Literature DB >> 19426479

A suite of recombinant luminescent bacterial strains for the quantification of bioavailable heavy metals and toxicity testing.

Angela Ivask1, Taisia Rõlova, Anne Kahru.   

Abstract

BACKGROUND: Recombinant whole-cell sensors have already proven useful in the assessment of the bioavailability of environmental pollutants like heavy metals and organic compounds. In this work 19 recombinant bacterial strains representing various Gram-positive (Staphylococcus aureus and Bacillus subtilis) and Gram-negative (Escherichia coli, Pseudomonas fluorescens) bacteria were constructed to express the luminescence encoding genes luxCDABE (from Photorhabdus luminescens) as a response to bioavailable heavy metals ("lights-on" metal sensors containing metal-response elements, 13 strains) or in a constitutive manner ("lights-off" constructs, 6 strains).
RESULTS: The bioluminescence of all 13 "lights-on" metal sensor strains was expressed as a function of the sub-toxic metal concentrations enabling the quantitative determination of metals bioavailable for these strains. Five sensor strains, constructed for detecting copper and mercury, proved to be target metal specific, whereas eight other sensor strains were simultaneously induced by Cd2+, Hg2+, Zn2+and Pb2+. The lowest limits of determination of the "lights-on" sensor strains for the metals tested in this study were (microg l-1): 0.002 of CH3HgCl, 0.03 of HgCl2, 1.8 of CdCl2, 33 of Pb(NO3)2, 1626 of ZnSO4, 24 of CuSO4 and 340 of AgNO3. In general, the sensitivity of the "lights-on" sensor strains was mostly dependent on the metal-response element used while the selection of host bacterium played a relatively minor role. In contrast, toxicity of metals to the "lights-off" strains was only dependent on the bacterial host so that Gram-positive strains were remarkably more sensitive than Gram-negative ones.
CONCLUSION: The constructed battery of 19 recombinant luminescent bacterial strains exhibits several novel aspects as it contains i) metal sensor strains with similar metal-response elements in different host bacteria; ii) metal sensor strains with metal-response elements in different copies and iii) a "lights-off" construct (control) for every constructed recombinant metal sensor strain. To our knowledge, no Gram-positive metal sensor expressing a full bacterial bioluminescence cassette (luxCDABE) has been constructed previously.

Entities:  

Mesh:

Substances:

Year:  2009        PMID: 19426479      PMCID: PMC2685376          DOI: 10.1186/1472-6750-9-41

Source DB:  PubMed          Journal:  BMC Biotechnol        ISSN: 1472-6750            Impact factor:   2.563


Background

The use of microbial cells for ecotoxicological analysis as well as for the toxicological screening of various chemicals is increasing. A variety of whole-cell sensors based on natural or genetically modified microbes has been developed for this purpose. In general, there are two strategies for developing such microbial sensors: one utilizes microbes expressing the reporting signal e.g., bioluminescence constitutively ("lights-off" bacterial strains) and the other in chemical/effect-induced manner ("lights-on" sensors). The "lights-off" bacterial strains have been extensively used for toxicity testing of pure compounds as well as environmental samples [1,2] already for decades. The most popular such tests are Microtox®, BioTox™, LUMIStox™, ToxAlert™, which measure the effect of the sample on the luminescence of a naturally bioluminescent bacterium Vibrio fischeri [3]. "Lights-on" sensors are usually recombinant microbial cells containing a metal-response unit (traditionally a transcriptional regulator and its controlled promoter) fused to a promoterless reporter gene encoding for the reporting signal. Upon the presence of a bioavailable compound of interest (heavy metal or an organic compound/group of compounds), its entrance to the sensor cell and subsequent binding to the transcriptional regulator the expression of a reporter gene will take place. β-galactosidase, GFP and bioluminescence (the most favourable) have been used most often for reporter applications (reviewed in [4]). For environmental applications, LuxCDABE (a whole bacterial gene cassette required for the production of bioluminescence) is the most suitable reporter, primarily due to rapidity and ease of use. The first recombinant luminescent "lights-on" sensors were constructed in 1991 for naphthalene [5] and mercury [6]. Since then, a number of papers on bacterial strains "sensing" inorganic substances (mainly heavy metals or metalloids) but also organic compounds (e.g., benzene and its derivatives, naphthalene, polychlorinated biphenyls) have been published (reviewed in [4,7]). Currently, recombinant bacterial "lights-on" heavy metal sensors expressing bacterial bioluminescence system as a reporter include sensors for Cd, Pb [8], Hg [8-12], Cr [8], Ni, Co [13], Zn, Cu [8,14,15] and As [16]. In most of these sensors, the bioluminescence-encoding genes from Vibrio fischeri (that may become labile in temperatures above 30°C [4] and thus, restrict testing) has been used. Most of these papers describe just a few sensors that are often based on Escherichia coli [9,10,12,14] orsome other Gram-negative bacterium from the genera Pseudomonas or Alcaligenes [8,11,13,15] as a host. Thus, Gram-positive bacteria have rarely been used as hosts and no Gram-positive metal sensors expressing luxCDABE as a reporter have been constructed so far. The recombinant luminescent sensor bacteria have been used for the assessment of bioavailable (the fraction entering the cells and inducing bioluminescence) metals from soils or water bodies [8,11,13,15,17]. However, due to the complexity of the environmental samples (colour, turbidity, mixed pollution) and the sensitivity of the used reporter system (bioluminescence is closely related to the energetic status of the cell [18]), several researchers [13,17,19-24] have recognized the need for relevant controls which enable accounting for unspecific effects of the sample. This paper reports on the development of a battery of recombinant bioluminescent bacterial heavy metal "lights on" sensors accompanied by corresponding bioluminescent non-specific "lights off" control strains.

Results

Luminescent Gram-negative strains

Escherichia coli-based strains

Escherichia coli is an enteric Gram-negative bacterium with the sequenced genome [25], well developed methods for genetic modification [26] and various laboratory strains available. Although the relevance of this bacterium for environmental testing is questionable, it has been widely used in the construction of various bacterial sensors [9,10,12,14,17], mainly due to its compatibility with the chemical-response elements used. In total three new E. coli MC1061 recombinant luminescent sensor strains expressing luxCDABE genes in response to subtoxic concentrations of bioavailable heavy metals ("lights-on" sensors) were constructed: E. coli MC1061(pmerRBSBPmerlux), E. coli MC1061(pSLcueR/pDNPcopAlux) and E. coli MC1061(pSLzntR/pDNPzntAlux) (Table 1). All the strains harbour plasmid(s) containing metal-response elements from resistance systems for Hg (from Serratia marcescens plasmid [27]; mer), Cu (cue/cop) and Zn (znt) (both from E. coli chromosome [28,29]) fused with the luxCDABE cassette [see Additional file 1]. MC1061(pSLcueR/pDNPcopAlux) and MC1061(pSLzntR/pDNPzntAlux) contain two plasmids necessary for sensor function, of which one (pSLzntR or pSLcueR, respectively) is present in bacterial cells in high copy number and contains genes for the regulatory proteins (or ). The other plasmid (pDNPzntAlux or pDNPcopAlux, respectively) present in medium copy number contains the lux-genes fused to a promoter (Por P) controlled by the regulatory proteins. Location of the genes for regulatory protein and the corresponding promoter in different plasmids yields high regulatory protein to promoter ratio necessary to reduce the unfavourably high level of leakage of the Pand Pand thus, high background luminescence of those strains (Table 1). Characteristics (number of cells in the test, background luminescence, maximum induction) of the constructed sensors are presented in Table 1. Induction profiles of those sensor strains with seven tested heavy metals are presented in Figure 1 and resepective limits of determination in Table 1.
Table 1

Characteristics of Escherichia coli MC1061-based luminescent heavy metal sensors and toxicity control strains

Sensor strainsControl strains

MC1061(pmerRBSBPmerlux)MC1061(pSLzntR/pDNPzntAlux)MC1061 (pSLcueR/pDNPcopAlux)MC1061(pSLlux)aMC1061(pDNlux)b

Background luminescencec230 ± 902940 ± 930520 ± 70575000 ± 352006500 ± 2270
Maximum inductiond40020100no inductionno induction
No of cells in the test (100 μl)4 × 1071078 × 1068 × 106107
CompoundLimit of determinatione/Toxicityf, M (mg of compound l-1)Toxicity (2-h EC50g), M (mg of compound l-1)

HgCl210-10 (0.00003)/5 × 10-6 (1.4)8 × 10-8 (0.02)/10-5 (2.7)no induction10-6 (0.4)10-6 (0.4)
CH3HgCl8 × 10-12 (0.000002)/5 × 10-8 (0.01)not testednot tested3 × 10-6 (0.7)not tested
CdCl23 × 10-7 (0.06)/5 × 10-4 (92)10-8 (0.003)/5 × 10-6 (0.9)no induction4 × 10-4 (70)2 × 10-4 (31)
ZnSO4hno induction5 × 10-6 (0.8)/5 × 10-2 (8000)no induction10-2 (1600)4 × 10-3 (640)
Pb(NO3)2no induction7 × 10-7 (0.2)/10-3 (330)no induction2.4 × 10-4 (79)6 × 10-4 (190)
CuSO4inot testednot tested10-7 (0.02)/10-3 (240)not tested5.4 × 10-4 (86)
AgNO3not testednot tested2 × 10-6 (0.3)/10-5 (2.6)not tested2 × 10-6 (0.3)

a control for MC1061(pmerRBSBPmerlux)

b control for MC1061(pSLcueR/pDNPcopAlux) and MC1061(pSLzntR/pDNPzntAlux)

c luminescence (relative light units, RLU) of 100 μl of bacterial suspension before the test as measured by plate luminometer Fluoroskan (ThermoLabsystems). Average of at least three assays

d as fold over the (non-induced) background

e see equation 4 in Methods

f the lowest tested concentration causing a measurable decrease in the bioluminescence of the sensor strains (read from concentration-induction curves in Figure 1)

g concentration causing 50% decrease in bioluminescence production (calculated from Figure 2)

h tested as ZnSO4 × 7H2O

i tested as CuSO4 × 5H2O

Figure 1

Induction of luminescence (expressed as normalized luminescence) by heavy metals in different sensor strains. Names of sensors and symbols for heavy metals are indicated. Data represent mean ± SD of three independent measurements.

Characteristics of Escherichia coli MC1061-based luminescent heavy metal sensors and toxicity control strains a control for MC1061(pmerRBSBPmerlux) b control for MC1061(pSLcueR/pDNPcopAlux) and MC1061(pSLzntR/pDNPzntAlux) c luminescence (relative light units, RLU) of 100 μl of bacterial suspension before the test as measured by plate luminometer Fluoroskan (ThermoLabsystems). Average of at least three assays d as fold over the (non-induced) background e see equation 4 in Methods f the lowest tested concentration causing a measurable decrease in the bioluminescence of the sensor strains (read from concentration-induction curves in Figure 1) g concentration causing 50% decrease in bioluminescence production (calculated from Figure 2) h tested as ZnSO4 × 7H2O i tested as CuSO4 × 5H2O Induction of luminescence (expressed as normalized luminescence) by heavy metals in different sensor strains. Names of sensors and symbols for heavy metals are indicated. Data represent mean ± SD of three independent measurements. In parallel with sensors, two E. coli toxicity control ("lights-off") strains: MC1061(pSLlux) and MC1061(pDNlux) were constructed (Table 1). These constitutively luminescent strains lacking metal-response elements contain plasmids in which the luxCDABE genes were either under the lac promoter (pSLlux) or T7 promoter (pDNlux). Indeed, within the limits of error, the control strains were not induced by the heavy metals (Figure 2) and inhibition of bioluminescence (NL) was observed with increasing metal concentrations. Toxicity (2-h EC50 values) of the seven tested heavy metals to E. coli MC1061(pSLlux) and MC1061(pDNlux) are presented in Table 1 and respective concentration-effect curves (used for EC50 calculation) in Figure 2.
Figure 2

Toxicity of heavy metals for constitutively luminescent control strains. Toxicity of heavy metals is expressed as inhibition of bioluminescence or decrease in normalized luminescence after 2 hours incubation. Names of strains and symbols for heavy metals are indicated. Data represent mean ± SD of three independent measurements. 2-h EC50 values calculated from these curves are presented in Tables 1-4.

Toxicity of heavy metals for constitutively luminescent control strains. Toxicity of heavy metals is expressed as inhibition of bioluminescence or decrease in normalized luminescence after 2 hours incubation. Names of strains and symbols for heavy metals are indicated. Data represent mean ± SD of three independent measurements. 2-h EC50 values calculated from these curves are presented in Tables 1-4.

Pseudomonas fluorescens – based strains

Pseudomonas fluorescens is a non-pathogenic saphrophyte, which inhabits soil, water and plant surface, often bearing the ability to degrade various pollutants and is thus a very relevant organism for environmental analysis. P. fluorescens has been used as a test organism for general toxicity [30] as well as a host bacterium for constructed recombinant sensors for mercury, arsenic [19], copper [31] but also for phenolic compounds [32]. In the current study eight recombinant luminescent P. fluorescens OS8-based sensor strains were constructed (Tables 2 and 3). Three strains: OS8(pDNmerRBSBPmerlux), OS8(pDNpbrRPpbrAlux) and OS8(pDNcadRPcadAlux) contained the sensor and reporter elements on a plasmid (about 10 copies per cell) and five sensor strains: OS8::KnmerRBSBPmerlux, OS8:: KncueRPcopAlux, OS8::KnzntRPzntAlux, OS8::KnpbrRPpbrAlux and OS8::KncadRPcadAlux contained the sensor and reporter elements as a single chromosomal insertion. The heavy metal response elements used originated from resistance systems for Hg (from Serratia marcescens plasmid [27]; mer), Pb (from Ralstonia metallidurans CH34 plasmid pMOL30 [33]; pbr), Cd (from Pseudomonas putida choromosome [34]; cad), Cu (cue/cop) and Zn (znt) (both from E. coli chromosome [28,29]) [see Additional file 1]. The sensors are characterized in Tables 2 and 3 and their induction profiles with selected heavy metals shown in Figure 1.
Table 2

Characteristics of Pseudomonas fluorescens OS8-based plasmid-containing luminescent heavy metal sensors and toxicity control strains

Sensor strainsControl strain

OS8(pDNmerRBSBPmerlux)OS8(pDNpbrRPpbrAlux)OS8(pDNcadRPcadAlux)OS8(pDNlux)

Background luminescencea1600 ± 5403960 ± 130025900 ± 870064500 ± 6600
Maximum inductionb20076no induction
No of cells in the test (100 μl)5 × 1064 × 1064 × 1065 × 106
CompoundLimit of determinationc/Toxicityd, M (mg of compound l-1)Toxicity (2-h EC50e), M (mg of compound l-1)

HgCl210-9 (0.0003)/10-7 (0.04)10-7 (0.04)/10-6 (0.4)10-7 (0.03)/10-6 (0.4)2.5 × 10-7 (0.07)
CH3HgCl10-10 (0.00003)/10-7 (0.04)not testednot tested2 × 10-6 (0.5)
CdCl25 × 10-6 (0.9)/10-2 (2740)8 × 10-7 (0.2)/5 × 10-4 (92)6 × 10-8 (0.01)/10-4 (18)4 × 10-2 (7300)
ZnSO4fNo induction4 × 10-5 (6.4)/5 × 10-2 (8050)8 × 10-6 (1.3)/3 × 10-2 (4800)3 × 10-2 (4800)
Pb(NO3)2No induction9 × 10-7 (0.3)/10-3 (500)4 × 10-7 (0.1)/10-3 (500)7 × 10-4 (230)
CuSO4gnot testednot testednot testednot tested
AgNO3not testednot testednot testednot tested

a luminescence (relative light units, RLU) of 100 μl of bacterial suspension before the test as measured by plate luminometer Fluoroskan (ThermoLabsystems). Average of at least three assays

b as fold over the (non-induced) background

c see equation 4 in Methods

d the lowest tested concentration causing a measurable decrease in the bioluminescence of the sensor strains (read from concentration-induction curves in Figure 1)

e concentration causing 50% decrease in the bioluminescence production (calculated from Figure 2)

f tested as ZnSO4 × 7H2O

g tested as CuSO4 × 5H2O

Table 3

Characteristics of Pseudomonas fluorescens OS8-based chromosomal luminescent heavy metal sensors and toxicity control strains

Sensor strainsControl strain

OS8::KnmerRBSBPmerluxOS8::KncueRPcopAluxOS8::KnzntRPzntAluxOS8::KnpbrRPpbrAluxOS8::KncadRPcadAluxOS8::Knlux

Background luminescencea1290 ± 2401250 ± 1803530 ± 157084 ± 352860 ± 320600–1400b
Maximum inductionc4007205080no induction
No of cells in the test (100 μl)2 × 1073 × 1076 × 1063 × 1063 × 1073 × 106 – 3 × 107b
CompoundLimit of determinationd/Toxicitye, M (mg of compound l-1)Toxicity (2-h EC50f), M (mg compound l-1)

HgCl23 × 10-9 (0.0008)/5 × 10-6 (1.3)no induction3 × 10-7 (0.08)/5 × 10-6 (1.4)3 × 10-8 (0.008)/10-6 (0.4)2 × 10-8 (0.005)/10-6 (0.4)5 × 10-7 (0.14)
CH3HgCl3 × 10-9 (0.0008)/5 × 10-6 (1.3)not testednot testednot testednot tested2 × 10-6 (0.58)
CdCl25 × 10-5 (9.2)/5 × 10-2 (9150)no induction8 × 10-8 (0.02)/10-2 (2750)8 × 10-8 (0.02)/5 × 10-4 (92)3 × 10-8 (0.006)/5 × 10-3 (915)2 × 10-2 (3660)
ZnSO4gno inductionno induction3 × 10-5 (4.8)/5 × 10-2 (8050)2 × 10-5 (3.2)/10-2 (2420)4 × 10-6 (0.6)/2 × 10-2 (3220)3.5 × 10-2 (5640)
Pb(NO3)2no inductionno induction4 × 10-7 (0.1)/10-3 (500)2 × 10-7 (0.07)/10-3 (500)3 × 10-7 (0.1)/10-3 (500)7 × 10-4 (231)
CuSO4hnot tested5 × 10-5 (8)/10-3 (240)not testednot testednot tested8 × 10-3 (1280)
AgNO3not testedno inductionnot testednot testednot tested5 × 10-7 (0.083)

a luminescence (relative light units, RLU) of 100 μl of bacterial suspension before the test as measured by plate luminometer Fluoroskan (ThermoLabsystems). Average of at least three assays

b cells at different optical densities (see Methods) yielded different RLU values and number of viable cells

c as fold over the (non-induced) background

d see equation 4 in Methods

e the lowest tested concentration causing a measurable decrease in the bioluminescence of the sensor strains (read from concentration-induction curves in Figure 1)

f concentration causing 50% decrease in the bioluminescence production (calculated from Figure 2)

g tested as ZnSO4 × 7H2O

h tested as CuSO4 × 5H2O

Characteristics of Pseudomonas fluorescens OS8-based plasmid-containing luminescent heavy metal sensors and toxicity control strains a luminescence (relative light units, RLU) of 100 μl of bacterial suspension before the test as measured by plate luminometer Fluoroskan (ThermoLabsystems). Average of at least three assays b as fold over the (non-induced) background c see equation 4 in Methods d the lowest tested concentration causing a measurable decrease in the bioluminescence of the sensor strains (read from concentration-induction curves in Figure 1) e concentration causing 50% decrease in the bioluminescence production (calculated from Figure 2) f tested as ZnSO4 × 7H2O g tested as CuSO4 × 5H2O Characteristics of Pseudomonas fluorescens OS8-based chromosomal luminescent heavy metal sensors and toxicity control strains a luminescence (relative light units, RLU) of 100 μl of bacterial suspension before the test as measured by plate luminometer Fluoroskan (ThermoLabsystems). Average of at least three assays b cells at different optical densities (see Methods) yielded different RLU values and number of viable cells c as fold over the (non-induced) background d see equation 4 in Methods e the lowest tested concentration causing a measurable decrease in the bioluminescence of the sensor strains (read from concentration-induction curves in Figure 1) f concentration causing 50% decrease in the bioluminescence production (calculated from Figure 2) g tested as ZnSO4 × 7H2O h tested as CuSO4 × 5H2O In addition to sensors, two toxicity control ("lights-off") strains were constructed (Tables 2 and 3). One of these, P. fluorescens OS8(pDNlux), contained the luxCDABE cassette under the T7 promoter on a plasmid and the other, P. fluorescens OS8::lux, contained the luxCDABE under the lac promoter as a chromosomal insertion. In both strains the bioluminescence was constitutive as within the limits of error they were not induced by the heavy metals (Figure 2). Toxicity (2-h EC50 values) of the tested metals to P. fluorescens OS8(pDNlux) and OS8::lux are presented in Tables 2 and 3 and respective concentration-effect curves in Figure 2.

Luminescent Gram-positive strains

Bacillus subtilis and Staphylococcus aureus were used to construct Gram-positive heavy metal sensor strains. Bacillus subtilis is a spore-forming bacterium common in soils and thus a relevant environmental test organism. Recombinant B. subtilis has earlier been used as a model Gram-positive bacterium for toxicity testing [35] as well as a host for a recombinant bacterial cadmium sensor [36]. Staphylococcus aureus, although not an environmentally relevant bacterium, it may be a medically important model organism as it is an opportunistic human pathogen often bearing multiple antibiotic resistance. Two Gram-positive sensor strains, S. aureus RN4220(pcadCPcadAlux) and B. subtilis BR151(pcadCPcadAlux), in which the luxCDABE genes were under the control of heavy metal-inducible -Psystem from S. aureus plasmid pI258 [36] were constructed. The luxCDABE genes used were modified from Photorhabdus luminescens by optimizing the codon usage and ribosome binding sites for Gram-positive bacteria [37]. The constructed sensors are characterized in Table 4 and their induction profiles with Hg2+, Cd2+, Pb2+, Zn2+ are presented in Figure 1.
Table 4

Characteristics of Staphylococcus aureus and Bacillus subtilis-based luminescent heavy metal sensors and toxicity control strains

Sensor strainsControl strains

S. aureus RN4220 (pcadCPcadAlux)B. subtilis BR151 (pcadCPcadAlux)S. aureus RN4220 (p602/22lux)aB. subtilis BR151 (pBL1/p602/22lux)b

Background luminescencec81 ± 3084 ± 30750 ± 70120 ± 40
Maximum inductiond304no inductionno induction
No of cells in the test (100 μl)107107107107
CompoundLimit of determinatione/Toxicityf, M (mg of compound l-1)Toxicity (2-h EC50g), M (mg of compound l-1)

HgCl210-8 (0.003)/5 × 10-7 (0.1)4 × 10-8 (0.01)/5 × 10-7 (0.1)5 × 10-8 (0.01)10-7 (0.04)
CdCl24 × 10-8 (0.007)/10-5 (2.75)10-8 (0.002)/10-7 (0.027)8 × 10-7 (0.2)3 × 10-6 (0.6)
ZnSO4h2 × 10-5 (3.2)/5 × 10-4 (81)10-5 (1.6)/10-4 (24)8 × 10-5 (13)10-4 (22)
Pb(NO3)210-7 (0.03)/10-3 (500)10-7 (0.03)/10-3 (500)10-3 (530)3 × 10-3 (990)

a control for RN4220(pcadCPcadAlux)

b control for BR51(pcadCPcadAlux)

c luminescence (relative light units, RLU) of 100 μl of bacterial suspension before the test as measured by plate luminometer Fluoroskan (ThermoLabsystems). Average of at least three assays.

d as fold over the (non-induced) background

e see equation 4 in Methods

f the lowest tested concentration causing a measurable decrease in the bioluminescence of the sensor strains (read from concentration-induction curves in Figure 1)

g concentration causing 50% decrease in the bioluminescence production (calculated from Figure 2)

h tested as ZnSO4 × 7H2O

Characteristics of Staphylococcus aureus and Bacillus subtilis-based luminescent heavy metal sensors and toxicity control strains a control for RN4220(pcadCPcadAlux) b control for BR51(pcadCPcadAlux) c luminescence (relative light units, RLU) of 100 μl of bacterial suspension before the test as measured by plate luminometer Fluoroskan (ThermoLabsystems). Average of at least three assays. d as fold over the (non-induced) background e see equation 4 in Methods f the lowest tested concentration causing a measurable decrease in the bioluminescence of the sensor strains (read from concentration-induction curves in Figure 1) g concentration causing 50% decrease in the bioluminescence production (calculated from Figure 2) h tested as ZnSO4 × 7H2O Two constitutively luminescent Gram-positive control ("lights-off") strains S. aureus RN4220(p602/22lux) and B. subtilis BR151(pBL1/p602/22lux) in which the optimized luxCDABE [37] is under the lac promoter, were constructed (Table 4). However, analogously to earlier studies [38] the stability of the plasmids with genes encoding for bioluminescence was relatively poor in Gram-positive bacterial strains as frequent loss of plasmids especially in strains with higher background luminescence, was observed. Even, no transformants were obtained when plasmid p602/22lux was transformed into B. subtilis BR151. This problem was solved and the relative stability of the bioluminescence encoding genes was achieved when the plasmid was transformed to B. subtilis strain containing a helper plasmid pBL1 (expresses LacIrepressor) [38]. Toxicity (2-h EC50 values) of Hg2+, Cd2+, Pb2+ and Zn2+ to S. aureus RN4220(p602/22lux) and B. subtilis BR151(pBL1/p602/22lux) are presented in Table 4 and respective concentration-effect curves in Figure 2.

Discussion

We constructed a set of Gram-negative and Gram-positive bioluminescent bacterial sensors in which the luxCDABE genes are regulated either by metal-response elements ("lights-on" metal sensors) or expressed in a constitutive manner ("lights-off" control strains). The developed set of bacterial sensors is original in several aspects: • both Gram-negative (E. coli, P. fluorescens) and Gram-positive (S. aureus, B. subtilis) bacteria were used as hosts for heavy metal sensors and luxCDABE genes from Photorhabdus luminescens (thermostability > 30°C) were used as a reporter system; • this is the first paper on construction and characterization of Gram-positive lux-cassette expressing sensors for Cd, Hg, Zn and Pb; • when possible, similar metal-response elements were used in different bacterial hosts, to evaluate the effect of the host bacterium on the specificity and sensitivity of the constructed sensor; • similar metal-response elements were expressed both in plasmid and in chromosome of P. fluorescens, to determine the effect of the copy number of the lux cassette-fused metal-response elements on the performance of the sensors; • a constitutively luminescent control ("lights-off" construct) was constructed for each heavy metal sensor and used to account for unspecific effects of the samples on bacterial bioluminescence. These control bacteria can also be used for general toxicity testing.

Properties of "lights-off" control strains

The constitutively luminescent "lights-off" control strains had always higher background bioluminescence than the respective control strains (Tables 1, 2, 3, 4). The highest background luminescence (600 000 RLU) was measured for E. coli MC1061(pSLlux) probably due to the location of the luxCDABE on a high-copy-number plasmid. As the rationale of including the control strains in the assay is to take into account the possible non-specific effects (e.g., toxicity) of the sample on bacterial bioluminescence, the high initial bioluminescence allowing more accurate measurement of the inhibition of bioluminescence, is certainly a bonus. By decreasing the plasmid copy number, the background bioluminescence of the "lights-off" strains clearly decreased. The bioluminescence of E. coli MC1061(pDNlux) containing a medium-copy-number plasmid was about 100-fold lower than that of E. coli MC1061(pSLlux) (Table 1). The same trend was observed for P. fluorescens as the background luminescence of OS8(pDNlux) (luxCDABE in about 10 copies) was about 100-fold higher than that of the OS::Knlux (a single copy of luxCDABE) (Tables 2 and 3). However, the background luminescence value did not affect the sensitivity of the "lights-off" strains to heavy metals: the EC50 values of differently luminescent E. coli and P. fluorescens control strains were similar (Tables 1, 2 and 3). Almost no effect of bioluminescence on bacterial sensitivity to heavy metals has also been demonstrated earlier by showing that a lux-marked Burkholderia sp. had similar sensitivity to Zn and Cu as the wild (not luminescent) strain in dehydrogenase assay [39]. In addition, we showed that the toxicity of Hg, methylmercury, Pb and Ag to the both Gram-negative bacteria (E. coli and P. fluorescens) was similar. However, E. coli proved more sensitive than P. fluorescens towards Zn (about 3-fold), Cu (about 15-fold) and Cd (about 100-fold) (Tables 1, 2 and 3). Indeed, relatively low sensitivity of a Pseudomonas putida towards Cd (about 3 orders of magnitude lower than the sensitivity of E. coli) in a growth ihibition assay has been shown earlier [40]. Comparison of Gram-negative and -positive control strains showed that the luminescence of the latter was always lower (Tables 1, 2, 3, 4). This could be either due to the poor expression of bioluminescence-encoding genes in these strains or partial loss of lux-containing plasmid in the bacterial cultures. In addition, Gram-positive strains were remarkably more sensitive to the tested heavy metals than Gram-negative (EC50 values in Tables 1, 2, 3, 4). Interestingly, other authors [41] have shown that the toxiciy of Hg was similar to E. coli and B. subtilis whereas we showed that the latter was at least 20-fold more senistive than the former.

Properties of heavy metal sensor strains: background luminescence

Differently from "lights-off" constructs, in metal sensor strains the lower background luminescence is an advantage as it ensures a more pronounced induction at lower metal concentrations (in the case of a strain with high background luminescence this high value must be exceeded at least twice to be equivalent to LOD). Theoretically, the sensor strains should be bioluminescent (induced) only in the presence of intracellular heavy metals, which bind on the regulatory protein. However, background luminescence values in the sensor strains were also registered in the absence of added heavy metals (Tables 1, 2, 3, 4). The reason for this could be either the leakage of the promoter controlling the expression of lux-genes and/or as proposed by [42] metal impurities of the test medium. Indeed, the optimized medium used in our study (see Methods), contained trace amounts of Cd (0.0001 mg l-1), Zn (0.035 mg l-1), Cu (0.0025 mg l-1) and Pb (0.003 mg l-1). However, these concentrations were more than 5-460-fold lower than the LODs of the sensors, depending on the strain (Tables 1, 2, 3, 4). Also, the background luminescence of the sensor strains (varying among the strains; Tables 1, 2, 3, 4) did not correlate with their sensitivities to the metals present as impurities in the test medium. Thus, the most probable reason for the background luminescence in the sensor strains is the leakage of the promoter controlling the expression of luxCDABE genes. Indeed, the E. coli MC1061(pmerRBSBPmerlux) had remarkably lower background than the other E. coli strains and it is well known that the regulatory protein in this sensor, MerR, is a strong repressor in the absence of mercury [43,44]. At the same time, the regulatory protein ZntR in MC1061(pSLzntR/pDNPzntAlux) strain with high background luminescence, has not been clearly shown to act as a repressor in the absence of zinc [29]. In addition to the nature of the metal-response elements, also the number of copies in which the lux-cassette and linked metal-response elements were present in the cells affected the background luminescence (P. fluorescens plasmid-bearing versus chromosomal strains, Tables 2 and 3). As a rule, the higher the background luminescence the lower the maximum induction of the sensors (Tables 1, 2, 3, 4). This could be due to the depletion of energy in the bacterial cells at high bioluminescence values as the emission of bioluminescence requires high amounts of cellular energy [45]. However, the background luminescence of the metal sensor strains did not affect their metal sensitivity (LOD) (Tables 1, 2, 3, 4).

Properties of heavy metal sensor strains: sensitivity and specificity

The sensor strains were characterized for their sensitivity and specificity using selected environmentally relevant heavy metals. The induction of luminescence was measured after 2 hours incubation that was selected according to our optimization studies (T.Rõlova, personal communication) and similar studies by other authors [17]. Interestingly, only one of the sensors, P. fluorescens OS8::KncueRPcopAlux was single metal (Cu) specific (Figure 1J). The E. coli MC1061(pSLcueR/pDNPcopAlux) expressing similar metal-response elements was in addition to Cu induced also by Ag, but in relatively high (environmentally irrelevant) concentrations (Figure 1I). The sensors expressing Hg-response elements (E. coli MC1061(pmerRBSBPmerlux), P. fluorescens OS8(pDNmerRBSBPmerlux) and OS8::KnmerRBSBPmerlux)) showed also relatively high specificity, by being induced only with inorganic and organic mercury compounds and Cd. However, induction with the latter occurred at concentrations 3-4 orders of magnitude higher than in the case of mercury and yielded remarkably lower inductions (Figure 1A–C). These data are in accordance with [46-48]. It is interesing to note that E. coli MC1061(pmerRBSBPmerlux) and P. fluorescens OS8(pDNmerRBSBPmerlux) were detecting methylmercury at about one order of magnitude lower concentrations than HgCl2 (Tables 1 and 2). Similar results for the same metal-response elements have been shown in [49] and is most probably caused by higher bioavailability of the organic mercury salt. On the other hand, both inorganic mercury and methylmercury were of similar toxicity to E. coli MC1061(pSLlux) or the latter was even less toxic to P. fluorescens control strains (Figure 2A), indicating that the elevated sensitivity towards methylated mercury occurs only at sub-toxic concentrations. Sensor bacteria carrying the metal-response elements from Zn-resistance system of E. coli (E. coli MC1061(pSLzntR/pDNPzntAlux) and P. fluorescens OS8::KnzntRPzntAlux), Cd-resistance system from Pseudomonas putida (P. fluorescens OS8(pDNcadRPcadAlux) and OS8::KncadRPcadAlux), Pb-resistance system from Ralstonia metallidurans (P. fluorescens OS8(pDNpbrRPpbrAlux), OS8::KnpbrRPpbrAlux) or Cd-resistance system from S. aureus (S. aureus RN4220(pcadCPcadAlux) and B. subtilis BR151(pcadCPcadAlux)) responded to four of the selected seven heavy metal salts: HgCl2, CdCl2, Pb(NO3)2 and ZnSO4 (Figure 1, Tables 1, 2, 3, 4) and the order of induction in all the cases was Hg2+ ≈ Cd2+ < Pb2+ < Zn2+. These unspecific responses were somewhat expected as earlier studies have shown similar results e.g. for Zn-resistance determinant from E. coli chromosome [14,50] and to our knowledge, no specific Cd-response system has been found. Unspecificity of several metal-response systems could be due to the evolution of these metal resistance systems to be induced by several heavy metals in order to detoxify them, or simply because the metal-binding proteins in these systems are unable to differentiate between different bi-valent metal ions [51]. Comparison of sensitivities of the current metal sensor strains with previously constructed ones (see below) showed that some of the current sensors were detecting very low levels of metals (lowest LOD values reported so far). However, variability of test results may occur between different papers due to different experimental conditions, which may affect the speciation and thus, bioavailability of metals. Nevertheless, our comparison showed that the strain E. coli MC1061(pSLcueR/pDNPcopAlux) detected 20-fold lower concentrations of Cu than similar previously published bacterial strains [11] and two strains – E. coli MC1061(pmerRBSBPmerlux) and B. subtilis BR151(pcadCPcadAlux) – were similar in sensitivity with the most sensitive previously reported strains for Hg and Cd, respectively [10,11,16,52].

Comparison of sensor constructs in different host bacteria

Performance of different types of recombinant bacteria carrying similar metal-response elements was compared. Comparison of the two Gram-negative host bacteria E. coli and P. fluorescens showed that the E. coli-based metal sensors were somewhat more sensitive. For example, E. coli MC1061(pSLcueR/pDNPcopAlux) was about 300-fold more sensitive to Cu than P. fluorescens OS8::KncueRPcopAlux and E. coli MC1061(pmerRBSBPmerlux) was induced by at least 10-fold lower concentrations of Hg2+, methylmercury and Cd2+ than P. fluorescens OS8(pDNmerRBSBPmerlux). This and the lower toxicity of some heavy metals to P. fluorescens compared with E. coli could be explained by different cellular metal homeostasis (e.g., the presence and nature of metal transporters) of the host bacteria. Indeed, the effect of metal transporters on the sensitivity of bacterial heavy metal sensors has been shown [53]. On the other hand, there were no remarkable differences in LOD values of the two Gram-positive sensor strains S. aureus RN4220(pcadCPcadAlux) and B. subtilis BR151(pcadCPcadAlux) carrying similar metal-response elements (Table 4). Thus, differently from "lights-off" strains, the sensitivity of the "lights-on" sensors depends on the nature of the metal sensing element rather than on the bacterial host. Indeed, the strains with metal-response elements from Hg resistance system were the most sensitive to Hg and the least sensitive to Cd regardless of the host strain. Different location of the metal-response elements in P. fluorescens (on a plasmid present in the cells in about 10 copies or as a single chosomosmal insertion) was chosen to clarify whether lowering the copy number of the metal-response elements and lux genes will yield higher sensitivity, as previously shown for stress-induced bacterial strains [54]. However, our data on P. fluorescens with chromosomal insertions showed lower background luminescence but not higher sensitivity than the respective plasmid-containing strains (Figure 1B, C).

Possible applications

As shown above, all the constructed metal sensor strains showed concentration-dependent linear increase in bioluminescence at sub-toxic concentrations of heavy metals. Moreover, the increased bioluminescence of the sensor implies that the toxic metal has crossed the biological membrane and thus, has a potential to accumulate in the food chain. In addition, the limits of determination of most of the constructed sensors under our test conditions were low enough to detect even the EC permitted limit values for Hg, Cd, Cu and Pb in drinking water (1, 5, 5000 and 10 μg l-1, respectively; Directive 98/83 EC). Currently the most challenging field of biosensor applications is the evaluation of bioavailable amounts of heavy metals in complex environmental matrices [55,56] for risk assessment purposes. However, the use of microbial sensors for environmental analysis is currently restricted mostly due to the lack of specificity. This drawback may be overcome by the combined use of several strains with different specificities and sensitivities. In addition, Cu and Zn-sensors have already proven very useful in other fields, e.g. in quantification of solubilized bioavailable metals from metal-containing nanoparticles [57-59].

Conclusion

As a result of this work, a battery of 19 recombinant luminescent bacterial strains was constructed which exhibits several novel aspects as it contains i) metal sensor strains with similar metal-response elements in different host bacteria; ii) metal sensor strains with metal-response elements in different copies and iii) a "lights-off" construct (control) for every constructed recombinant metal sensor strain. Thus, this set of sensors may be applicable for testing both, bioavailability of heavy metals and general toxicity.

Methods

Construction of plasmids and strains

Bacterial strains and plasmids used in this study are listed and their detailed characterization is provided in Additional file [see Additional file 1]. All the constructed sensors are based on components of heavy metal resistance systems (metal-response elements) and luxCDABE genes from Photorhabdus luminescens [60] (reporter).

Gram-negative strains

Escherichia coli-based sensors and the respective control strains

Four new plasmids were constructed and electroporated [26] into E. coli MC1061 [61]. The obtained plasmid constructs were verified by multiple restriction analysis. Plasmid pmerRBSBPmerlux was constructed by ligating the 4600 bp BamHI-NheI-digested and Klenow-treated fragment of pmerRBSBluc [49] and 3200 bp EcoRI-XcmI-digested and T4-treated fragment of pTetlux [62]. Plasmid pDNPcopAlux was constructed by replacing the lucFF gene in pSLcueRPcopAluc [63] by luxCDABE genes. For that, 3900 bp BamHI-NheI fragment of pSLcueRPcopAluc was ligated with a BamHI-NheI-digested PCR fragment of luxCDABE (primers: 5' TTAAGGATCCGCAAATATGACTAAAAAAATT 3' and 5' ATATGCTAGCACTATCAAACGCTTCGGTTAA 3'; pmerRBSBPmerlux was used as a template). The resulting plasmid pSLcueRPcopAlux was digested with NaeI and the fragment containing the promoter of copA and the luxCDABE was inserted into BamHI-digested and Klenow-treated pDN18N [64]. The resulting plasmid pDNPcopAlux was electroporated into E. coli MC1061(pSLcueR) [63]. Plasmid pSLzntR was constructed by self-ligating the 3500 bp NgoMI fragment of pSLzntluc [50] containing the zntR gene. To construct pDNPzntAlux, first an intermediate pSLzntRPzntAlux was constructed by ligating the BamHI-NheI-digested pSLzntluc (containing the promoter of zntA) and BamHI-NheI-digested PCR fragment of luxCDABE (see above). A NaeI fragment of pSLzntRPzntAlux containing the promoter of zntA and luxCDABE genes was then ligated with BamHI-digested and Klenow-treated pDN18N [64] resulting in pDNPzntAlux. The plasmids pSLzntR and pDNPzntAlux were tandemly electroporated into E. coli MC1061 [61]. In addition to those four newly constructed plasmids, the previously constructed plasmids pSLlux and pDNlux [32] were electroporated into E. coli MC1061 to obtain control strains MC1061(pSLlux) and MC1061(pDNlux).

Pseudomonas fluorescens-based sensor and the respective control strains

Both, chomosomal insertion- and plasmid-containing strains of P. fluorescens OS8 were constructed.

Plasmid-containing strains

Altogether three new broad-host range sensor plasmids were constructed and electroporated into P. fluorescens OS8 [65] by standard methods [26]. The plasmid constructs were verified by multiple restriction analysis. Plasmid pDNmerRBSBPmerlux was constructed by digesting the pmerRBSBPmerlux with PvuII and ligating with BamHI-digested and Klenow-treated pDN18N [64]. Plasmid pDNpbrRPpbrAlux was constructed by ligating the BamHI-XhoI-digested pSLlux [32] and BamHI-XhoI-digested 650 bp PCR product containing pbrR and promoter of pbrA (primers: 5' ATATCTCGAGGGGAGCCTTACCGGCAGAACAGCGA 3'and 5' TTAAGGATCCCCTCATGGCAACCCCTTGTGTGTATTCA 3'; Ralstonia metallidurans CH34 cell extract prepared as in [50] was used as a template). The resulting plasmid pSLpbrRPpbrAlux was digested with PvuII-NaeI and ligated with BamHI-digested and Klenow-treated pDN18N [64] to obtain pDNpbrRPpbrAlux. Plasmid pDNcadRPcadAlux was constructed by ligating the BamHI-BspEI-digested pSLlux [32] and BamHI-AgeI-digested 550 bp PCR fragment containing cadR and promoter of cadA (primers 5' ATATACCGGTAAGCTTTTGGCTTAATGCCCGTG 3' and 5' TTAAGGATCCCATGGGGTCATCCTTAATTTGAGCC 3' were used; cell extract of Pseudomonas putida PaW85 prepared as in [50] was used as a template). The resulting plasmid pSLcadRPcadAlux was digested with XhoI-SalI, Klenow-treated and ligated with BamHI-digested and Klenow-treated pDN18N [64] to obtain pDNcadRPcadAlux. The control strain OS8(pDNlux) was from [32].

Strains with chromosomal insertions

Chromosomal insertions were done by Tn5 mini-transposonmutagenesis method [66]. Transposon-carrying suicide plasmids were constructed (see below) and transferred into the recipient strains by conjugation.

Construction of suicide plasmids

All suicide plasmids were constructed in the E. coli strain SY372 λpir [67] and were based on pTCR241 [68]. The pTCR241 was modified as follows: 1500 and 2500 bp NotI fragments between terminal ends of the Tn5 were removed and replaced by kanamycin resistance gene from pET26b(+) (Novagen) and the resulting plasmid was desginated pTCRKn. For the construction of pTCRKnpbrRPpbrAlux, pTCRKnmerRBSBPmerlux and pTCRKnzntRPzntAlux, 6900, 8200 and 7000 bp PvuII fragments of pSLpbrRPpbrAlux, pmerRBSBPmerlux and pSLzntRPzntAlux and for the construction of pTCRKncadRPcadAlux and pTCRKncueRPcopAlux, 6750 and 6500 bp SalI-XhoI-digested and Klenow-treated fragments of pSLcadRPcadAlux and pSLcueRPcopAlux were inserted into StuI-site of pTCRKn situated between the terminal ends of the Tn5 before the kanamycin resistance encoding gene. All the fragments inserted into pTCRKn contained respective metal-response elements and luxCDABE genes. For the construction of pTCRKnlux, an intermediate plasmid was constructed by inserting SalI-NruI fragment of pSLlux (luxCDABE genes under the lac promoter) into SalI-StuI-digested pSL1190. From the resulting plasmid a PvuII fragment (lac promoter and luxCDABE) was inserted into StuI-digested pTCRKn. The plasmid constructs were verified by multiple restriction analysis

Chromosomal insertions to P. fluorescens OS8

For chromosomal insertions, E. coli S17-1 λ pir [69] was transformed with the appropriate suicide plasmid by CaCl2 method [26] to obtain the donor strains. The donor strain was grown overnight in LB medium (per liter: 10 g of tryptone, 10 g of NaCl, 5 g of yeast extract [26]) with 100 μg ml-1 of ampicillin and mixed with the overnight culture (in LB) of the recipient P. fluorescens OS8 at a ratio 1:2 (20 μl: 40 μl). 5 ml of 10 mM MgSO4 was added to the mixture and the cells were collected on a 0.45 μm membrane filter. The filter was incubated on LB agar plate for 8–18 h to allow conjugation after which the cells on the filter were resuspended in 5 ml of 10 mM MgSO4. 100–500 μl of the resulting mixture was plated onto selective M9 minimal medium (per liter: 6 g of Na2HPO4, 3 g of KH2PO4, 0.5 g of NaCl, 1 g of NH4Cl) agar (1.5%) plates supplemented with 4 g l-1 of glucose and microelements (final concentration per liter: 26.9 mg of MgO, 5 mg of CaCO3, 0.13 ml of conc. HCl, 11.3 mg of FeSO4 × 7H2O, 3.6 mg of ZnSO4 × 7H2O, 2.8 mg of MnSO4 × 4H2O, 0.65 mg of CuSO4 × 5H2O, 0.7 mg of CoSO4 × 7H2O, 0.15 mg of H3BO3; the mixture was prepared as 400-fold concentrate). Selectivity of the plates was obtained by supplementing the medium with 100 μg ml-1 of kanamycin. Strains with chromosomal insertions of metal-response elements and luxCDABE genes from pTCRKnpbrRPpbrAlux, pTCRKnmerRBSBPmerlux, pTCRKnzntRPzntAlux, pTCRKncadRPcadAlux and pTCRKncueRPcopAlux were designated as OS8::KnpbrRPpbrAlux, OS8::KnmerRBSBPmerlux, OS8::KnzntRPzntAlux, OS8::KncadRPcadAlux and OS8::KncueRPcopAlux, respectively. The strain with chromosomal insertion of luxCDABE from pTCRKnlux was designated as OS8::Knlux.

Gram-positive strains

Plasmids pcadCPcadAlux and p602/22lux were constructed by inserting the SmaI-SpeI-digested 5700 bp luxCDABE from pSB2025 (translational signals before the genes have been optimized for Gram-positive bacteria) [37,70] into NheI-BamHI-digested (BamHI-digested end was filled with Klenow fragment) pTOO24 [36] or p602/22 [71], respectively. The plasmid constructs were verified by multiple restriction analysis For the construction of Gram-positive metal sensor and control strains, the plasmids pcadCPcadAlux and p602/22lux were inserted into Staphylococcus aureus RN4220 [72] and Bacillus subtilis BR151 [73] or BR151(pBL1) [38] by electroporation [74,75].

Cultivation of bacteria

The constructed strains were stored as frozen glycerol (15%) stocks at -70°C. Prior to testing, bacteria were grown on LB [26] agar plates containing appropriate antibiotics (see below). For the test, bacteria were cultivated in M9 medium (per liter: 6 g of Na2HPO4, 3 g of KH2PO4, 0.5 g of NaCl, 1 g of NH4Cl, 0.25 g of MgSO4 × 7H2O, 0.01 g of CaCl2; [26]) supplemented with glucose (final concentration 1 g l-1) and acid hydrolysate of casein (cas-AA; LabM; final concentration 5 g l-1), HMM medium (per liter: 8.4 g of MOPS at pH 7.2, 3.7 g of KCl, 0.53 g of NH4Cl, 0.07 g of MgSO4 × 7H2O, 0.21 g of glycerol-2-phosphate, 0.0003 g of FeCl3 × 6H2O; all the components were prepared as 10 or 100-fold concentrated stocks, filter-sterilized and stored at +4°C except for glycerol-2-phosphate, which was stored at -20°C; [76]) supplemented with glucose (final concentration 1 g l-1) and cas-AA (final concentration 5 g l-1) or LB medium. The culture media were supplemented with antibiotics as follows: ampicillin 100 μg ml-1 (E. coli MC1061(pmerRBSBPmerlux), MC1061(pSLlux)), ampicillin 100 μg ml-1 plus tetracycline 10 μg ml-1 (E. coli MC106 (pSLcueR/pDNPcopAlux), MC1061(pSLzntR/pDNPzntAlux)), tetracycline 10 μg ml-1 (MC1061(pDNlux)) and 20 μg ml-1 (P. fluorescens OS8(pDNmerRBSBPmerlux), OS8(pDNpbrRPpbrAlux), OS8(pDNcadRPcadAlux), OS8(pDNlux)), kanamycin 50 μg ml-1 (S. aureus RN4220(pcadCPcadAlux), RN4220(p602/22lux) and B. subtilis BR151(pcadCPcadAlux)) or 100 μg ml-1 (P. fluorescens OS8::KnmerRBSBPmerlux, OS8::KncueRPcopAlux, OS8::KnzntRPzntAlux, OS8::KnpbrRPpbrAlux, OS8::KncadRPcadAlux, OS8::Knlux), kanamycin 50 μg ml-1 plus erythromycin 10 μg ml-1 (BR151(pBL1/p602/22lux)). All cultivations were performed on a shaker at 200 rpm, 30°C. M9 medium with the above-mentioned supplements was used to cultivate E. coli and P. fluorescens strains when they were use to test Cd, Hg, methylmercury, Zn, Cu or Ag. HMM medium with supplements was used to cultivate E. coli and P. fluorescens if they were used to test Pb. The cultures in exponential phase (OD600 = 0.6–0.8) were diluted with the respective test media until OD600~0.1 except the four P. fluorescens strains with chromosomal insertions, which were cultivated until the OD600 of 0.8 (OS8::KncadRPcadAlux and OS8::KncueRPcopAlux), 0.4 (OS8::KnmerRBSBPmerlux) and 0.2 (OS8::KnzntRPzntAlux). LB medium was used to cultivate S. aureus and B. subtilis strains. The cultures in exponential phase (OD600 = 0.6–1) were then washed twice with either glucose and cas-AA supplemented M9 medium (further test with Hg, Zn or Cd) or cas-AA and glucose-supplemented HMM (further test with Pb) and diluted until OD600~0.1. The number of bacterial cells in the test was determined for each strain before the test by spreading the appropriate dilutions of bacterial culture on antibiotic-containing LB agar plates and counting the colony forming units after 24 hours growth at 30°C.

Preparation of standard chemicals

All heavy metal salts were at least of analytical grade (98%): mercury (II) chloride (HgCl2), methylmercury chloride (MeHgCl), cadmium (II) chloride (CdCl2), zinc (II) sulphate-7-hydrate (ZnSO4 × 7H2O) and copper (II) sulphate-5-hydrate (CuSO4 × 5H2O) were purchased from Riedel-de-Haën, lead (II) nitrate (Pb(NO3)2) was from Fluka and silver (I) nitrate (AgNO3) from J. T. Baker B.V. 1 M stock solutions of CdCl2, ZnSO4 × 7H2O and CuSO4 × 5H2O as well as 0.1 M of HgCl2, AgNO3 and Pb(NO3)2 were prepared in MilliQ water. 0.1 M stock solution of methylmercury chloride was prepared in DMSO. Before the induction measurements, serial dilutions of the stock solutions (geometrical factor 3.3) were done in MilliQ water.

Measurements and calculations

Serial dilutions of heavy metal standard solutions in MilliQ water were pipetted onto white 96-well Cliniplate (Thermo Labsystems, Helsinki, Finland) (100 μl per well), and an equal volume of the bacterial suspension (preparation escribed above) was added and the plates were incubated for 2 h at 30°C (optimal for the induction of bioluminescence in sensor cells) without shaking. After incubation, luminescence was measured with plate luminometer Fluoroskan (Thermo Labsystems). All the measurements with sensor and respective control bacteria were performed as three independent experiments in duplicate. To determine the background luminescence (non-affected by added metals) for each sensor and control strain, MilliQ water was added to bacterial suspension instead of metal dilutions (6 replicates). Response of either metal sensor or control bacteria was expressed as normalised luminescence (NL) calculated as in [63] according to the following formula: where LB is the background luminescence (luminescence of bacteria without added heavy metal) and LS the metal-affected luminescence of the respective bacterium. The NL of the control strains could be used to correct the luminescence of the sensor stains in slightly toxic, coloured or turbid samples. The limit of determination in NL values (LODNL) for the sensor bacteria was determined in every assay as follows: where is the mean background luminescence value of the sensor (minimum six blanks included in each assay) and SD is the standard deviation. The LOD as mg of metal l-1 was the metal concentration corespondng to LODNL in the calibration curve. In the case of the control strains, the inhibition of luminescence by metals was calculated by the following formula: The 2-h EC50 (concentration of metal causing 50% decrease in luminescence during 2 hours of exposure) was calculated from concentration-effect curves using log-normal regression.

Authors' contributions

AI was active in planning of the study, carried out most of the molecular genetic studies and supervised the calibration of sensors. She also drafted the manuscript. TR carried out transposonmutagenesis and calibration of sensors AK participated in the planning of the work concerning general toxicity, in coordination and in revision of the manuscript.

Additional file 1

Strains and plasmids used in this study. Relevant characteristics of the bacterial strains and plasmids used in this study are provided. Click here for file
  56 in total

1.  Genetically engineered whole-cell sensing systems: coupling biological recognition with reporter genes.

Authors:  S Daunert; G Barrett; J S Feliciano; R S Shetty; S Shrestha; W Smith-Spencer
Journal:  Chem Rev       Date:  2000-07-12       Impact factor: 60.622

2.  The complete genome sequence of Escherichia coli K-12.

Authors:  F R Blattner; G Plunkett; C A Bloch; N T Perna; V Burland; M Riley; J Collado-Vides; J D Glasner; C K Rode; G F Mayhew; J Gregor; N W Davis; H A Kirkpatrick; M A Goeden; D J Rose; B Mau; Y Shao
Journal:  Science       Date:  1997-09-05       Impact factor: 47.728

3.  Effect of inoculation of a TOL plasmid containing mycorrhizosphere bacterium on development of Scots pine seedlings, their mycorrhizosphere and the microbial flora in m-toluate-amended soil.

Authors: 
Journal:  FEMS Microbiol Ecol       Date:  2000-02-01       Impact factor: 4.194

4.  Chromosomal location of genes regulating resistance to bacteriophage in Bacillus subtilis.

Authors:  F E Young; C Smith; B E Reilly
Journal:  J Bacteriol       Date:  1969-06       Impact factor: 3.490

5.  Physiological and toxicological characterization of an engineered whole-cell biosensor.

Authors:  F A Chinalia; G I Paton; K S Killham
Journal:  Bioresour Technol       Date:  2007-03-26       Impact factor: 9.642

6.  Detection of organomercurials with sensor bacteria.

Authors:  A Ivask; K Hakkila; M Virta
Journal:  Anal Chem       Date:  2001-11-01       Impact factor: 6.986

7.  A genomic approach to gene fusion technology.

Authors:  T K Van Dyk; Y Wei; M K Hanafey; M Dolan; M J Reeve; J A Rafalski; L B Rothman-Denes; R A LaRossa
Journal:  Proc Natl Acad Sci U S A       Date:  2001-02-13       Impact factor: 11.205

8.  Toxicity of nanosized and bulk ZnO, CuO and TiO2 to bacteria Vibrio fischeri and crustaceans Daphnia magna and Thamnocephalus platyurus.

Authors:  Margit Heinlaan; Angela Ivask; Irina Blinova; Henri-Charles Dubourguier; Anne Kahru
Journal:  Chemosphere       Date:  2008-01-14       Impact factor: 7.086

9.  Rapid, sensitive bioluminescent reporter technology for naphthalene exposure and biodegradation.

Authors:  J M King; P M Digrazia; B Applegate; R Burlage; J Sanseverino; P Dunbar; F Larimer; G S Sayler
Journal:  Science       Date:  1990-08-17       Impact factor: 47.728

10.  Effect of pH on intracellular accumulation of trace concentrations of Hg(II) in Escherichia coli under anaerobic conditions, as measured using a mer-lux bioreporter.

Authors:  George R Golding; Richard Sparling; Carol A Kelly
Journal:  Appl Environ Microbiol       Date:  2007-12-14       Impact factor: 4.792

View more
  39 in total

1.  Whole-cell biochips for online water monitoring.

Authors:  Tal Elad; Shimshon Belkin
Journal:  Bioeng Bugs       Date:  2012-03-01

Review 2.  Where microbiology meets microengineering: design and applications of reporter bacteria.

Authors:  Jan Roelof van der Meer; Shimshon Belkin
Journal:  Nat Rev Microbiol       Date:  2010-07       Impact factor: 60.633

3.  Relationships between bacterial energetic metabolism, mercury methylation potential, and hgcA/hgcB gene expression in Desulfovibrio dechloroacetivorans BerOc1.

Authors:  Marisol Goñi-Urriza; Yannick Corsellis; Laurent Lanceleur; Emmanuel Tessier; Jérôme Gury; Mathilde Monperrus; Rémy Guyoneaud
Journal:  Environ Sci Pollut Res Int       Date:  2015-03-14       Impact factor: 4.223

Review 4.  Are luminescent bacteria suitable for online detection and monitoring of toxic compounds in drinking water and its sources?

Authors:  Marjolijn Woutersen; Shimshon Belkin; Bram Brouwer; Annemarie P van Wezel; Minne B Heringa
Journal:  Anal Bioanal Chem       Date:  2010-11-09       Impact factor: 4.142

5.  Advances in characterizing microbial community change and resistance upon exposure to lead contamination: Implications for ecological risk assessment.

Authors:  S Elizabeth George; Yongshan Wan
Journal:  Crit Rev Environ Sci Technol       Date:  2019-12-23       Impact factor: 12.561

Review 6.  Synthetic biology: advancing the design of diverse genetic systems.

Authors:  Yen-Hsiang Wang; Kathy Y Wei; Christina D Smolke
Journal:  Annu Rev Chem Biomol Eng       Date:  2013-02-13       Impact factor: 11.059

7.  Improving the sensitivity of bacterial bioreporters for heavy metals.

Authors:  Anu Hynninen; Karmen Tönismann; Marko Virta
Journal:  Bioeng Bugs       Date:  2009-12-02

8.  Effects of rhamnolipids from Pseudomonas aeruginosa DS10-129 on luminescent bacteria: toxicity and modulation of cadmium bioavailability.

Authors:  Olesja Bondarenko; Pattanathu K S M Rahman; Thahira J Rahman; Anne Kahru; Angela Ivask
Journal:  Microb Ecol       Date:  2010-01-15       Impact factor: 4.552

9.  Genetically modified whole-cell bioreporters for environmental assessment.

Authors:  Tingting Xu; Dan M Close; Gary S Sayler; Steven Ripp
Journal:  Ecol Indic       Date:  2013-05-01       Impact factor: 4.958

10.  Antioxidant activity of humic substances via bioluminescent monitoring in vitro.

Authors:  A S Tarasova; D I Stom; N S Kudryasheva
Journal:  Environ Monit Assess       Date:  2015-02-07       Impact factor: 2.513

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.