Literature DB >> 19351416

Lack of association between PRNP 1368 polymorphism and Alzheimer's disease or vascular dementia.

Byung-Hoon Jeong1, Kyung-Hee Lee, Yun-Jung Lee, Yun Joong Kim, Eun-Kyoung Choi, Young-Hoon Kim, Young-Sook Cho, Richard I Carp, Yong-Sun Kim.   

Abstract

BACKGROUND: Polymorphisms of the prion protein gene (PRNP) at codons 129 and 219 play an important role in the susceptibility to Creutzfeldt-Jakob disease (CJD), and might be associated with other neurodegenerative disorders. Several recent reports indicate that polymorphisms outside the coding region of PRNP modulate the expression of prion protein and are associated with sporadic CJD, although other studies failed to show an association. These reports involved the polymorphism PRNP 1368 which is located upstream from PRNP exon 1. In a case-controlled protocol, we assessed the possible association between the PRNP 1368 polymorphism and either Alzheimer's disease (AD) or vascular dementia (VaD).
METHODS: To investigate whether the PRNP 1368 polymorphism is associated with the occurrence of AD or VaD in the Korean population, we compared the genotype, allele, and haplotype frequencies of the PRNP 1368 polymorphism in 152 AD patients and 192 VaD patients with frequencies in 268 healthy Koreans. RESULTS AND
CONCLUSION: Significant differences in genotype, allele and haplotype frequencies of PRNP 1368 polymorphism were not observed between AD and normal controls. There were no significant differences in the genotype and allele frequencies of the PRNP 1368 polymorphism between Korean VaD patients and normal controls. However, in the haplotype analysis, haplotype Ht5 was significantly over-represented in Korean VaD patients. This was the first genetic association study of a polymorphism outside the coding region of PRNP in relation to AD and VaD.

Entities:  

Mesh:

Substances:

Year:  2009        PMID: 19351416      PMCID: PMC2676277          DOI: 10.1186/1471-2350-10-32

Source DB:  PubMed          Journal:  BMC Med Genet        ISSN: 1471-2350            Impact factor:   2.103


Background

Alzheimer's disease (AD), the most common cause of dementia in the aged population, is associated with progressive memory deterioration and disordered cognitive function resulting from a loss of cholinergic transmission and characterized neuropathologically by the presence of neurofibrillary tangles and amyloid plaques in the brain and clinically by gradual loss of memory. These changes may result from destructive processes involving the disruption of microtubule assembly and synaptic loss. Further neuronal damage and disease progression are consequences of this damage. Although the processes involved in AD could be triggered by many environmental factors, genetic studies have shown that in some cases mutations and polymorphisms of particular genes can confer susceptibility to the degenerative process. Several genes associated with AD have been identified, including amyloid precursor protein gene (APP), presenilin-1 gene (PS1), presenilin-2 gene (PS2), and the apolipoprotein E gene (ApoE) [1]. AD and prion diseases, such as Creutzfeldt-Jakob disease (CJD), share a number of clinical, pathogenetic and pathological features. A structural hallmark of AD is amyloid-β peptide (Aβ) aggregates in extracellular amyloid deposits defined as senile plaques, while in CJD there is an accumulation of abnormal protease-resistant isoform (PrPres) in neurons and in extracellular amyloid-like aggregates. Aβ-positive senile plaques in AD brains commonly contain PrPC deposits [2-4] and incidental Aβ-positive senile plaques in prion diseases such as CJD may also be positive for PrPC [5]. Vascular dementia (VaD) is the second most common cause of dementia after AD. VaD is a clinical syndrome causing cognitive decline due to cerebrovascular lesions. Risk factors for VaD are age, sex, race, hypertension, smoking, diabetes mellitus, and hypercholesterolemia. However, there is no conclusive evidence for the association of genetic polymorphisms with VaD. VaD and prion diseases share some pathophysiological similarities, such as the occurrence of dementia. Prion protein contains 253 amino acids encoded by prion protein gene (PRNP), located on chromosome 20p12.3 in humans. PRNP plays an important role in conferring susceptibility or resistance to prion disease. A number of mutations in the open reading frame (ORF) are linked to the familial form of prion diseases [6,7]. Polymorphisms at codons 129 or 219 of PRNP are susceptibility factors to sporadic CJD [8-11]. In several European populations, an association between the PRNP codon 129 polymorphism and AD was reported [12-15]. In contrast to these studies, other studies failed to detect a significant association between this polymorphism and AD [16-18], and in Asian populations, no association between the PRNP codons 129/219 polymorphisms and AD was reported [19]. Recently, the polymorphism (PRNP 1368) in an upstream of PRNP exon 1 was found to be associated with sporadic CJD in British and German populations [20,21], but this association was not seen in Dutch and Korean populations [22,23]. This polymorphism was studied in other diseases in addition to sporadic CJD. In a British population, there was no association of PRNP 1368 polymorphism with frontotemporal lobar degeneration (FTLD) [24]. Although PRNP 1368 polymorphism has been studied in sporadic CJD and FTLD patients, a case-controlled association study between the PRNP 1368 polymorphism and either AD or VaD has not been reported thus far. In the present study, the purpose was to investigate the genotype and allele frequency of a polymorphism outside the coding region of PRNP in Korean AD and VaD patients and to determine the correlation between this polymorphism and the incidence of AD and VaD in the Korean population.

Methods

Subjects

Analysis included 152 Korean patients with AD (51 male and 101 female; mean age at disease onset 73.48 ± 8.00 years), which were diagnosed according to the National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) criteria [25] with minor modification specifying the gradual onset and progression of memory loss with a duration of at least 12 months. None of these patients reported family history of AD. All AD patients were gathered from Chunchon, South Korea and were examined in the Department of Neurology, Chunchon Sacred Heart Hospital. General medical and neurological examinations, neuropsychological testing, and computed topography scans were performed to exclude other forms of dementia. Blood samples were collected from 152 AD patients between May 2000 and June 2005. One hundred ninety two Korean patients with VaD (100 male and 92 female; mean age: 71.95 ± 8.92 years) were diagnosed according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) [26] and National Institute of Neurological Disorders and Stroke-Association Internationale pour la Recherche et l'Enseignement en Neurosciences (NINDS-AIREN) criteria [27] after clinical examination and neuropsychological testing, including mini-mental state examination (MMSE). VaD patients were gathered from Anyang, South Korea and were examined in the Department of Neurology, Hallym University Hospital. Blood samples were collected from 192 VaD patients between May 2000 and June 2008. The control subjects were 268 unrelated individuals (118 male and 150 female; mean age 71.17 ± 8.68 years) matched for age and ethnic background to AD patients and VaD patients (Table 1). All control subjects were volunteers recruited from routine health checkups at the Chunchon Sacred Heart Hospital. None of them presented symptoms of dementia or any movement disorders. Absence of dementia was determined by considering past history and Korean MMSE criterion (score of >24). Blood samples were collected from 268 healthy Korean volunteers between May 2000 and June 2005. The study was approved by the Ethical Committee of Chunchon Sacred Heart Hospital and an informed consent was given by all subjects or their caregivers. All blood samples were frozen at -70°C prior to analysis.
Table 1

Characteristics of AD and VaD patients and controls

ControlADP valueaVaDP valuea
Number of subjects268152192
Gender
 Male, n (%)118 (44.0%)51 (33.55%)0.014100 (52.1%)0.090
 Female, n (%)150 (56.0%)101 (66.45%)92 (47.9%)
Mean age at disease onset (years ± SD)-73.48 ± 8.000.00671.95 ± 8.920.348
Mean age at blood collection (years ± SD)71.17 ± 8.68--

aBased on the difference between controls and AD or VaD patients

Characteristics of AD and VaD patients and controls aBased on the difference between controls and AD or VaD patients

Genotyping

Genomic DNA was extracted from 200 μl blood using the QIAamp DNA blood mini kit (Qiagen, USA) following the supplier's instructions. Polymerase chain reaction (PCR) was performed with J-1 (GAGAAAACCTTGCGTCAGCA) and J-2 (AAGGTGCAGAAAAGATGGGC) primers. These primers were designed to amplify a 586 bp product in an upstream region of PRNP exon 1. The PCR reagents contained 50 pmole of each primer, 5 μl of 10 × Taq DNA polymerase buffer, 1.5 mM MgCl2, 0.2 mM of each dNTP mixtures, and 2.5 units of Taq DNA polymerase (Promega, USA). The PCR conditions were 94°C for 2 min to denature, and 35 cycles of 94°C for 45 sec, 56°C for 45 sec, and 72°C for 1 min 30 sec, and then 1 cycle of 72°C for 10 min to extend the reaction. The Perkin-Elmer Cetus DNA thermal cycler (Pekin-Elmer, USA) was used. Restriction cleavage sites were searched using Webcutter, ver. 2.0 (Carolina Biological Supply Co., USA). A 20 μl aliquot of purified PCR mixture was digested at 37°C for 1 h with 5 units of Pvu II (Invitrogen, USA). Restriction products were separated on a 1.5% agarose gel and visualized with ethidium bromide staining under UV light. The purification of PCR products for sequencing was done using a QIAquick gel extraction kit (Qiagen, USA). The PCR products were directly sequenced on an ABI 377 automatic sequencer using a Taq dideoxy terminator cycle sequencing kit (ABI, USA) and the same primers as indicated earlier in the standard conditions.

Statistical analyses

A χ2 test was used to determine whether the PRNP 1368 polymorphism was in Hardy-Weinberg equilibrium (HWE) in the Korean population. Odds ratios (OR) with 95% confidence interval (CI) and P-values were calculated by using the codominant model, controlling for age and sex as covariates. Differences in age of populations were analyzed using Student's t-test, and sex differences by using χ2 test. Haplotypes and their frequencies were inferred using the algorithm developed by Stephens et al. [28]. Fisher's exact test was used to analyze differences in haplotype frequency between the normal population and patients with AD and VaD. The statistical powers were calculated using Statistical Power Calculator .

Results

The genotype frequencies at PRNP 1368 were in HWE in Korean control group (P = 0.742) and AD group (P = 0.226), not in VaD group (P = 0.025) (data not shown). To examine a correlation between the PRNP 1368 polymorphism and susceptibility of AD in Koreans, we examined the genotype and allele frequencies of this polymorphism in 152 Korean AD patients and in 268 healthy controls. No significant difference between Korean AD patients and controls was found in genotype or allele frequency of the PRNP 1368 polymorphism (Table 2). This result suggests that the PRNP 1368 polymorphism does not increase susceptibility to AD. When our data set was stratified by gender, there was no significant association between this polymorphism and AD (data not shown).
Table 2

Genotype and allele frequencies of the PRNP 1368 polymorphism in the normal population, AD patients, and VaD patients

Control(n = 268)AD(n = 152)VaD(n = 192)AD vs ControlVaD vs control


ORa95% CIbP valueOR95%CIP value
Genotype frequency
 CC103 (38.4)56 (36.8)84 (43.8)------
 CT124 (46.3)67 (44.1)74 (38.5)0.9940.640 – 1.5440.9780.7320.487 – 1.1000.133
 TT41 (15.3)29 (20.1)34 (17.7)1.3010.731 – 2.3150.3711.0170.594 – 1.7420.952
Allele frequency
 C330 (61.6)179 (58.9)242 (63.0)------
 T206 (38.4)125 (41.1)142 (37.0)1.1190.839 – 1.4910.4440.9400.717 – 1.2320.654

Figures in parentheses are percentages

aOdds ratio

bConfidence interval

Genotype and allele frequencies of the PRNP 1368 polymorphism in the normal population, AD patients, and VaD patients Figures in parentheses are percentages aOdds ratio bConfidence interval We also investigated the genotype and allele frequencies of PRNP 1368 in 192 Korean VaD patients to determine whether this polymorphism correlated with VaD. There were no significant differences in genotype and allele frequencies between VaD patients and controls (Table 2). In addition, analysis of the haplotype frequency was performed in AD patients, VaD patients and controls. Six haplotypes of the 3 PRNP polymorphisms were constructed in Koreans. One (ht 5) of these six haplotypes was significantly over-represented in Korean VaD patients (Table 3).
Table 3

Haplotype frequency of three PRNP polymorphisms in the normal population, AD patients, and VaD patients

Haplotypes1368Codon 129Codon 219FrequencyP value

ADVaDControlAD vs ControlVaD vs ControlAD vs VaD
ht1CAG0.55920.56220.5951---
ht2TAG0.36180.36230.34500.4790.4510.996
ht3TAA0.02630.01420.02920.9900.1670.215
ht4TGG0.01970.00370.01150.2800.2520.050
ht5CAA0.01640.03520.01090.3330.0130.226
ht6CGG0.00660.02240.00831.00.0780.197
Haplotype frequency of three PRNP polymorphisms in the normal population, AD patients, and VaD patients

Discussion

In this study, we failed to detect a significant association between the PRNP 1368 polymorphism and the occurrence of either AD or VaD in the Korean population. There is the possibility that the PRNP 1368 polymorphism is not functional with regard to affecting the level of PrPC. Another possibility is that a false negative result was obtained due to statistical powers. Data for AD and VaD patients showed a statistical power of 19.1% and 11.2%, respectively, at the Type I error rate of 0.05 compared with healthy controls. The statistical powers aren't high enough for ensuring that the PRNP 1368 polymorphism is not relevant to prion replication. However, in the haplotype analysis among 3 PRNP polymorphisms, haplotype ht5 was the only haplotype significantly associated with VaD (p = 0.013) (Table 3) and the genotype frequency of PRNP 1368 polymorphism in VaD patients was not in HWE. These results suggested some interaction among 3 PRNP polymorphisms in the determination of VaD risk and were needed for further evaluation of the association of PRNP 1368 polymorphism with VaD in other ethnic groups. Although the exact function of the prion protein is not fully understood, it might be involved in the development and intensity of oxidative stress and, thereby, contribute to neurodegeneration. Thus, polymorphisms in the coding region of PRNP might influence other neurodegenerative disorders in addition to prion diseases. Many studies on a correlation between the PRNP codon 129 and AD in various populations have yielded contradictory results [12-19]. This controversial result may be due to the different sample size of the population analyzed, to a difference in frequency of PRNP genotypes between different ethnic groups [29], or even to a difference in age of onset. In our previous studies, we failed to detect a significant association between PRNP polymorphism at codons 129/219 and the risk for AD or VaD in the Korean population [30,31]. Recently, there has been growing concern about several polymorphisms outside the ORF of PRNP, as there is evidence that levels of PRNP expression influence incubation time and the susceptibility to prion diseases. Polymorphisms in the PRNP promoter region may be associated with increased susceptibility of prion diseases in cattle and mice [32-34]. These PRNP promoter polymorphisms influence the PRNP gene expression level [35]. Overexpression of PRNP in transgenic mice led to a decrease in incubation time, whereas PRNP knockout mice were resistant to prion disease after infection [36,37]. Therefore, we suggest that the polymorphism of PRNP 1368, located in the promoter region, may influence the expression of the PRNP gene; the promoter polymorphisms of PRNP might also be associated with other neurodegenerative diseases. In previous studies, several polymorphisms were identified in intronic and upstream regions of human PRNP. The single nucleotide polymorphism (SNP) at position -101 (PRNP 12533) within the regulatory region of PRNP was associated with sporadic CJD in the British population [38], but not in samples derived from Dutch and German populations [20,39]. Even though these results did not show a relationship between PRNP 1368 and AD or VaD, it would be useful to assess associations between AD/VaD and other PRNP polymorphisms in the promoter region, including the PRNP 12533 polymorphism.

Conclusion

PRNP 1368 polymorphism was not significantly associated with incidence of sporadic AD and VaD in Koreans. However, in the haplotype analysis among 3 PRNP polymorphisms, we observed a significant association between haplotype ht5 and VaD. Our report is the first association study of a polymorphism outside the coding region of PRNP with AD and VaD.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

BHJ and YSK designed the study. BHJ, KHL, and YJL performed the genotyping. BHJ, YJK, EKC, YHK, YSC, and YSK analyzed the data. BHJ, EKC, and YJK performed statistical analysis. BHJ, YJK, RIC, and YSK wrote the paper. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here:
  37 in total

1.  A new statistical method for haplotype reconstruction from population data.

Authors:  M Stephens; N J Smith; P Donnelly
Journal:  Am J Hum Genet       Date:  2001-03-09       Impact factor: 11.025

2.  PRNP Val129 homozygosity increases risk for early-onset Alzheimer's disease.

Authors:  Bart Dermaut; Esther A Croes; Rosa Rademakers; Marleen Van den Broeck; Marc Cruts; Albert Hofman; Cornelia M van Duijn; Christine Van Broeckhoven
Journal:  Ann Neurol       Date:  2003-03       Impact factor: 10.422

3.  Absence of association between codon 129/219 polymorphisms of the prion protein gene and Alzheimer's disease in Japan.

Authors:  Takuya Ohkubo; Yuji Sakasegawa; Takashi Asada; Toru Kinoshita; Yuichi Goto; Hideo Kimura; Hidehiro Mizusawa; Naomi S Hachiya; Kiyotoshi Kaneko
Journal:  Ann Neurol       Date:  2003-10       Impact factor: 10.422

4.  PRNP contains both intronic and upstream regulatory regions that may influence susceptibility to Creutzfeldt-Jakob Disease.

Authors:  James E McCormack; Herbert N Baybutt; Dawn Everington; Robert G Will; James W Ironside; Jean C Manson
Journal:  Gene       Date:  2002-04-17       Impact factor: 3.688

5.  Polymorphism at codon 129 of the prion protein gene is not associated with sporadic AD.

Authors:  O Combarros; M Sánchez-Guerra; J Llorca; A Alvarez-Arcaya; J Berciano; N Peña; C Fernández-Viadero
Journal:  Neurology       Date:  2000-08-22       Impact factor: 9.910

6.  Immunohistochemistry for the prion protein: comparison of different monoclonal antibodies in human prion disease subtypes.

Authors:  Gábor G Kovács; Mark W Head; Ivan Hegyi; Tristan J Bunn; Helga Flicker; Johannes A Hainfellner; Linda McCardle; Lajos László; Christa Jarius; James W Ironside; Herbert Budka
Journal:  Brain Pathol       Date:  2002-01       Impact factor: 6.508

7.  Sporadic--but not variant--Creutzfeldt-Jakob disease is associated with polymorphisms upstream of PRNP exon 1.

Authors:  S Mead; S P Mahal; J Beck; T Campbell; M Farrall; E Fisher; J Collinge
Journal:  Am J Hum Genet       Date:  2001-11-05       Impact factor: 11.025

8.  PRNP 1368 polymorphism is not associated with sporadic Creutzfeldt-Jakob disease in the Korean population.

Authors:  B-H Jeong; K-H Lee; Y-J Lee; Y-H Kim; Y-S Cho; R I Carp; Y-S Kim
Journal:  Eur J Neurol       Date:  2008-06-28       Impact factor: 6.089

9.  Polymorphisms within the prion (PrP) and prion-like protein (Doppel) genes in AD.

Authors:  E Golanska; K Hulas-Bigoszewska; E Rutkiewicz; M Styczynska; B Peplonska; M Barcikowska; J Bratosiewicz-Wasik; P P Liberski
Journal:  Neurology       Date:  2004-01-27       Impact factor: 9.910

10.  Prion protein gene polymorphism and Alzheimer's disease: one modulatory trait of cognitive decline?

Authors:  V M Casadei; C Ferri; E Calabrese; L M Grimaldi; M Franceschi; F Veglia; F Licastro; C Mariani
Journal:  J Neurol Neurosurg Psychiatry       Date:  2001-08       Impact factor: 10.154

View more
  6 in total

1.  Association between the PRNP 1368 polymorphism and the occurrence of sporadic Creutzfeldt-Jakob disease.

Authors:  Jolanta Bratosiewicz-Wąsik; Joanna Smoleń-Dzirba; Annemieke J Rozemuller; Casper Jansen; Wim Spliet; Gerard H Jansen; Tomasz J Wąsik; Paweł P Liberski
Journal:  Prion       Date:  2012-08-16       Impact factor: 3.931

2.  Lack of association between 14-3-3 beta gene (YWHAB) polymorphisms and sporadic Creutzfeldt-Jakob disease (CJD).

Authors:  Byung-Hoon Jeong; Hyoung-Tae Jin; Eun-Kyoung Choi; Richard I Carp; Yong-Sun Kim
Journal:  Mol Biol Rep       Date:  2012-10-11       Impact factor: 2.316

Review 3.  Pathways to neurodegeneration: mechanistic insights from GWAS in Alzheimer's disease, Parkinson's disease, and related disorders.

Authors:  Vijay K Ramanan; Andrew J Saykin
Journal:  Am J Neurodegener Dis       Date:  2013-09-18

Review 4.  Can infections cause Alzheimer's disease?

Authors:  Francis Mawanda; Robert Wallace
Journal:  Epidemiol Rev       Date:  2013-01-24       Impact factor: 6.222

5.  Genotype patterns and characteristics of PRNP in the Korean population.

Authors:  Sol Moe Lee; Young Ran Ju; Bo-Yeong Choi; Jae Wook Hyeon; Jun Sun Park; Chi Kyeong Kim; Su Yeon Kim
Journal:  Prion       Date:  2012-05-07       Impact factor: 3.931

Review 6.  Characterization of mutations in PRNP (prion) gene and their possible roles in neurodegenerative diseases.

Authors:  Eva Bagyinszky; Vo Van Giau; Young Chul Youn; Seong Soo A An; SangYun Kim
Journal:  Neuropsychiatr Dis Treat       Date:  2018-08-14       Impact factor: 2.570

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.