Prunotto; Stefanie Hauck; Christian Herder; Karsten Suhre; Christian Gieger; Maciej Tomaszewski; Alexander Teumer; Melanie Waldenberger
Journal:  J Am Soc Nephrol       Date:  2021-06-16       Impact factor: 14.978

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.