Raquel Iglesias-Fernández1, Angel Matilla. 1. Department of Plant Physiology, Faculty of Pharmacy, University of Santiago de Compostela, 15782-Santiago de Compostela, Spain.
Abstract
After-ripening (AR) in Sisymbrium officinale seeds altered SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6 gene expression. Except for SoGA20ox2 expression, which sharply diminished, the expression of the other genes rose during development, particularly that of SoACS7. In contrast, only the SoACO2 and SoGA2ox6 transcripts increased with seed desiccation; the others decreased. AR increased the SoGA3ox2 transcript in dry seed, but dramatically decreased the SoACS7 transcript. At the onset of imbibition, AR inhibited SoACS7 and SoACO2 expression and stimulated that of SoGA20ox2, SoGA3ox2, and SoGA2ox6, demonstrating that the participation of ethylene (ET) and gibberellins (GAs) differs in after-ripened and non-after-ripened seeds. The inhibition of SoACO2 expression in the presence of GA(4+7), paclobutrazol (PB), inhibitors of ET synthesis and signalling (IESS), and notably ET+GA(4+7) indicated ET-GA cross-talk in non-after-ripened seeds. A positive effect of AR in reversing this inhibition was found. The idea of ET-GA cross-talk is also supported by the effect of ET on SoGA3ox2 expression, notably induced by the AR process. In contrast, SoGA20ox2 expression did not appear to be susceptible to AR. SoGA2ox6 expression, poorly known in seeds, suggests that AR prompted an up-regulation under all treatments studied, whereas in non-after-ripened seeds expression was down-regulated. On the other hand, the beta-mannanase (MAN) activity dramatically increased in dry after-ripened seed, being significantly boosted by ET. The absence of MAN inhibition by IESS suggests that although ET seems to be one of the factors controlling MAN, its presence did not appear to be essential. GA(4+7) only increased MAN in seeds which were after-ripened. Here, it is proposed that ET and GAs participate actively in establishing the AR process.
After-ripening (AR) in Sisymbrium officinale seeds altered SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6 gene expression. Except for SoGA20ox2 expression, which sharply diminished, the expression of the other genes rose during development, particularly that of SoACS7. In contrast, only the SoACO2 and SoGA2ox6 transcripts increased with seed desiccation; the others decreased. AR increased the SoGA3ox2 transcript in dry seed, but dramatically decreased the SoACS7 transcript. At the onset of imbibition, AR inhibited SoACS7 and SoACO2 expression and stimulated that of SoGA20ox2, SoGA3ox2, and SoGA2ox6, demonstrating that the participation of ethylene (ET) and gibberellins (GAs) differs in after-ripened and non-after-ripened seeds. The inhibition of SoACO2 expression in the presence of GA(4+7), paclobutrazol (PB), inhibitors of ET synthesis and signalling (IESS), and notably ET+GA(4+7) indicated ET-GA cross-talk in non-after-ripened seeds. A positive effect of AR in reversing this inhibition was found. The idea of ET-GA cross-talk is also supported by the effect of ET on SoGA3ox2 expression, notably induced by the AR process. In contrast, SoGA20ox2 expression did not appear to be susceptible to AR. SoGA2ox6 expression, poorly known in seeds, suggests that AR prompted an up-regulation under all treatments studied, whereas in non-after-ripened seeds expression was down-regulated. On the other hand, the beta-mannanase (MAN) activity dramatically increased in dry after-ripened seed, being significantly boosted by ET. The absence of MAN inhibition by IESS suggests that although ET seems to be one of the factors controlling MAN, its presence did not appear to be essential. GA(4+7) only increased MAN in seeds which were after-ripened. Here, it is proposed that ET and GAs participate actively in establishing the AR process.
The seed, which is the dispersal unit in angiosperms and ensures the survival and perpetuation of the mother plant, is formed by zygotic embryogenesis. This complex process, regulated by hormones and a developmental programme (Yamaguchi and Nambara, 2006, and references therein), is divided into two extensive phases called morphogenesis and maturation. During seed maturation, the cell cycle ceases, molecular dependence on the mother plant disappears, water content diminishes, storage products are synthesized, abscisic acid (ABA) accumulates, and primary dormancy is established (reviewed in Hilhorst and Toorop, 1997; Raz ; Finkelstein ; Kermode, 2005; Weber ; Finch-Savage and Leubner-Metzger, 2006; Holdsworth ). Dormancy, defined as the failure of an intact viable seed to germinate under favourable conditions, is an adaptive trait optimizing germination to the most suitable time for the seed to complete its life cycle (Finch-Savage and Leubner-Metzger, 2006; Bentsink ). Thus, in order for germination to begin, seed dormancy must be lost (Filkelstein et al., 2008).After-ripening (AR) is one way to overcome seed dormancy. A recent concept of seed AR suggested that this process triggers a widening or increasing sensitivity of seeds to environmental conditions, promoting germination, at the same time as it narrows or decreases sensitivity to conditions that repress germination (Finch-Savage and Leubner-Metzger, 2006). Seed AR is determined by moisture and oil contents, seed covering structures, and temperature, and requires seed moisture contents above a threshold value (Manz , and references therein). The main seed AR effects can be grouped as: (i) a widening of the temperature range for germination (Oracz ); (ii) a lowering of the ABA level and sensitivity plus a rise in sensitivity to gibberellins (GAs) or loss of requirement for GAs (Grappin ; Ali-Rachedi ; Cadman ); (iii) a loss of light requirement for germination of seeds that do not germinate in darkness (Derks and Karssen, 1993) and an increase in seed sensitivity to light in seeds that do not germinate even with light (Derks and Karssen, 1993; Batlla and Benech-Arnold, 2005, and references therein); (iv) a loss of the nitrate requirement (Derks and Karssen, 1993; Alboresi , and references therein); and (v) an accelerated germination velocity (reviewed by Finch-Savage and Leubner-Metzger, 2006; Holdsworth ). However, although the need for AR is well known in several species, it has been hardly studied at the molecular level with respect to changes induced by AR signals in the dry viable seed and their impact during imbibition (Kucera ; Finch-Savage and Leubner-Metzger, 2006; Holdsworth ). Recent results indicate that non-imbibed seeds (i.e. dry seeds), characterized by a low moisture level, are competent for both transcription and translation. Thus, the AR process in viable dry seeds can positively or negatively alter the level of several transcripts (Bove ; Finch-Savage ; Leymarie ) and proteins (Chibani ). It is probable that there are zones in the dry seed where the moisture level is relatively high (i.e. above the threshold) to allow these alterations (Manz ). This partial and localized imbibition environment was called ‘low hydration’ by Holdsworth . The conditions that generate optimal ‘low hydration’ values for seed AR have been determined (Leubner-Metzger, 2005). Likewise, complex and specific gene networks related to seed AR were recently updated (Finch-Savage and Leubner-Metzger, 2006; Holdsworth , and references therein).Many plant hormones have been shown to be involved in germination (Kucera ). Among these, GAs have long been known as stimulators and ABA as an inhibitor (Finkelstein , 2008; Yamaguchi and Kamiya, 2002; Yamaguchi and Nambara, 2006). However, the role of ethylene (ET) seem less obvious than that of ABA and GAs, since the intervention of ET during the maintenance of seed dormancy and during the transition from dormancy to germination involves a complex network with many steps still to be clarified (Vandenbussche and Van der Straeten, 2007). Thus, opinions vary concerning the developmental stage during which ET regulates dormancy. Some suggest that ET acts minimally during dormancy inception and that its major action is during imbibition to terminate dormancy and/or initiate germination (Matilla and Matilla-Vázquez, 2008, and references therein). In studies using ET response mutants of Arabidopsis, endogenous ET promoted seed germination by decreasing sensitivity to endogenous ABA (Beaudoin ). ET appears to be a negative regulator of ABA during germination (Ghassemian ). In short, ET seems to act antagonistically against ABA during dormancy termination but acts in concert with GAs to promote these transitional changes. Although ET and GAs work together in the process of radicle emergence, the participation of GAs appears to be quantitatively and qualitatively more important. To date, published data indicate that ET is not the hormone that triggers the decisive steps during the appearance and elimination of dormancy in seeds, but rather is part of a complex network of interacting signals involved in dormancy, the details of which are currently difficult to assess with precision. The etr1-2 mutation confers dominant ET insensitivity and as a consequence results in mature seed populations that exhibit more pronounced primary dormancy (Chiwocha ). Moreover, etr1-2 mutation disrupts ABA homeostasis, and auxin, cytokinin, and GA pathways are all affected in mutant seeds (Chiwocha ).Although the signs of seed germination become visible with radicle emergence, it is unquestionable that during the maturation period (Nakabayashi ; Holdsworth ), imbibition (Yamaguchi ; Finch-Savage and Leubner-Metzger, 2006), and dry storage (Grappin ; Holdsworth ) of the seed a series of preparatory processes occur to break seed coats. However, the identity of these processes and their hormonal regulation is far from being known in detail at the molecular level (Kucera ). Similarly, there are major gaps in our knowledge of the control of the molecular mechanisms that participate in the reduction and elimination of dormancy, as in the case of AR, a temporally and environmentally regulated process in the dry seed, which determines the germination potential and the loss of dormancy (Carrera ). At present, most of the information on AR has been provided by studies on tobacco and Arabidopsis. However, the Arabidopsis thaliana accessions Ler and Col have a weak dormancy that is eliminated by short periods of AR (van der Schaar et al., 1997), making these species less suitable for dormancy studies. In contrast, the Cvi accession, which is considered profoundly dormant because it requires several months of AR, is currently used for genetic and molecular studies of dormancy and AR (Alonso et al., 2003; Ali-Rachedi ; Bentsink ; Carrera ; Holdsworth ). In this work, using endospermic seeds of the nitrophilous species hedge mustard, Sisymbrium officinale L., in which dormancy is overcome by a long AR, it is demonstrated that the expression pattern of genes involved in ET synthesis (SoACS7 and SoACO2) and in GA synthesis (SoGA20ox2 and SoGA3ox2) and breakdown (SoGA2ox6) is notably altered during the imbibition period of after-ripened seeds; these alterations are strongly affected by the presence of ET and/or GA4+7. It is proposed that ET–GA cross-talk exists to overcome seed dormancy by AR.
Materials and methods
Plant material and seed after-ripening treatment
Ripe fruits of hedge mustard, S. officinale (L.), were collected in the field in Galicia (north-western Spain) at the time of their natural dispersal (July–August 2006). After harvest, the fruits were dried at room temperature for 1 month to allow separation of seeds from the rest of the fruit (i.e. valves, replum, and pedicel) by hand. After collection, seeds were air-dried for 7 d and mature dark seeds were separated from light ones, which were discarded. Freshly harvested dark seeds (non-after-ripened seeds) were stored dry at 21±0.2 °C for 6 months (after-ripened seeds) until the experiment began. The loss of seed dormancy by AR was demonstrated by means of a germination test. In parallel, fruits of S. officinale were collected at two developmental stages: the first involved whole fruits with early development (early fruits; EF) while the second one included both whole fruits and seeds with very advanced development [late fruits (LF) and late seeds (LS)] .
Germination assays
Three replicates of 50 seeds were sown in 90 mm Petri dishes on two layers of filter paper (Whatman No. 1) moistened with 3 ml of sterile 20 mM KNO3, pH 7.0 (control) supplemented with solutions of gibberellin (100 μM GA4+7, Sigma-Aldrich, Spain), ET (10 μM etephon, Sigma-Aldrich, Spain), an inhibitor of GA synthesis [25 μM paclobutrazol (PB), Sigma-Aldrich, Spain], and a mixture of inhibitors of synthesis [100 μM aminoethoxyvinylglycine (AVG) and 1 mM cobalt chloride (Co2Cl), Sigma-Aldrich, Spain] and signalling of ET [1 mM silver thiosulphate (STS), Sigma-Aldrich, Spain] called IESS (inhibitors of ET synthesis and signalling).Germination experiments were conducted in a growth chamber at 24 °C with a 16 h photoperiod (photosynthetic photon flux density of 55 μmol m−2 s−1). Seeds were not surface-sterilized in order to avoid influencing their dormancy status; in any case, fungal infections were not detected by light microscopy. Seeds were considered germinated when radicle protrusion was visible. Germination tests were performed at least twice using three replicates. The imbibition period in this study ended immediately before the onset of radicle protrusion. The specificity of the ethephon effects in this study was checked as described in Calvo .
Total RNA isolation from seeds and cDNA synthesis
After-ripened and non-after-ripened seeds were imbibed for 0, 3, 6, 12, and 15 h; three replicates of 50 seeds were collected in 2 ml tubes from the Petri dishes, immediately frozen in liquid N2, and stored at –80 °C until RNA extraction. A grinding ball (stainless steel, 0.7 mm) was added to the tubes, and seeds were finely ground in liquid N2 using a Mikro-Dismembrator-S (Sartorius AG, Goettingen, Germany) for 2 min at 1500 rpm. For each point, three replicates were taken. Total RNA was isolated using the phenol extraction/LiCl precipitation method (Verwoerd ). The integrity and purity of the RNA were checked both electrophoretically and by the 260/280 nm absorbance ratio. Total RNA samples were digested with DNase (DNase I recombinant, RNase-Free, Roche, Switzerland) following the manufacturer's directions. The RNA concentration was estimated by A260 measurement, and the samples were stored at –80 °C. Reagents used in this protocol were supplied by Sigma-Aldrich (Spain). The cDNA was synthesized from 1 μg of total RNA using the First-Strand Synthesis kit for RT-PCR (Roche, Switzerland), using oligo-p (dT) as a primer and following the manufacturer's directions. Samples were stored at –20 °C until used.
Isolation of SoACS7, SoACO2, SoGA3ox2, SoGA20ox2, and SoGA2ox6 partial-length cDNA
The cDNA sequences were obtained from seed RNA using degenerate primer pairs based on highly conserved regions of corresponding genes from other species (Table 1). That is, primers were designed in such a way that they would pick up any SoACS, SoACO, SoGA20ox, SoGA3ox, or SoGA2ox, respectively. PCR conditions were as follows: 95 °C for 2 min, 40 cycles of 95 °C for 45 s, 47–55 °C for 45 s, 72 °C for 45 s, and a final elongation step of 7 min at 72 °C. PCRs were performed in a 25 μl reaction volume containing 12.5 μl of 2× Super Premix, Sapphire (Mbiotech, Seoul, Korea), 1 μl of forward primer (100 μM, final concentration 4 μM), 1 μl of reverse primer (100 μM, final concentration 4 μM), and 9.5 μl of sterilized water, and finally 1 μl of cDNA. PCR products were analysed electrophoretically and the bands of the expected size were excised and extracted from the agarose gel using a MiniElute™ Gel Extraction Kit (Qiagen, Hilden, Germany), and then sequenced. Sequences were compared with existing sequences in target databases using BLAST (Altschul ). They contained cDNA sequences of genes with vey high similarity to GA3ox, GA20ox, GA2ox, ACO, and ACS genes of other plant species (GenBank databases). They were named SoACS7, SoACO2, SoGA3ox2, SoGA20ox2, and SoGA2ox6, and registered in GenBank under the accession numbers EU689114, EU689115, EU689111, EU689113, and EU689112, respectively.
Table 1.
List of degenerate primers used for PCR assay in the isolation of partial length cDNAs
Gene
Primer name
Primer sequence (5′–3′)
SoGA3ox2
FwConGA3ox
ATGTGGTCNGAAGGNTTCAC
RvConGA3ox
ATGTGNAANAAGTCACC
SoGA20ox2
FwConGA20ox
AADCTNCCNTGGAARGAGAC
RvConGA20ox
TGBAARCARCTCTTGTA
SoGA2ox6
FwConGA2ox
GGNTTYGGAGARCAYWCWGACCC
RvSoGA2ox
CACTNNTAAAYCTYCCATTNGTCA
SoACO2
FwConACO
ATGGAGAGAACATCAAGYTTYCTVTT
RvConACo
TTAGAATGTCTCCTCVGTNGCCA
SoACS7
FwConACS
CCAGGGTTTGATAGAGATTTGAG
RvConACS
GCAGNSGACGCAAATYCATCC
List of degenerate primers used for PCR assay in the isolation of partial length cDNAs
Real-time semi-quantitative PCR assay
Semi-quantitative PCR analysis was performed with the cDNA obtained as described above as a template. Specific primer design was performed using the sequences found for SoGA3ox2, SoGA20ox2, SoGA2ox6, SoACO2, and SoACS7 (Table 2). Meanwhile, 18S RNA was used as a control for the genes studied, since it was found to be expressed at constant levels throughout the study period (Supplementary Figs S1, S2 available at JXB online). The PCR was performed in an iCycler iQ™ Real-time Detection System (Bio-Rad Laboratories, Hercules, CA, USA). For each 25 μl reaction, a 1 μl cDNA sample was mixed with 12.5 μl of IQ™ SYBR® Green Supermix (Bio-Rad Laboratories), 0.5 μl of forward primer (12 μM, final concentration 240 nM), 0.5 μl of reverse primer (12 μM, final concentration 240 nM), and 10.5 μl of sterilized water. Samples were subjected to thermal cycling conditions of DNA polymerase activation at 95 °C for 4 min, 40 cycles of 45 s at 95 °C, 45 s at 52 °C (for SoGA20ox2 and SoGA2ox6) or 55 °C (for SoGA3ox2, SoACO2, and SoACS7), 45 s at 72 °C, and 45 s at 80 °C; a final elongation step of 7 min at 72 °C was performed. The melting curve was designed to increase 0.5 °C every 10 s from 62 °C (for SoGA20ox2 and SoGA2ox6) or 65 °C (for SoGA3ox2, SoACO2, and SoACS7). Real-time PCR analysis was performed with two different cDNAs from the same time point (from two different RNAs), and each was made in triplicate. The amplicon was analysed by electrophoresis and sequenced once for identity confirmation. Real-time PCR efficiency was estimated via a calibration dilution curve and slope calculation. Expression levels were determined as the number of cycles needed for the amplification to reach a threshold fixed in the exponential phase of the PCR (CT). The ΔΔCT method was used to analyse data (Pfaffl, 2001). In order to observe the alterations in the transcript levels, the expression in dry seeds was used to relativize data (Finch-Savage ).
Table 2.
List of primers used for the real-time PCR assay
Gene
Primer name
Primer sequence (5′–3′)
Amplicon size (bp)
SoGA3ox2
FwSoGA3ox2
CTGTGGTTGGCATTAGGTTC
168
RvSoGA3ox2
GAGAGTTGAGTCGGTATGGG
SoGA20ox2
FwSoGA20ox2
GGTCTTGGTGAAGGATGG
157
Rv SoGA20ox2
AAGATCATGGAGCTTCTGG
SoGA2ox6
Fw SoGA2ox6
GTAGATGGACTTGAGATTTGC
89
Rv SoGA2ox6
CAGTCACCGACCAATACG
SoACO2
FwSoACO2
GGTGATAACCAACGGCAAGT
89
RvSoACO2
TGTAGAACGAGGCAATGGAC
SoACS7
FwSoACS7
GGCTTCTATGTTGTCGGA
113
RvSoACS7
CGATCCCTGCCTTCTTA
18S RNA
Fw18S-RNA
GGCTCGAAGACGATCAGATA
87
Rv18S-RNA
TCATAAGGTGCCGGCGGAGT
List of primers used for the real-time PCR assay
Endo-β-mannanase (EC 3.2.1.78) activity
Triplicate lots of after-ripened and non-after-ripened seeds were ground in 1 M sodium acetate buffer, pH 4.7 (Sigma Aldrich, Spain). After centrifugation at 20 000 g at 4 °C for 45 min, the supernatants were assayed in duplicate for endo-β-mannanase (MAN) activity. For enzymatic determination, 100 μl of 0.25% (w/v) AZC L-galactomannan (Megazyme International Ireland Ltd, Wicklow, Ireland) in 100 mM sodium acetate buffer, pH 4.7) were mixed with 25 μl of supernatant and incubated at 28 °C for 3 h, with constant agitation in an orbital shaker. Dye release from AZC L-galactomannan was determined spectrophotometrically by measuring the absorbance at 590 nm in supernatant samples of the reaction mixture. One unit of MAN activity was defined as the amount of enzyme that releases 1 nmol of reducing sugar equivalent to D-mannose per minute under the above conditions. A curve relating dye release from AZC L-galactomannan to reducing sugar release from locust bean gum (Sigma Aldrich) as determined by the PAH–BAH method (Lever, 1972) was constructed and used for interconversion of mannanase activities.
Results
Germination characteristics in after-ripened seeds
Freshly harvested and mature dark S. officinale seeds hardly germinated. However, the germination rate (i.e. percentage of seeds that are likely to germinate) increased with the time of dry storage at 21±0.2 °C (Table 3), implying that AR was strongly involved in breaking dormancy of these endospermic seeds. On the other hand, the absence of nitrate strongly delayed the germination, and complete germination was reached after 73 h in after-ripened seeds, as opposed to only 5±1% without AR (Fig. 1). Likewise, AR in S. officinale seeds broadened the range of optimal germination temperatures. Hence, the highest germination percentage was reached between 20 °C and 30 °C in after-ripened seeds, and emergence of the radicle occurred far earlier than in the seed lot without AR, in which germination peaked at 30 °C (Fig. 2). The water uptake rate during imbibition, which was sigmoidal in S. officinale seeds, was also affected by AR. Non-after-ripened seeds imbibed hardly any more than did seeds after AR was fully established (Fig. 3). This varying imbibition pattern does not appear to be related to mucilage production by epidermal tissue of the seed coat, since both after-ripened and non after-ripened seeds showed the same secretion capacity (data not shown). Moreover, the water uptake rate was altered by the imbibition temperature, increasing with temperature (i.e. 20, 24, or 30 °C) in non-after-ripened seeds, but peaking at 24 °C in after-ripened seeds (Fig 3).
Table 3.
Effect of GA4+7 and ethephon on germination percentage of S. officinale seeds with (6 months) and without (freshly harvested seeds) after-ripening
Treatment
Germination (%)*
15 h
18 h
19 h
20 h
21 h
22 h
26 h
Control
Not after-ripened
0
0
0
0
0
2±1 a
8±1 b
After-ripened†
0
0
0
3±1 a
16±2 c
27±5 d
53±4 f
After-ripened
0
0
2±1 a
9±2 b
40±3 e
51±5 f
100±4 i
GA4+7
Not after-ripened
0
0
0
0
5±2 a
7± 2 a
14±3 b
After-ripened
4±2 a
10±3 b
15±2 c
25±4 d
64±3 g
92±7 h
100±2 i
PB
Not after-ripened
0
0
0
0
0
1±1 a
2±1 a
After-ripened
0
2±1 a
3±1 a
4±1 a
4±1 a
8±2 b
19±4 c
PB+GA4+7
Not after-ripened
0
0
0
0
2±1 a
6±1 a
12±1 b
After-ripened
1±1 a
8±1 b
16±2 c
23±3 d
60±5 g
91±4 h
100±2 i
ET
Not after-ripened
0
0
0
0
2±1 a
5±1 a
12±3 b
After-ripened
0
8±2 b
11±3 b
24±3 d
62±4 g
89±6 h
100±3 i
IESS
Not after-ripened
0
0
0
0
0
4±2 a
4±2 a
After-ripened
0
0
0
0
2±1 a
7±2 b
61±1 g
IESS+ET
Not after-ripened
0
0
0
0
0
4±1 a
10±2 b
After-ripened
0
5±1 a
10±2 b
21±1 c
59±2 g
85±3 h
100±1 i
IESS, inhibitors of ET synthesis and signalling; PB: paclobutrazol; 0, not found
Data are mean values of three replicates ±SE. Significant differences between values as assessed by LSD test (P < 0.05) are shown as different letters (Steel and Torre, 1982).
Dry seeds stored at 21±0.2 °C for 3 months.
Fig. 1.
Germination percentage at 24 °C of Sisymbrium officinale seeds in the absence of 20 mM KNO3. After-ripened seeds (filled squares); non-after-ripened seeds (open squares). Data are means ±SE of three independent experiments.
Fig. 2.
Germination percentage of Sisymbrium officinale seeds at different germination temperatures in the presence of 20 mM KNO3. Filled symbols, after-ripened seeds; open symbols, non-after-ripened seeds. Circles, 20 °C, squares, 24 °C; triangles, 30 °C. Data are means ±SE of three independent experiments.
Fig. 3.
Water uptake of Sisymbrium officinale seeds during the first 9 h of imbibition at different temperatures in the presence of 20 mM KNO3. (A) Non-after-ripened seeds. (B) After-ripened seeds. Black bars, 20 °C; grey bars, 24 °C; striped bars, 30 °C. Data are means ±SE of three independent experiments.
Effect of GA4+7 and ethephon on germination percentage of S. officinale seeds with (6 months) and without (freshly harvested seeds) after-ripeningIESS, inhibitors of ET synthesis and signalling; PB: paclobutrazol; 0, not foundData are mean values of three replicates ±SE. Significant differences between values as assessed by LSD test (P < 0.05) are shown as different letters (Steel and Torre, 1982).Dry seeds stored at 21±0.2 °C for 3 months.Germination percentage at 24 °C of Sisymbrium officinale seeds in the absence of 20 mM KNO3. After-ripened seeds (filled squares); non-after-ripened seeds (open squares). Data are means ±SE of three independent experiments.Germination percentage of Sisymbrium officinale seeds at different germination temperatures in the presence of 20 mM KNO3. Filled symbols, after-ripened seeds; open symbols, non-after-ripened seeds. Circles, 20 °C, squares, 24 °C; triangles, 30 °C. Data are means ±SE of three independent experiments.Water uptake of Sisymbrium officinale seeds during the first 9 h of imbibition at different temperatures in the presence of 20 mM KNO3. (A) Non-after-ripened seeds. (B) After-ripened seeds. Black bars, 20 °C; grey bars, 24 °C; striped bars, 30 °C. Data are means ±SE of three independent experiments.Prior to the investigation of the molecular effects of GAs and ET during imbibition of after-ripened seeds, a thorough study of the effect of both hormones on germination was performed by quantifying the radicle emergence over short time periods (Table 3). In control seeds (20 mM KNO3), radicle protrusion began to be detectable at 19 h, and reached 100% after 26 h. At this time point, only 8% of the non-after-ripened seeds germinated. The presence of GA4+7 advanced and strongly stimulated germination in the after-ripened seeds between 18 h and 22 h, whiles carcely affecting non-after-ripened seeds (Table 3). A similar profile was found in the presence of exogenous ethephon (Table 3) or the ET immediate precursor ACC (data not shown). Together, GA4+7 and ethephon were incapable of boosting the germination percentage with respect to individual hormones (data not shown). The addition of PB, a widely used inhibitor of GA synthesis, or a mixture of IESS (i.e. AVG+CoCl2+STS) strongly depressed radicle emergence in both after-ripened and non-after-ripened seeds (Table 3). In contrast, the inhibition provoked by PB and IESS was overcome by the addition of GA4+7 and ethephon, respectively (Table 3).
Alterations in SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6 expression in late embryogenesis and dry seed with and without AR
Prior to the study of the alterations of the transcripts provoked by AR during the imbibition of S. officinale seeds, the expression of SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6 was evaluated during embryogenesis. The objective of this experiment was to determine whether these genes were active during seed formation and whether the level of their transcripts was altered by AR in ripe seed. For this, whole seeds showing early development (early fruits, EF) and full development (late fruits, LF) were collected, as well as seeds in the desiccation phase (LS), seeds submitted to AR (after-ripened seeds, AS), and those which were not (non-after-ripened seeds, NAS).With the gene expression in AS as control, the following results were found. (i) The level of SoACO2 mRNA increased concomitantly with development and during seed desiccation; however, AR lowered the level of this transcript (Fig. 4A). (ii) The expression of SoACS7 was very abundant during embryogenesis, diminishing with the desiccation process and very strongly with AR (Fig. 4B). (iii) The SoGA3ox2 transcript level increased with development and strongly decreased with desiccation; AR induced a notable expression of this gene related to the synthesis of bioactive GAs (Fig. 4C). (iv) SoGA20ox2 expression was quantitatively very strong only in the early developmental phases, and AR hardly affected the level of this transcript (Fig. 4D). (v) The transcription of SoGA2ox6 increased with development and desiccation, negatively affecting AR at the level of SoGA2ox6 mRNA (Fig. 4E).
Fig. 4.
Transcript analysis by real-time PCR of SoACO2, SoACS7, SoGA3ox2, SoGA20ox2, and SoGA2ox6 (A–E) during the development of the fruit and seed of S. officinale. EF, early fruit; LF, late fruit; LS, late seed; NAS, non-after-ripened dry seed; AS, after-ripened dry seed. Error bars indicate the standard deviations of three independent experiments.
Transcript analysis by real-time PCR of SoACO2, SoACS7, SoGA3ox2, SoGA20ox2, and SoGA2ox6 (A–E) during the development of the fruit and seed of S. officinale. EF, early fruit; LF, late fruit; LS, late seed; NAS, non-after-ripened dry seed; AS, after-ripened dry seed. Error bars indicate the standard deviations of three independent experiments.
After-ripening alters SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6 expression patterns during early imbibition
In order to study the effect of AR on the expression of genes that are involved in ET synthesis and in GA synthesis and breakdown, homologues of ACS, ACO, GA20ox, GA3ox, and GA2ox were isolated. They were cloned by means of the primer strategy mentioned in Materials and methods. In total, five partial cDNAs (SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6) were isolated, and their phylogenetic relationships to the known genes are shown in Supplementary Figs S3–S7 at JXB online. The molecular mechanism operating during the imbibition phase of after-ripened seeds is at present largely unknown. The notable differences observed in the germination rate of after-ripened and non-after-ripened seeds in the presence of ethephon, GA4+7, or inhibitors (Table 3) led to the analysis of the effect of AR on alterations in the accumulation of five transcripts involved in the synthesis of ET (SoACS7 and SoACO2) and GAs (SoGA20ox2, SoGA3ox2, and SoGA2ox6) during the early imbibition period (0–15 h). In the control (20 mM KNO3), the following results were recorded. (i) The SoACS7 transcript was expressed only at the beginning of imbibition (3 h) in seeds that were not after-ripened, and the AR process eliminated this expression (Fig. 5A). (ii) The level of SoACO2 transcript was very high in non-after-ripened seeds at 3 h and strongly diminished up to 12 h, increasing afterwards; AR reduced transcript accumulation during the first 6 h of imbibition (Fig. 5C). (iii) SoGA20ox2 mRNA levels were almost similar at 3, 12, and 15 h, hardly being affected by the AR process; however, AR strongly increased the lowest transcript level found at 6 h (Fig. 6A). (iv) The transcript accumulation pattern found for the SoGA3ox2 gene (Fig. 6G) was similar to that of SoGA20ox2. (v) The expression of SoGA2ox6 was the lowest of all GA-oxidases studied in this work, notably at 6 h in non-after-ripened seeds; and the expression levels at 12 h and 15 h imbibition were slightly increased by AR (Fig. 6M).
Fig. 5.
Transcript analysis by real-time PCR of SoACS7 and SoACO2 during the time course of imbibition at 24 °C of S. officinale seeds. SoACS7: (A) control and (B) ethephon. Transcription in after-ripened seeds was not detected. SoACO2: (C) control; (D) ethephon; (E) GA4+7; (F) ethephon+GA4+7; (G) PB; (H) IESS. Non-after-ripened seed (black bars); after-ripened seed (grey bars). Error bars indicate the standard deviations of three independent experiments.
Fig. 6.
Transcript analysis by real-time PCR of SoGA20ox2, SoGA3ox2, and SoGA20x6 during the time course of imbibition at 24 °C of S. officinale seeds. SoGA20ox2: (A) control; (B) GA4+7; (C) PB; (D) ethephon; (E) IESS; (F) ethephon+GA4+7. SoGA3ox2: (G) control; (H) GA4+7; (I) PB; (J) ethephon; (K) IESS; (L) ethephon+GA4+7. SoGA2ox6: (M) control; (N) GA4+7; (O) PB; (P) ethephon; (Q) IESS; (R) ethephon+GA4+7. Non-after-ripened seed (black bars); after-ripened seed (grey bars). Error bars indicate the standard deviations of three independent experiments.
Transcript analysis by real-time PCR of SoACS7 and SoACO2 during the time course of imbibition at 24 °C of S. officinale seeds. SoACS7: (A) control and (B) ethephon. Transcription in after-ripened seeds was not detected. SoACO2: (C) control; (D) ethephon; (E) GA4+7; (F) ethephon+GA4+7; (G) PB; (H) IESS. Non-after-ripened seed (black bars); after-ripened seed (grey bars). Error bars indicate the standard deviations of three independent experiments.Transcript analysis by real-time PCR of SoGA20ox2, SoGA3ox2, and SoGA20x6 during the time course of imbibition at 24 °C of S. officinale seeds. SoGA20ox2: (A) control; (B) GA4+7; (C) PB; (D) ethephon; (E) IESS; (F) ethephon+GA4+7. SoGA3ox2: (G) control; (H) GA4+7; (I) PB; (J) ethephon; (K) IESS; (L) ethephon+GA4+7. SoGA2ox6: (M) control; (N) GA4+7; (O) PB; (P) ethephon; (Q) IESS; (R) ethephon+GA4+7. Non-after-ripened seed (black bars); after-ripened seed (grey bars). Error bars indicate the standard deviations of three independent experiments.The GA4+7 treatments, compared with the control, strongly reduced the expression of SoACO2 in non-after-ripened seeds, this expression being stimulated by AR (Fig. 5E). PB induced a SoACO2 expression pattern resembling that produced by GA4+7, but quantitatively higher (Fig. 5G), the stimulation of expression surpassing that of the control in after-ripened seeds (Fig. 5C, G). No SoACS7 transcription was detected in the presence of GA4+7 or PB in either seed lot. GA4+7 provoked a notable accumulation of SoGA20ox2 transcript in non-after-ripened seeds at 6 h and 15 h imbibition, and AR diminished this accumulation compared with the control and GAs treatments (Fig. 6A, B). The expression of SoGA20ox2 increased during imbibition in the presence of PB and, even though hardly any differences were found in after-ripened seeds, the AR process induced more SoGA20ox2 transcripts than in the control at 12 h and 15 h (Fig. 6A, C). At the beginning of imbibition, AR caused the absence of SoGA3ox2 expression in the presence of GA4+7 and PB (Fig. 6H, I). However, in the presence of GA4+7 and PB, the accumulation of SoGA2ox6 transcripts was strongly stimulated by AR (Fig. 6N, O).In the presence of ethephon-derived ET, the following results were obtained. (i) SoACS7 transcript accumulation was strongly inhibited, and, as in the control, no transcripts were detected in after-ripened seeds (Fig. 5B); on the other hand, no transcription was found in the presence of either IESS or ethephon+GA4+7. (ii) In non-after-ripened seeds, a significant decline with respect to control was found in the level of SoACO2 transcripts during the first 6 h of imbibition, then rising until the end of the imbibition, unlike those of the control. AR consistently induced lower transcript accumulation (Fig. 5D). The SoACO2 expression pattern in the presence of IESS was very similar to that in the presence of GA4+7 (Fig. 5H, E), whereas ethephon and GA4+7 added together registered the lowest SoACO2 transcript accumulation of all treatments studied (Fig. 5F). (iii) The SoGA20ox2 expression pattern was qualitatively similar to that of the control, but ethephon notably lowered the transcript level during the first 12 h of imbibition in after-ripened seeds (Fig. 6D). (iv) The presence of IESS strongly decreased the SoGA20ox2 transcript accumulation at the beginning of imbibition of non-after-ripened seeds, this treatment being the only one in which AR stimulated transcripts during imbibition (Fig. 6E). When ethephon and GA4+7 were added together, the SoGA20ox2 transcript levels were quantitatively lower than when both hormones were added separately (Fig. 6F). (v) Treatments with ethephon, IESS, and ethephon+GA4+7 strongly inhibited the SoGA3ox expression in after-ripened and non-after-ripened seeds (Fig. 6J–L). (vi) The SoGA3ox2 mRNA accumulation in the presence of ethephon was similar to that of seeds treated with PB (Fig. 6I, J), whereas this SoGA3ox2 transcript accumulation was similar in the presence of IESS and ethephon+GA4+7, showing strong inhibition, between 6 h and 15 h, compared with the ethephon treatment in after-ripened seeds (Fig. 6J–L). (vii) In the presence of ethephon, the accumulation of SoGA2ox6 transcripts was strongly stimulated by AR (Fig. 6P), this accumulation being strongly inhibited by IESS (Fig. 6Q), and the presence of ethephon+GA4+7 was not capable of overcoming this inhibition (Fig. 6R).
Alterations in β-mannanase activity induced by AR in the presence of ET and GA4+7
AR strongly altered MAN activity both in dry seeds and during imbibition. In control seeds, the main difference took place in dry seeds, where AR provoked the enzymatic activity ∼12-fold more than in non-after-ripened seeds, in which the MAN activity increased slightly as imbibition progressed (Fig. 7A). In addition, the AR notably boosted enzymatic activity during the first 3 h of imbibition, but clearly depressed it between 6 h and 12 h compared with the non-after-ripened seeds (Fig. 7A). In both seed lots, MAN activity was considerable prior to radicle emergence (Fig. 7A). The ethephon treatment substantially affected the MAN activity, so that, in non-after-ripened seeds, ethephon caused strong stimulation in the initial (0–3 h) and final imbibition phases (12–15 h). However, in after-ripened seeds, ethephon stimulated the enzymatic activity throughout the entire study period compared with the control (Fig. 7A) and the non-after-ripened seeds, as well as those treated with ethephon (Fig. 7D). The presence of IESS in after-ripened and non-after-ripened seeds sharply boosted MAN activity throughout the study period (Fig. 7E). The presence of GA4+7 in the non-after-ripened seeds resulted in a profile of MAN which was qualitatively and quantitatively similar to that of the control (Fig. 7A, B) but quantitatively far lower than in the presence of ethephon (Fig. 7B, D). However, the enzymatic stimulation by GA4+7 in after-ripened seeds was quantitatively lower than that found with ethephon (Fig. 7B, D). Finally, after the first 3 h of imbibition of after-ripened seeds, PB induced the greatest stimulation in the enzymatic activity of all the treatments studied, but hardly altered the activity in non-after-ripened seeds (Fig. 7C).
Fig. 7.
Analysis of endo-β-mannanase activity during the time course of imbibition at 24 °C of S. officinale seeds. (A) Control; (B) GA4+7; (C) PB; (D) ethephon; (E) IESS. Non-after-ripened seed (black bars); after-ripened seed (grey bars). Error bars indicate the standard deviations of three independent experiments.
Analysis of endo-β-mannanase activity during the time course of imbibition at 24 °C of S. officinale seeds. (A) Control; (B) GA4+7; (C) PB; (D) ethephon; (E) IESS. Non-after-ripened seed (black bars); after-ripened seed (grey bars). Error bars indicate the standard deviations of three independent experiments.
Discussion
AR affects germination and some related parameters
In this study, it is shown that the AR process affects the germination of S. officinale seeds in four ways. First, AR was incapable of replacing or preventing the presence of NO3– in the germination medium. The role of NO3– in the alleviation of dormancy by low temperatures (i.e. stratification) is strongly supported by previous results in Arabidopsis, suggesting a notable role for NO3– transported by the mother plant to the seed to promote germination through a complex signalling network in which the ABA and GA pathways may be involved (Ali-Rachedi ; Alboresi ). Recently, it was demonstrated in the Cvi accession that the seeds first become sensitive to NO3–, then to cold, and finally to light (Finch-Savage ). It was tentatively concluded that increased NO3– accumulation and reduction convey a signal to break dormancy rather than to function as a nitrogen source for nutrition (Finch-Savage ). However, little is known about the role of NO3– in dry AR at moderate temperatures. The presence of a signalling pathway for the NO3– in S. officinale seeds was initially suggested due to the possible presence of receptors and because the effect of the NO3– in promoting germination was independent of its reduction in the plant (Hilhorst and Karssen, 1989; Hilhorst, 1990). The results found in this study point to the idea that the NO3– signalling networks and AR engage in cross-talk, given the strongly positive effect of AR on the stimulation of radicle emergence in medium without NO3– compared with medium with NO3– (i.e. protrusion 50 h ahead, comparing Fig. 1 and Fig. 2). That is, it cannot be ruled out that NO3– affects a very early stage of the imbibition of after-ripened seeds, provoking greater effectiveness in the breaking of dormancy. In support of this hypothesis, it was previously demonstrated that NO3– positively altered other signalling pathways and levels of hormones involved in the germination of other species. Thus, in seeds of the Arabidopsis accession Ler, NO3– provoked a reduction in the light requirement (Batak ), and altered the ABA levels in seeds of Cvi during early imbibition (Ali-Rachedi ). Other nitrogenous molecules (e.g. nitric oxide and nitrite) stimulate germination in Arabidopsis (Bethke ). However, it is not known whether they do so per se or whether this happens because they are metabolic derivatives of NO3–. Secondly, in the presence of NO3–, AR in S. officinale broadened the optimal temperature range for germination (i.e. 24–30 C), accelerating the protrusion compared with non-ripened seeds. This widening of the temperature range compatible with good germination was also described in Avena sativa and Bromus tectorum after-ripened seeds [Corbineau ; Bair ; and updated by Leubner-Metzger (http://www.seedbiology.de)]. Dry AR may represent a natural mechanism for controlling dormancy release in dry climates (Probert, 2000) and it is widely accepted that the temperature is the greatest regulator of dormancy cycles in the soil (Probert, 2000; Baskin and Baskin, 2004).Thirdly, the AR in S. officinale induced a notable sensitivity to ET and GA4+7, both hormones strongly stimulating germination. The germination profiles in the presence of ET and GA4+7 are very similar. PB and IESS strongly inhibited the effect induced by ET and GA4+7. Although the intervention of the GAs in the avoidance of dormancy in endospermic seeds appears to be beyond any doubt, the role of ET is far from being known in detail. Briefly, ET seems to act in concert with GAs to promote germination; however, the participation of GAs appears to be quantitatively and qualitatively more important (reviewed in Matilla and Matilla-Vázquez, 2008, and references therein). Fourthly, AR quantitatively altered the initial seed water uptake rate, with 24 °C (used in this work) being the temperature at which the seed is most rapidly imbibed. However, although the entry of water is more rapid in after-ripened seeds, this imbibition must be tightly controlled in order to initiate the normal germination process. Currently, there are no scientific data to explain this difference in water uptake rate between after-ripened and non-after-ripened seeds. The secretion of mucilage by the seed coat during hydration could act as a mechanism to control the entry of water, affecting the seed viability and germination (Western ; Penfield ; Rautengarten ). The fruit of S. officinale contains mixospermous seeds that are heterogeneous with respect to the colour of their seed coat, and the dark seeds (used in this work) have: (i) a greater capacity to secrete mucilage; (ii) a slower and controlled water uptake rate; and (iii) a far faster protrusion of the radicle than in the other population (Iglesias-Fernández ). However, the AR process does not alter mucilage production (data not shown), apparently ruling out that this hygroscopic compound may function to enhance and control the water uptake during S. officinale seed imbibition.
AR alters the expression patterns of SoACS7, SoACO2, SoGA20ox2, SoGA3ox2, and SoGA2ox6 genes during the imbibition period
To gain knowledge at the molecular level concerning hormonal regulation of AR in S. officinale seeds, the expression patterns of genes involved in ET synthesis (i.e. SoACS and SoACO) and GA metabolism (i.e. SoGA3ox, SoGA20ox, and SoGA2ox) were studied. Previously, it was shown that the level of SoACO2, SoGA3ox2, and SoGA2ox6 transcripts rose during development. Notably, the content in the transcripts corresponding to SoACO2 and SoGA2ox6 increased with the seed desiccation process, decreasing SoACS7, SoGA20ox2, and SoGA3ox2. However, except for the expression of SoGA3ox2 which was markedly increased, and SoGA20ox2, AR triggered a major fall in the level of the rest of the transcripts studied, above all SoACS7, a gene strongly expressed during embryogenesis. Taking into account that the expression in after-ripened dry seeds was used to normalize data, the existence of transcription in dry S. officinale seeds is evident. Transcriptional activity in environments which are hardly hydrated, such as that in dry seeds, is under debate. However, the discovery of zones with high hydration in after-ripened tobacco seeds has led to strong expectations that this enigma can be deciphered (Leubner-Metzger, 2005; Manz ). The cDNA-AFLP analysis of Nicotiana plumbaginifolia (Bove ) and barley (Leymarie ) demonstrates that the great majority of the transcripts studied declined in abundance during AR. Global transcript analysis in Arabidopsis using microarrays also showed that the expression level of 30 genes, including DOG1, decreased during AR (Finch-Savage ). Although the dry seeds may contain stored mRNAs from the final phases of embryogenesis with a function far from being known, the present results also suggest that after-ripened and non-after-ripened dry seeds have the capacity for transcription. The confirmation of this capacity will be important in order to delve into the mechanism of AR in S. officinale.Although the alteration in the expression of various gene groups has been studied in Arabidopsis during the breaking of dormancy by stratification and AR (Yamaguchi ; Finch-Savage ; Holdsworth , and references therein), there are no detailed studies at the molecular level on the hormonal regulation of the mechanisms induced by the AR process at the onset of germination. It has been demonstrated here that in the very early phase of imbibition (i.e. the first 6 h), AR strongly inhibits the expression of SoACS7 and SoACO2, whereas it stimulates the expression of SoGA20ox2, SoGA3ox2, and SoGA2ox6. This indicates that the preparation for radicle protrusion during the imbibition phase under the AR process requires strong stimulation of GA synthesis and has less need for the stimulation of ET synthesis. That is, the need for and participation of GAs and ET appear to differ in after-ripened and non-after-ripened seeds in early imbibition. As occurs in Arabidopsis (De Grauwe ; Weiss and Ori, 2007), cross-talk clearly takes place between ET and GAs in S. officinale. Major germination-associated changes in the transcriptome of A. thaliana were evident within 6 h of the initiation of imbibition (Nakabayashi ; Holdsworth ). The expression of SoACO2 and SoACS7 is inhibited very rapidly by ethephon (i.e. the first 3 h). However, while SoACO2 expression increased during the progression of imbibition and was inhibited by the AR process, the expression of SoACS7 sharply diminished and was not detectable in after-ripened seeds. Petruzzelli et al. (2000) have reported that in pea seeds ET provokes a positive feedback that raises the Ps-ACO1 mRNA level; and Hermann have shown that the ACO transcript is accumulated in Beta vulgaris seeds upon imbibition. On comparing after-ripened and non-after-ripened seeds when SoACO2 expression was stimulated by ethephon, it was again concluded that the intensity of SoACO2 expression was lower in after-ripened seeds. The strong SoACO2 expression observed during the first 6 h in seeds not treated with ethephon was probably related to the production of ET involved in the protrusion. This assumption is supported by the fact that, in the presence of ethephon, SoACO2 expression was inhibited compared with seeds not treated with ethephon. The role of ET during the imbibition phase is not known and its role in the removal of dormancy is debated (Matilla and Matilla-Vázquez, 2008), but it has been demonstrated that both ET biosynthesis and sensitivity are important for seed germination of Arabidopsis (Beaudoin ; Ghassemian ; Kucera ). Thus, there are seeds in which ET is not required for dormancy maintenance or release, nor is it needed for germination to start (Matilla, 2000; Kucera ; Gianinetti ). The inhibition of SoACO2 expression in non-after-ripened seeds in the presence of GA4+7, PB, or ISSE, and notably with ET+GA4+7, as well as the clear effect of AR in reversing this inhibition, strongly indicated the presence of cross-talk between the two hormone signalling pathways. The existence of some cross-talk between ET and GAs to regulate FsACO1 gene expression during the breaking of dormancy in stratified Fagus silvatica seeds has previously been shown (Calvo ).Previous works have demonstrated that the synthesis and perception of GAs are essential for seed germination in Arabidopsis (Ogawa ). Central players are the GA3ox and GA2ox gene families involved in GA biosynthesis and breakdown, respectively (Yamaguchi ; Mitchum ). Thus, the GA3ox1 gene, but not the GA3ox2 gene, is induced by stratification during seed imbibition (Yamaguchi ; Mitchum ). In this study, it was demonstrated that the AR process provokes a strong expression of SoGA3ox2 and SoGA20ox2 genes at the onset of imbibition, SoGA3ox2 expression being fully inhibited by GA4+7, PB, ethephon+GA4+7, and ISSE. However, exogenous ethephon, which considerably lowers the level of SoGA3ox2 transcripts in non-after-ripened seeds, can slightly raise SoGA3ox2 expression in after-ripened seeds. This fact again leads to the assumption of the existence of cross-talk between ET and GAs during the transition from seed dormancy to germination induced by AR. On the other hand, the fact that exogenous GA4+7 strongly inhibits SoGA3ox2 expression during imbibition agrees with previous evidence indicating that bioactive GAs may control their own synthesis through a negative feedback regulation of the expression genes of GA biosynthesis (Olszewski ). However, this feedback regulation does not appear to be identical in after-ripened and non-after-ripened seeds, since the inhibition by exogenous GA4+7 of SoGA3ox2 expression compared with the control is not quantitatively similar in the two seed lots. In support of this hypothesis are the results of SoGA3ox2 expression in after-ripened and non-after-ripened seeds in the presence of the PB, which strongly alters its expression pattern.Taking into account the results of SoGA3ox2 and SoGA20ox2 expression and those of percentage germination, it is concluded that the requirement for ET and GAs for radicle emergence preparation involves, apart from the two hormone signalling pathways, the strict control of the level of ET and GAs in the appropriate tissue, and the regulation of SoGA20ox2 whose expression profiles are qualitatively and quantitatively different from those observed for SoGA3ox2. Thus, it is proposed that SoGA20ox2 expression and regulation must be of great importance during the imbibition of S. officinale seeds, since their expression is considerably higher than that of SoGA3ox2 in all the treatments studied, and does not appear to be as susceptible to AR, as has been demonstrated here for SoGA3ox2. It has been postulated that cross-talk between ET and GA signalling regulates FsGA20ox gene expression during the breaking of dormancy in stratified F. silvatica seeds (Calvo ). The results of SoGA20ox2 expression in the presence of ethephon, GA4+7, and ethephon+GA4+7 also appear to support ET–GA cross-talk. Taking together the results of SoGA3ox and SoGA20ox2 expression during imbibition, it is concluded that: (i) GA biosynthesis is indispensable to overcome hedge mustard seed dormancy; (ii) both genes are regulated by both ET and GAs to carry out the transition from dormancy to germination induced by AR; and (iii) AR strongly inhibits SoGA3ox2 expression in the presence of GA4+7, PB, and ethephon+GA4+7, indicating that this gene is subjected to a tight feedback regulation, possibly to prevent accumulation of GAs after the signal for AR has been decided.On the other hand, it is demonstrated here that, at the onset of imbibition of S. officinale seeds, SoGA2ox6 is expressed at basal levels, confirming the need for the synthesis of bioactive GAs in both the presence and absence of AR (i.e. high expression of SoGA3ox2 and SoGA20ox2). Moreover, it was also demonstrated that the AR process up-regulated SoGA2ox6 expression under all the treatments studied, as opposed to the down-regulation observed in non-after-ripened seeds. Due to the scant information on SoGA2ox6 physiology in seeds, the alterations found in SoGA2ox6 expression in S. officinale are very complex to explain and relate to the breaking of dormancy induced by the AR process. Nevertheless, it is worth emphasizing that although the AR does not appear to affect SoGA2ox6 expression in controls, the expression in after-ripened seeds tended to be greater than in non-after-ripened seeds, in the treatments studied. Previous results demonstrate that AtGA2ox6 is down-regulated by stratification in dark, imbibed Arabidopsis seeds (Yamaguchi ). Also, up- and down-regulation of different GA metabolism genes by ET in Arabidopsis seedlings have recently been demonstrated, this finding being related to ET–GA cross-talk (Vandenbussche ; Dugardeyn ). The present results, considered overall, suggest the hypothesis that the regulation of the synthesis of bioactive GAs involved in the AR process is subject to strong control. Consequently, if the threshold level of GAs necessary to prompt germination is surpassed because of any endogenous or exogenous agent, the seed responds with the destruction of the unnecessary bioactive GAs, and SoGA2ox6 would be involved in this destruction.
ET and GAs alter β-mannanase activity during imbibition of after-ripened seeds
In the seeds of a number of plant species, MAN activity shows a sharp surge during germination. However, the timing of the highest enzymatic activity depends on the species. The MAN activity increases in the micropylar endosperm prior to the completion of seed germination (Toorop ; Nonogaki ), or it increases afterwards (Bewley , and references therein; Marraccini ; Gong ). Controversy persists as to whether the rise in MAN activity in the endosperm during germination is sufficient to permit radicle emergence, and the consensus appears to be that, while this enzyme is required for endosperm weakening, it is not, by itself, sufficient to allow germination to be completed (Gong ). In contrast to the extensive investigation of MAN before and after the protrusion process, there is no information on the evolution of this cell wall-loosening enzyme in AR seeds. Here, it is shown for the first time that the specific activity of MAN is much higher in dry after-ripened seeds that in dry non-after-ripened seeds, and MAN activity remains high in after-ripened seeds over the first 3 h of imbibition, abruptly declining afterwards. The cause of this high enzymatic activity early on is unknown. However, while this manuscript was in preparation, Ren , using anti-MAN antibodies of tomato in rice seeds, reported that a MAN protein is present in an inactive form in dry rice grains. If these results are applicable to S. officinale, possibilities to explain the presence of MAN activity in dry seed can be proposed. (i) This protein forms part of a pool of proteins stored from zygotic embryogenesis. (ii) AR promotes MAN gene expression in dry seeds. Leubner-Metzger (2005) demonstrated a transient low level transcription and translation of the β-1,3-glucanase gene during tobacco seed AR, leading to the release of dormancy, whereas in Arabidopsis the expression profiling revealed that transcripts of a number of genes exhibited a transient accumulation within 6 h after imbibition (Nakabayashi ). Ren do not present data on the expression of OsMAN1, OsMAN2, OsMAN6, and OsMANP in the very early phases of rice seed imbibition. (iii) The enzymatic activity is high in dry seed and after 3 h of imbibition as a consequence of the fact that the enzyme is studied in vitro under optimal conditions that do not exist in vivo. (iv) If the present results reflect in vivo events, the AR may soften the tissue very early with unknown implications in the germination process; and (v) as an alternative to (iv), MAN may be involved in the production of sugars from the degradation process of the cell wall, these sugars serving to nourish the embryo. The MAN activity in lettuce endosperm is assumed to be associated with reserve mobilization closely following radicle emergence rather than with prior endosperm weakening (Wang ). It bears mentioning in relation to proposal (iv) that the MAN activity increased notably in after-ripemed S. officinale seeds immediately before radicle emergence (data not shown). On the other hand, MAN activity was significantly increased by ethephon treatment both at the onset of imbibition and in the period near radicle emergence. Nevertheless, IESS did not inhibit MAN activity in either after-ripened or non-after-ripened seeds, suggesting that ET is one of the factors contributing to, but not indispensable for, the regulation of MAN activity during imbibition. ET increases MAN activity in germinating thermotolerant lettuce seeds (Nascimento ), and the authors hypothesize that the endosperm weakening is a result of elevated enzymatic activity. However, this hypothesis does not agree with the findings of Wang who point out that some members of the MAN family may be ET responsive and may be associated with sugar reserve mobilization from the cell wall rather than with endosperm weakening prior to protrusion. It is noteworthy that exogenous GA4+7 increases MAN activity during imbibition of S. officinale after-ripened seeds, but not in non-after-ripened seeds. In contrast, the MAN activity is dramatically increased in the presence of the GA synthesis inhibitor PB, apparently indicating that a fall in the level of bioactive GAs triggers a rapid desynchronization in the seed, whereupon a non-specific enzymatic stimulation takes place without provoking radicle emergence due to the absence of GAs. A search at http://www.bioinformatics2.wsu.edu/cgi-bin/Athena/cgi/home.pl revealed ABA, GAs, and dehydration motifs/transcription factors in the promoters of the MAN of Arabidopsis. However, no motif for ET was found. Nevertheless, the expression of the LeMAN2 gene is up-regulated in Sl-ERF2-overexpressing seeds, suggesting that Sl-ERF2 (an ET response-factor gene) stimulates seed germination through the induction of LeMAN2 (Pirello ). Taken together, the data presented on MAN activity during early imbibition of S. officinale after-ripened seeds point to ET–GA cross-talk, as discussed for the expression of the genes studied.
Is ET–GA cross-talk required for AR?
The complexity of hormonal responses and their functional overlap support the presence of an intensive cross-talk between hormone signalling pathways (Brady and McCourt, 2003). Although the influence of ET on expression of GA response and synthesis genes provided evidence for the existence of an interaction between both hormones (De Grauwe , and references therein), it was not clear at which level this cross-talk appeared. DELLA proteins, which act as nuclear repressors of GA signalling, appear to be key integrators in the ET–GA cross-talk (Jiang and Fu, 2007; Steber, 2007, and references therein). The current tendency is to suggest that the ET–GA cross-talk is multiple, depending on the process and the state of development. Recent reviews have dealt extensively with these interactions (Kucera ; De Grauwe , 2008; Dugardeyn ; Holdsworth ). On the other hand, ET promotes dormancy breaking through interactions with ABA signalling. Seeds of etr1 and ein2/era3 mutants display increased dormancy correlated with increased sensitivity to ABA in seed germination. In contrast, the ctr1 mutation and treatment of A. thaliana wild-type seeds with ACC result in decreased sensitivity to ABA. Thus, ET stimulation of seed germination may occur via antagonism of ABA signalling (Filkenstein et al., 2008, and references therein). Having said all this, and taking into account the results presented here, it is proposed that the intervention of ET–GA cross-talk seems probable in the S. officinaleAR process. However, whether this intervention is direct or indirect is at present unclear. Obviously, any hormonal interaction results in an alteration of hormone levels (Chiwocha ). It is probable that the effect of ET on GA, and vice versa, might be indirect, possibly via ABA. The ET–ABA cross-talk is under study at present by our group.
Supplementary data
Supplementary data are available at JBX online.Transcription levels of a housekeeping gene (18S RNA), presented as CT mean values, during the development of the fruit and seed of S. officinale. EF, early fruit; LF, late fruit; LS, late seed; NAS, not after-ripened dry seed; AS,after-ripened dry seed. Error bars indicate the SDs of 10 independent experiments.. Transcription levels of a housekeeping gene (18S RNA), presented as CT mean values, during the time course of imbibition at 24 °C of S. officinale seeds. (A) Control; (B) GA4+7; (C) PB; (D) etephon; (E) IESS; (F) etephon+GA4+7. Non-after-ripened seed (open circles); after-ripened seed (filled circles). Error bars indicate the SDs of 10 independent experiments.Phylogenetic tree (cladogram) including SoACS7 and other plant ACS genes. Accession numbers are given in parentheses. The aLRT statistical test of branch support was used (numerical values in branch).Phylogenetic tree (cladogram) including SoACO2 and other plant ACO genes. Accession numbers are given in parentheses. The aLRT statistical test of branchsupport was used (numerical values in branch).Phylogenetic tree (cladogram) including SoGA20ox2 and other plant GA20ox genes. Accession numbers are given in parentheses. The aLRT statistical test of branch support was used (numerical values in branch).Phylogenetic tree (cladogram) including SoGA3ox2 and other plant GA3ox genes. Accession numbers are given in parentheses. The aLRT statistical test of branch support was used (numerical values in branch).Phylogenetic tree (cladogram) including SoGA2ox6 and other plant GA2ox genes. Accession numbers are given in parentheses. The aLRT statistical test of branch support was used (numerical values in branch).
Authors: W van Der Schaar; C Alonso-Blanco; K M Léon-Kloosterziel; R C Jansen; J W van Ooijen; M Koornneef Journal: Heredity (Edinb) Date: 1997-08 Impact factor: 3.821
Authors: William E Finch-Savage; Cassandra S C Cadman; Peter E Toorop; James R Lynn; Henk W M Hilhorst Journal: Plant J Date: 2007-04-25 Impact factor: 6.417
Authors: Alberto Gianinetti; Lucas J J Laarhoven; Stefan T Persijn; Frans J M Harren; Luciana Petruzzelli Journal: Ann Bot Date: 2007-03-08 Impact factor: 4.357
Authors: Liesbeth De Grauwe; Wim H Vriezen; Sophie Bertrand; Andy Phillips; Ana M Vidal; Peter Hedden; Dominique Van Der Straeten Journal: Planta Date: 2007-03-10 Impact factor: 4.540
Authors: Ada Linkies; Kerstin Müller; Karl Morris; Veronika Turecková; Meike Wenk; Cassandra S C Cadman; Françoise Corbineau; Miroslav Strnad; James R Lynn; William E Finch-Savage; Gerhard Leubner-Metzger Journal: Plant Cell Date: 2009-12-18 Impact factor: 11.277
Authors: Karl Morris; Ada Linkies; Kerstin Müller; Krystyna Oracz; Xiaofeng Wang; James R Lynn; Gerhard Leubner-Metzger; William E Finch-Savage Journal: Plant Physiol Date: 2011-02-14 Impact factor: 8.340