Literature DB >> 19416545

Preliminary study of malaria incidence in Nouakchott, Mauritania.

Khadijetou Mint Lekweiry1, Mohamed Ould Abdallahi, Hâmpaté Ba, Céline Arnathau, Patrick Durand, Jean-François Trape, Ali Ould Mohamed Salem.   

Abstract

BACKGROUND: Malaria is one of the main motives for outpatient consultation and hospitalization in Mauritania. However, its incidence remains unclear because of diagnostic problems and insufficient epidemiological data.
METHODS: Between April and August 2007, a study on malaria incidence was carried out in Nouakchott city. A total of 237 febrile outpatients, from all Nouakchott districts, attending the two main hospitals of the city were investigated. Finger prick and blood dried filter paper samples were performed to prepare thick and thin films and nested-PCR for malaria parasite species identification and density. The accuracy of diagnosis of 'presumptive malaria', assigned by clinicians and based on fever and other malaria suggestive symptoms, was assessed. Entomological investigations based on morphological and molecular characterization of Anopheline species were conducted in Dar Naïm district.
RESULTS: Malaria prevalence rate was 25.7% (61/237), the majority of positive blood slides as well as nested-PCR products were due to Plasmodium vivax 70.5% (43/61) and Plasmodium ovale 24.6% (15/61). Two malaria patients, both with P. vivax, have never travelled out of Nouakchott and seem likely to have been autochthonous (3.3%). Of the 237 individuals included in the survey, 231(97.5%) were clinically diagnosed and treated as malaria cases. 26.4% of clinically diagnosed cases were positive for Plasmodium using microscopic examination and PCR. Thus, false positive cases constituted 73.6% (170/231) of the clinically diagnosed malaria cases. The search for mosquito vectors in Dar Naïm district allowed morphological and molecular identification of Anopheles arabiensis and Anopheles pharoensis.
CONCLUSION: This study demonstrates that, during the hot and dry season, Plasmodium species responsible of recurrent malaria (P. vivax and P. ovale) are the dominant species in Nouakchott city and autochthonous malaria cases exist but are rare. Clinical diagnosis of malaria has a very low positive predicted value. The systematic use of microscopy-based diagnosis and/or rapid diagnostic tests should be considered to appropriately manage malaria and non-malaria cases.

Entities:  

Mesh:

Substances:

Year:  2009        PMID: 19416545      PMCID: PMC2687455          DOI: 10.1186/1475-2875-8-92

Source DB:  PubMed          Journal:  Malar J        ISSN: 1475-2875            Impact factor:   2.979


Background

Malaria is the most deadly vector-transmitted human disease in the world. It causes nearly a million deaths each year, mostly in Africa [1]. This disease and the relevant mortality are due to one of four Plasmodium species transmitted by the bite of an infected female Anopheles species mosquito. Mauritania is located in north-western Africa, between latitudes 15° and 27° North and longitudes 5° and 17° West. The country is largely arid, with two-thirds of its areas covered by the Sahara desert and the remainder belongs to the Sahelian zone. It has a low rainfall that increases from North to South and only one rainy season from July to October [2]. Consequently, the country is geographically divided into three climatic areas: the Saharan region in the north with an annual rainfall less than 100 mm, the Sahelian zone characterized by an annual rainfall of 100–300 mm, and the southern area, along the Senegal River valley, with an annual rainfall of 300–500 mm. In Mauritania, malaria is the main motive of outpatient consultation and hospitalization after diarrhoea and respiratory infections [2,3]. According to the World malaria report of 2008, the disease is increasing since the number of reported cases reached 188,025 in 2006 against only 26,933 in 1990 [1]. The main factors affecting this increase are the development of a hydro-agricultural project in the south and the reappraisal of the oases in the north [2]. However, the precise malaria incidence is still unknown since, in most health centers, febrile episodes are often considered as malaria, based only on a clinical diagnosis and the parasitological confirmation is rarely sought by the physician. On the other hand, research describing the situation of this parasitic disease in the country is relatively recent and still limited [3-5]. These have described the four Plasmodium species with a predominance of P. falciparum in the southern and south-eastern endemic areas of the country. Furthermore, researches about mosquito species responsible of malaria transmission in the country have mainly focused on the inventory of Anopheline fauna [6]. Nouakchott, capital city of Mauritania has, during the last three decades, undergone rapid and profound demographic changes due to the rural exodus following the drought of 1970s. The city has struggled to cope with the pace and the extension of informal urbanization. Poor housing, lack of sanitation and drainage of surface water and the development of peri-urban orchards, with multiple crops, have resulted in extensive mosquito-favourable environment, encouraging the appearance of vector-borne diseases. This work describes malaria situation in Nouakchott. The main goals were: a) to assess the real contribution of malaria to febrile episodes, b) to determine the Plasmodium species involved and their relative importance, c) to evaluate the impact of "presumptive diagnosis" on the accuracy of malaria incidence, and d) to identify the mosquito vector. The results should be valuable for the national strategy against malaria in Mauritania.

Methods

Study area

This study was conducted in the city of Nouakchott (18°.11'N; 16°.16'W) at an average altitude of 7 m. The city is situated in a Sahara zone, near the Atlantic coast (Figure 1), comprises nine districts and houses 743,511 inhabitants corresponding to one fourth of the whole population of the country [7]. The wet season is short, extending from August to September, with little annual variation in the amount of rainfall (50 to 80 mm). The average annual temperatures range from 20.7°C to 33.3°C, and the average relative humidity from 33.4% to79.1%.
Figure 1

Map of Nouakchott city showing the different districts and the location of the two main hospitals.

Map of Nouakchott city showing the different districts and the location of the two main hospitals.

Subject and blood sample collection

From April to August, corresponding in most part to the hot and dry season, a total of 237 febrile outpatients attending the two main hospitals of Nouakchott city were included in this study. All the patients had a fever associated with malaria-like symptoms (e.g. headache, vomiting, abdominal pain and diarrhoea). Blood samples were collected by finger-prick and blood dried filter paper samples were performed. An epidemiological record including age and sex of patients, axillary temperature, provenance, clinical symptoms, type of treatment and recent journey was completed for each patient. Of the patients attending the two hospitals, 6.75% had come from areas outside the city, the rest were inhabitants of Nouakchott who had no recent travel history or had never left Nouakchott.

Malaria parasites identification

Identification of Plasmodium sp. was undertaken using microscopy and polymerase chain reaction (PCR). Thin and thick blood films were put on the same slide and stained using standard methods [8]. One experienced laboratory technician examined the stained blood. The parasite density/μl was calculated by counting the number of parasites per 200 white blood cells (WBC), assuming a WBC count of 8,000/μl [9]. Data collected were graded according to parasitaemia into five classes: 1:<50; 2: 50–499; 3: 500–4,999; 4: 5,000–49,999; and 5: ≥ 50,000 [10]. As quality control, all slides were re-read at the 'Laboratoire de Paludologie et Zoologie tropicale' of the IRD (Senegal). Epidemiological and laboratory data were analysed using EpiInfo 6.04 software. DNA was extracted from filter paper according to DNeasy Blood and Tissue handbook protocol (Qiagen, France). Amplification of genus and species-specific Plasmodium was done by using the primers: rPLU5 (5'-CCTGTTGTTGCCTTAAACTTC-3'), rPLU6 (5'TTAAAATTGTTGCAGTTAAAACG3'); rFAL1 (5'-TTAAACTGGTTTG GGAAAACCAAATATATT-3'), rFAL2 (5'-ACACAATGAACTCAATCATGACTAC CCGTC-3'); rVIV1 (5'-CGCTTCTAGCTTAATCCACATAACTGATAC-3'), rVIV2 (5'-CTTCCAAGCCGAAGCAAAGAAAGTCCTTA-3'); rOVA1 (5'ATCTCTTTTGATTTTTTAGTATTGGAGA-3'), rOVA2 (5'-AAAAGGACACATTAATTGTATCCTAATG-3'); rMAL1 (5'-ATAACATAGTTGTACGTTAAGAATAACCGC-3'), rMAL2 (5'-AAAATTCCCATGCATAAAAAATTATACAAA-3') as described by Snounou et al [11]. Each 20 μL reaction mixture for nest-1 amplification contained 5 μL of template DNA, 250 nM of each oligonucleotide primer (rPLU5 & rPLU6), 125 μM dNTP, 10× PCR buffer (500 mM KCl, 100 mM Tris-HCl [pH 8.3], 20 mM MgCl2), and 0.4 Units of HotStar Taq DNA polymerase (Qiagen, France). The reactions were subjected to 25 cycles under the following conditions: initial denaturation at 95°C for 5 min, annealing at 58°C for 2 min, extension at 72°C for 2 min, denaturation at 94°C for 1 min, final annealing at 58°C for 2 min, and final extension at 72°C for 5 min. About 5 μl of the nest-1 amplification products served as the DNA template for each of the 20 μl of second PCR (nest-2) amplification. Nest-2 was performed as nest-1, except that 30 cycles were performed. After amplification, the reaction mixture was loaded on a 1.5% agarose gel, separated by electrophoresis, stained with ethidium bromide and photographed under UV light.

Entomological investigations and sporozoites detection

Entomological investigations were carried out in Dar Naïm District, especially the surrounding area of Zaatar, for the search of malaria vector mosquitoes. This area is characterized by the presence of intense agricultural activity mainly consisting of vegetable crops. Mosquitoes were collected from five houses after indoor insecticide spraying early in the morning. The anophelines were identified to species level using morphological characteristics according to the identification keys of Gillies & De Meillon [12] and Gillies & Coetzee [13]. After identification, all mosquitoes belonging to Anopheles gambiae complex were stored in individual tubes with silica gel and preserved at -20°C in the laboratory. Species identification of the An. gambiae complex was done by PCR according to Scott et al [14]. All collected anopheline mosquitoes were examined by ELISA to detect circumsporozoite protein (CSP) as described by Burkot et al [15] and modified by Wirtz et al [16].

Results

This study was carried out to assess the incidence of malaria fever among a set of 237 outpatients with febrile symptoms consulting the two main Nouakchott's hospitals. The median age of the patients was 33.9 years (Table 1). Most of the patients were males 59.1% (140) while 40.9% (97) were females (χ2 = 7.48, P = 0.006). The mean axillary temperature overall the patients was 38.9°C. Thick blood film analysis showed that 61 out of the 237 tested individuals were positive for Plasmodium sp. giving a malaria infection rate of 25.7%. The highest number of infections was due to P. vivax with a rate of 70.5% (43/61) followed by P. ovale with 24.6% (15/61) and P. falciparum with a rate of 1.6% (1/61) (Table 2). No infection with Plasmodium malariae was found. Variation of parasitaemia among the 61 positive patients showed that 22 had parasite density between 50–499 parasites/μL of blood (Table 2). 18 and 15 malaria patients had a parasite density respectively between 500–4,999 and 5,000–49,999 parasite/μL of blood. The results of Nested-PCR conducted on a DNA extracted from blood samples of 148 patients demonstrated the high prevalence of P. vivax. Indeed an amplification product of 120 bp characterizing this species has been evidenced in 43 of the 148 tested samples.
Table 1

Malaria prevalence in two hospitals in Nouakchott

SexNumber of patients (%)Thick blood filmMean age (years)Mean axillary temperature (°C)
Positive (%)Negative (%)

Male140 (59.1)37 (26.4)103 (73.6)32.838.9
Female97(40.9)24 (24.7)73 (75.3)35.138.9
Total237(100)61 (25.7)176 (74.3)33.938.9
Table 2

Variation of parasitaemia* and infection rate in the 61 malaria positive patients

SpeciesParasite densityTotalInfection rate (%)

<5050–499500–4,9995,000–49,99950,000
P. falciparum0100011.6
P. vivax41911904370.5**
P. ovale027511524.6
P. malariae0000000
Mixed infection***1001023.3
Total522181516125.7

* Parasitaemia is considered as the number of parasites per microlitre of blood; ** P = 0.002; *** P. vivax and P. ovale

Malaria prevalence in two hospitals in Nouakchott Variation of parasitaemia* and infection rate in the 61 malaria positive patients * Parasitaemia is considered as the number of parasites per microlitre of blood; ** P = 0.002; *** P. vivax and P. ovale The 61 positive cases came from all Nouakchott districts, except Sebkha, El Mina and Riadh districts were no malaria infections were found (Table 3). The highest number of positive cases was recorded in the District of Dar Naïm (40 of 61) and Teyarett (13 of 61). Two of the 61 malaria positive patients, both with P. vivax, had never left Nouakchott and could, therefore, be considered as endemic cases.
Table 3

Distribution of malaria positive cases according to the different Nouakchott districts.

DistrictNPositive
Dar Naïm8340 (65.6%)*
Teyarett4213 (21.3%)
Toujounin223 (5%)
Tevragh Zeina152 (3.3%)
Ksar131 (1.6%)
Arafat281 (1.6%)
Sebkha40
Elmina110
Riyadh30
Others**161 (1.6%)

Total23761 (100%)

* P < 0.0001; ** from other areas outside the city.

N: number of individuals.

Distribution of malaria positive cases according to the different Nouakchott districts. * P < 0.0001; ** from other areas outside the city. N: number of individuals. The others lived in Nouakchott but had travelled to other regions. Of the 237 feverish cases, who attended the two hospital emergencies, the physicians diagnosed and treated 231 (97.5%) as malaria on clinical grounds (Table 4). A 26.4% (61/231) of clinically diagnosed cases were slide positives for Plasmodium using microscopic examination, whereas 73.6% (170/231) showed no malaria infection at all.
Table 4

Distribution and frequencies of presumptive malaria among the 237 outpatients with febrile symptoms in Nouakchott hospitals.

Numberof patientsSlides found positiveSlides found negative
Presumptivemalaria (%)231(97.5%)61(26.4%)170(73.6%)
Other*(%)6(2.5%)0(0%)6(100%)
Total(%)237(100%)61(25.7%)176(74.3%)

* These were clinically diagnosed and treated as non-malaria fevers

Distribution and frequencies of presumptive malaria among the 237 outpatients with febrile symptoms in Nouakchott hospitals. * These were clinically diagnosed and treated as non-malaria fevers Entomological investigations carried out in Dar Naïm District allowed the collection of 443 mosquitoes. Among these eight were morphologically identified as An. gambiae s.l and one as An. pharoensis. The remaining mosquitoes were identified as Culex sp. and Aedes sp. Since species belonging to An. gambiae complex are morphologically indistinguishable, a PCR was performed on the eight An. gambiae s.l. specimens. Results showed that all tested mosquitoes were Anopheles arabiensis, as confirmed by a PCR product of 315 bp. Of the eight anophelines mosquitoes collected and examined by CSP ELISA to detect circumsporozoite protein, none was found positive.

Discussion

This study is one of the few reports addressing malaria situation in Nouakchott city. Starting from 237 feverish outpatients consulting the two main health centers in this Saharan city, results showed a malaria prevalence rate of 25.7% among cases of fever with malaria-like symptoms and identified P. vivax as the dominant species followed by P. ovale. In a previous study, conducted in Nouakchott and based on microscopic examination of blood films from 446 febrile patients, Cortes and al [3] showed a malaria prevalence rate of 18.5%, 68.5% of which were due to P. falciparum and 35.5% to P. vivax. The difference between these results and those obtained by Cortes et al [3] can be explained by the difference in the periods during which the two studies were conducted and/or the different techniques used. In N'Djaména (Chad), a Sahelian town with highly seasonal malaria transmission, Othnigué and al [17] found that among 1,658 patients 30% were positive for Plasmodium (all P. falciparum) using rapid test diagnosis and microscopic examination. Low parasite densities were observed among the 61 malaria patients since 45 of them have less than 5,000 parasites/μL. It could be that, in the majority of cases, these were relapses, characteristic of vivax malaria and where parasite density is generally lower than during the primary infection. Of the 237 analysed patients, 221 have no recent history of travel outside Nouakchott including two patients (3.3% of the cases diagnosed) that had never traveled out of the city. This result should support the results of Cortes et al [3] suggesting the presence of malaria endemic to Nouakchott. The high rate of malaria infection observed among febrile patients from Dar Naïm District and the identification of An. arabiensis and An. pharaoensis mosquitoes in the same district, strongly support this hypothesis. Indeed, the intensive gardening activities carried out in the areas surrounding this district could create adequate conditions for mosquitoes breeding. The presence of Anopheles spp. has been previously reported in the neighbouring district of Toujounine [18]. However, none of the eight trapped anophelines mosquitoes was found positive with CSP ELISA. The absence of sporozoïtes infection in this case may be due to the small sample size of mosquitoes. Further studies need to be carried out on bionomics of An. arabiensis and An. pharaoensis to determine their exact role in malaria transmission in Nouakchott. The study also revealed that presumptive malaria was diagnosed as the main health problem for 97% of patients. The high frequency of malaria presumptive diagnosis contrasts with the laboratory results showing that only 26.4% of those patients were Plasmodium positive by microscopy and PCR. In other words, at least 73% of clinically diagnosed patients are misdiagnosed. Malaria presumptive diagnosis is widely reported as a common practice in many health centres in Africa [17,19]. It is worth remembering that giving anti-malarial drugs to all febrile cases or all presumptive malaria cases will contribute to the appearance of resistant forms [20,4]. Inadequate treatment can lead to severe complications and may results in a high burden and economic costs on health services and households.

Conclusion

During hot-dry season, malaria fever accounts for 25.7% of febrile cases in Nouakchott city and Plasmodium species responsible of recurrent malaria (P. vivax and P. ovale) are the most dominant species. Autochtonous malaria exists but is rare. Clinical diagnosis of malaria has a very low positive predicted value, and its low specificity leads to inappropriate care and high economic coast for a large proportion of patients. Regarding the low specificity of malaria clinical diagnosis in this Saharan urban setting, no malaria treatment should be given unless clinical diagnosis is confirmed by a laboratory-based diagnosis, such as rapid test or microscopy. Anopheles arabiensis may be the most important species involved in the transmission of malaria in Nouakchott, although its occurrence seems to be relatively low.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

KML is the principal investigator of the study and led the drafting of this manuscript; MOA supervised the microscopic examination and performed the statistical analysis; HB supervised entomological investigations; JFT supervised the quality control of slides and participated in the manuscript preparation and revision; CA carried out molecular analysis and participated in the manuscript preparation and revision; PD supervised molecular analysis and participated in the manuscript preparation and revision; AOMS initiated the study and participated in the manuscript preparation and revision. All authors read and approved the final manuscript.
  12 in total

1.  Diagnostic value of molecular markers in chloroquine-resistant falciparum malaria in Southern Mauritania.

Authors:  T Jelinek; A O Aida; G Peyerl-Hoffmann; S Jordan; A Mayor; C Heuschkel; A O el Valy; F von Sonnenburg; E M Christophel
Journal:  Am J Trop Med Hyg       Date:  2002-11       Impact factor: 2.345

2.  Chloroquine-resistant falciparum malaria in Mauritania.

Authors:  M Gasquet; J Delmont; J Le Bras; F Delmas; P Capdegelle; P Timon-David
Journal:  Lancet       Date:  1995-12-09       Impact factor: 79.321

3.  High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction.

Authors:  G Snounou; S Viriyakosol; X P Zhu; W Jarra; L Pinheiro; V E do Rosario; S Thaithong; K N Brown
Journal:  Mol Biochem Parasitol       Date:  1993-10       Impact factor: 1.759

Review 4.  Rapid diagnostic tests for malaria parasites.

Authors:  Anthony Moody
Journal:  Clin Microbiol Rev       Date:  2002-01       Impact factor: 26.132

5.  Malaria in Mauritania: the first cases of malaria endemic to Nouakchott.

Authors:  H Cortes; F Morillas-Márquez; A Valero
Journal:  Trop Med Int Health       Date:  2003-04       Impact factor: 2.622

6.  Population structure of Plasmodium falciparum isolates during an epidemic in southern Mauritania.

Authors:  S Jordan; T Jelinek; A O Aida; G Peyerl-Hoffmann; C Heuschkel; A O el Valy; E M Christophel
Journal:  Trop Med Int Health       Date:  2001-10       Impact factor: 2.622

7.  Identification of Plasmodium falciparum-infected mosquitoes by a double antibody enzyme-linked immunosorbent assay.

Authors:  T R Burkot; J L Williams; I Schneider
Journal:  Am J Trop Med Hyg       Date:  1984-09       Impact factor: 2.345

8.  Comparative testing of monoclonal antibodies against Plasmodium falciparum sporozoites for ELISA development.

Authors:  R A Wirtz; F Zavala; Y Charoenvit; G H Campbell; T R Burkot; I Schneider; K M Esser; R L Beaudoin; R G Andre
Journal:  Bull World Health Organ       Date:  1987       Impact factor: 9.408

9.  Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction.

Authors:  J A Scott; W G Brogdon; F H Collins
Journal:  Am J Trop Med Hyg       Date:  1993-10       Impact factor: 2.345

10.  Low autochtonous urban malaria in Antananarivo (Madagascar).

Authors:  Léon Paul Rabarijaona; Frédéric Ariey; Robert Matra; Sylvie Cot; Andrianavalona Lucie Raharimalala; Louise Henriette Ranaivo; Jacques Le Bras; Vincent Robert; Milijaona Randrianarivelojosia
Journal:  Malar J       Date:  2006-03-31       Impact factor: 2.979

View more
  14 in total

1.  Increasing prevalence of Plasmodium vivax among febrile patients in Nouakchott, Mauritania.

Authors:  Mohamed Salem Ould Ahmedou Salem; Khadijetou Mint Lekweiry; Jemila Mint Deida; Ahmed Ould Emouh; Mohamed Ould Weddady; Ali Ould Mohamed Salem Boukhary; Leonardo K Basco
Journal:  Am J Trop Med Hyg       Date:  2015-01-12       Impact factor: 2.345

2.  The international limits and population at risk of Plasmodium vivax transmission in 2009.

Authors:  Carlos A Guerra; Rosalind E Howes; Anand P Patil; Peter W Gething; Thomas P Van Boeckel; William H Temperley; Caroline W Kabaria; Andrew J Tatem; Bui H Manh; Iqbal R F Elyazar; J Kevin Baird; Robert W Snow; Simon I Hay
Journal:  PLoS Negl Trop Dis       Date:  2010-08-03

3.  Cloning and heterologous expression of Plasmodium ovale dihydrofolate reductase-thymidylate synthase gene.

Authors:  Srisuda Tirakarn; Pinpunya Riangrungroj; Palangpon Kongsaeree; Mallika Imwong; Yongyuth Yuthavong; Ubolsree Leartsakulpanich
Journal:  Parasitol Int       Date:  2012-01-02       Impact factor: 2.230

4.  Vivax malaria in Mauritania includes infection of a Duffy-negative individual.

Authors:  Nathalie Wurtz; Khadijetou Mint Lekweiry; Hervé Bogreau; Bruno Pradines; Christophe Rogier; Ali Ould Mohamed Salem Boukhary; Jamal Eddine Hafid; Mohamed Salem Ould Ahmedou Salem; Jean-François Trape; Leonardo K Basco; Sébastien Briolant
Journal:  Malar J       Date:  2011-11-03       Impact factor: 2.979

5.  Utility of filter paper for preserving insects, bacteria, and host reservoir DNA for molecular testing.

Authors:  F Karimian; Mm Sedaghat; Ma Oshaghi; F Mohtarami; A Sanei Dehkordi; M Koosha; S Akbari; Ss Hashemi-Aghdam
Journal:  Iran J Arthropod Borne Dis       Date:  2011-12-31

6.  Polymorphism of the merozoite surface protein-1 block 2 region in Plasmodium falciparum isolates from Mauritania.

Authors:  Mohamed Salem O Ahmedou Salem; Magatte Ndiaye; Mohamed OuldAbdallahi; Khadijetou M Lekweiry; Hervé Bogreau; Lassana Konaté; Babacar Faye; Oumar Gaye; Ousmane Faye; Ali O Mohamed Salem O Boukhary
Journal:  Malar J       Date:  2014-01-23       Impact factor: 2.979

7.  Efficacy of chloroquine for the treatment of Plasmodium vivax in the Saharan zone in Mauritania.

Authors:  Mohamed Salem Ould Ahmedou Salem; Yeslim Ould Mohamed Lemine; Jemila Mint Deida; Mohamed Aly Ould Lemrabott; Mohamed Ouldabdallahi; Mamadou Dit Dialaw Ba; Ali Ould Mohamed Salem Boukhary; Mohamed Lemine Ould Khairy; Mohamed Boubacar Abdel Aziz; Pascal Ringwald; Leonardo K Basco; Saidou Doro Niang; Sidi Mohamed Lebatt
Journal:  Malar J       Date:  2015-01-28       Impact factor: 2.979

Review 8.  Malaria in Mauritania: retrospective and prospective overview.

Authors:  Khadijetou Mint Lekweiry; Mohamed Salem Ould Ahmedou Salem; Leonardo K Basco; Sébastien Briolant; Jamaleddine Hafid; Ali Ould Mohamed Salem Boukhary
Journal:  Malar J       Date:  2015-03-04       Impact factor: 2.979

9.  Absence of dry season Plasmodium parasitaemia, but high rates of reported acute respiratory infection and diarrhoea in preschool-aged children in Kaédi, southern Mauritania.

Authors:  Sunkaru Touray; Hampâté Bâ; Ousmane Bâ; Mohamedou Koïta; Cheikh B Ould Ahmed Salem; Moussa Keïta; Doulo Traoré; Ibrahima Sy; Mirko S Winkler; Jürg Utzinger; Guéladio Cissé
Journal:  Parasit Vectors       Date:  2012-09-07       Impact factor: 3.876

10.  Sub-National Targeting of Seasonal Malaria Chemoprevention in the Sahelian Countries of the Nouakchott Initiative.

Authors:  Abdisalan Mohamed Noor; Eliud Kibuchi; Bernard Mitto; Drissa Coulibaly; Ogobara K Doumbo; Robert W Snow
Journal:  PLoS One       Date:  2015-08-31       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.