Literature DB >> 18976579

Paralysis case and contact spread of recombinant vaccine-derived poliovirus, Spain.

Ana Avellón, Maria Cabrerizo, Teresa de Miguel, Pilar Pérez-Breña, Antonio Tenorio, Jose Luis Pérez, Maria Victoria Martínez de Aragón, Gloria Trallero.   

Abstract

Entities:  

Mesh:

Substances:

Year:  2008        PMID: 18976579      PMCID: PMC2630745          DOI: 10.3201/eid1411.080517

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


× No keyword cloud information.
To the Editor: The World Health Organization Polio Eradication Initiative has reduced to 4 the number of countries with endemic transmission of wild polioviruses and has reported the widespread circulation of polioviruses that have evolved from attenuated vaccine (oral poliovirus vaccine [OPV]), so-called vaccine-derived polioviruses (VDPVs) (,). VDPVs can reportedly replicate in immunocompromised persons, in whom they produce paralysis, and can spread to contacts and produce paralytic polio in immunocompetent but incompletely immunized persons; these viruses can even cause some polio outbreaks in areas with a low level of vaccination coverage (). When VDPVs are detected, a careful follow-up of VDPV cases and contacts is essential if spread is to be avoided. Because point mutations or recombination events have been associated with reversion to neurovirulence transmission and thus a greater probability of outbreaks (), meticulous molecular studies of the detected strains are recommended. Spain progressively adopted vaccination with OPV for children in 2004. As a consequence, the incidence of vaccine-like poliovirus detection in recently vaccinated children, which was relatively common up to that time (51 isolates in 2003) (), began to decrease (15 isolates in 2004 and none in 2005 except the case described here). In July 2005, a 14-month-old boy from Morocco with residual paralysis and major histocompatibility class II immunodeficiency was reported through the Spanish Acute Flaccid Paralysis Surveillance System. The patient had received 2 OPV doses at birth and at 6 months of age in Morocco; 8 months later, meningoencephalitis developed. The case was immediately considered suspicious and was therefore monitored at least monthly until the boy died. Sampling was conducted, coinciding with his visits to the hospital to receive therapy with immunoglobulin (γ globulin 0.5 g/kg). His contacts were studied, environmental surveillance was conducted, and molecular analysis of all detected viruses was performed. Laboratory methods for virus detection and characterization, including 10 new reverse-transcription–PCRs designed to cover the entire genome, are detailed in the Table.
Table

Laboratory methods used for study of vaccine-derived poliovirus case, Spain, 2005*

procedureTestMethod†Sample
Sample preparation
Concentration of sewage for detection of enterovirus in the environmentConcentration with negative charge filters (Millipore, Billerica, MA, USA; 0.45 μm) of 20 L of local sewageE
RNA purification from samples (before molecular analysis)
MagAttract Virus Mini-Biorobot (QIAGEN GmbH, Hilden, Germany) from 200 μL of stool sample dissolved in water
S
Classic virology techniques
Cellular culture (Biosafety Level 3) for growing PVLB20 (transgenic mouse), RD (human rhabdomyosarcoma), HEF (human fibroblast), A-549 (ATCC-CCL185)S, E
Immunofluorescence of infected cellsLim-Beyesh-Melnick A-H and RIVM A-G poolsI
EV neutralization assay
Antibodies (Chemicon, Temecula, CA, USA)
I
Molecular techniquesMolecular EV detectionRT-nested PCR 5′ UTR (4)S, I, E
Molecular EV quantificationMutaReal EV real-time PCR kit (Immunodiagnostik AG, Bensheim, Germany)S
Molecular EV typingRT-nested PCR in major VP1 region (5)S, I, E
PV intratypic characterizationSpecific vaccine PV RT-PCR (6)S, I, E
PV genome sequencing fragment 11s: TAAAACAGCTCTGGGGTTGTA (2–22)
1as: CACCACCCAAGAAGCGGCC (1023–1041)
1ns: GCTCTGGGGTTGTACCCACTCC (9–30)
1nas:TAACTCTGGGCAATTCAACGA(1001–1021)S, I
PV genome sequencing fragment 2†2s: CATGCTAAACTCCCCAAAC (945–963)
2as: AGGTGCGCAACATGATGG (1882–1910)S, I
PV genome sequencing fragment 3†3s: CAGACAATTACCAGTCTCC (1814–1832)
3as: ATTACTAAAAATGCATTGGTTCCC (2518–2541)S, I
PV genome sequencing VP1 fragment†VP1s: ACAACACACATTAGTCAAGAGGCTA (2449–2473)
VP1as: GGATTTGGACACCAAAACAAAGC (3385–3407)S, I
PV genome sequencing fragment 4†4s:GTGCCCACGACCTCCA (3288–3303)
4as: CTTGGGTGCGACATCTCA (4042–4059)S, I
PV genome sequencing fragment 5†5s: TAATCAAAATTATCTCATCACTTGTG (3962–3987)
5as: CATGAGCGAGTACTCCAGA (4872–4889)S, I
PV genome sequencing fragment 6†6s: CTGGCCAGGAGATTCG (4834–4949)
6as: AAATGATGGAGTTTTGATCGT(5725–5747)S, I
PV genome sequencing fragment 7†7s: AGGCAGGAACTAATCTTGAAA (5630–5650)
7as: CTAAGTATGTAGGCAACAAGAT (6164–6185)S, I
PV genome sequencing fragment 8†8s: CAAAAATGATCCCAGGCTCA (6117–6136)
8as: AAACCTACAAGGGCATAGATT (6917–6937)S, I
PV genome sequencing fragment 9†9s: CAGGCACATCAATTTTTAACTC (6857–6878)
9as: GGTAAATTTTTCTTTAATTCGGGG(7416–7439)S, I
Additional PV sequencing primers447as: CCGGCCCCTGAATGCGGC (447–464)
4666s: CCAGACGGAGCAGACATG (4666–4683)S, I

*E, local sewage; S, stools; I, isolates; EV, enterovirus; PV, poliovirus; UTR, untranslated region; VP1, virus capsid protein.
†Sense (s) and antisense (as) primers: 5′ → 3' sequence (position according to X00595). n, nested. All reverse transcription–PCR (RT-PCR) systems had the same conditions: 5 μL of clinical samples (case) or isolates (contacts) were added to the reaction mixture (final volume 50 μL): AMV/Tfl 1X reaction buffer, 2 mmol/L MgSO4, 200 μM each dNTP, 1 μM each primer, 5 U of AMV RT, and 5 U of Tfl DNA polymerase (Access RT-PCR System, Promega, Madison, WI, USA). First RT step of 45 min at 48°C, 2 min at 94°C, 45 cycles of denaturation (94°C, 2 min), annealing (53°C, 1 min), and elongation (68°C,1 min 30 s).

*E, local sewage; S, stools; I, isolates; EV, enterovirus; PV, poliovirus; UTR, untranslated region; VP1, virus capsid protein.
†Sense (s) and antisense (as) primers: 5′ → 3' sequence (position according to X00595). n, nested. All reverse transcription–PCR (RT-PCR) systems had the same conditions: 5 μL of clinical samples (case) or isolates (contacts) were added to the reaction mixture (final volume 50 μL): AMV/Tfl 1X reaction buffer, 2 mmol/L MgSO4, 200 μM each dNTP, 1 μM each primer, 5 U of AMV RT, and 5 U of Tfl DNA polymerase (Access RT-PCR System, Promega, Madison, WI, USA). First RT step of 45 min at 48°C, 2 min at 94°C, 45 cycles of denaturation (94°C, 2 min), annealing (53°C, 1 min), and elongation (68°C,1 min 30 s). Serotype 2 VDPVs were detected in all 10 stool samples of the patient with residual paralysis for 6 months, until he died, and in 3 of the 7 family contacts analyzed (father and 2 brothers, 11 and 13 years of age, none with confirmed previous vaccination). One of the contacts, considered immunocompetent, shed virus for 216 days (5 fecal samples in which 5 complete genomes were obtained and 1 additional fecal sample in which virus capsid protein l [VP1] could be amplified); a stool sample collected on day 284 was negative. Technical problems delayed sewage sampling. When sewage from the area in which the patient and positive contacts lived was sampled on February 8, 2006, no polioviruses were detected; however, an echovirus 30 was detected. Poliovirus viral load fluctuated (106–109 copies/mL in the paralysis-affected person), decreasing after each immunoglobulin therapy dose (Figure 1 in the Technical Appendix). The corresponding level was <105 in the contacts. The highest value of viral load was recorded in the patient’s final sample, taken before he died. Homology of the VP1 gene with respect to the original vaccine PV2 fluctuated from 97.8% to 98.6% in the case samples but remained constant (98.4%) in the contact samples (Figure 1 in the Technical Appendix). All studied polioviruses featured the following nucleotide substitutions in the 5′ untranslated region: G309A, T344C, T355C, T398C, A481G, T500C, and T743C (Figure 2 in the Technical Appendix). Furthermore, the final sample from the patient had A476C, G505T, T588A, and A738C. Several nucleotide substitutions detected in VP1–4 were common to all samples (Figure 2 in the Technical Appendix); 5 resulted in amino acid changes, including T2909C (VP1 I143T) and G3277A (VP1 V266I). All samples contained 2 noncontiguous recombination fragments Sabin 2/Sabin 1 in the nonstructural genes, including the entire 3C gene and the 3′ half of the 3D-pol (Figure 2 in the Technical Appendix) as in other reports (–). Both fragments, when compared with C species enterovirus, were closely related to Sabin 1 (99.6% and 97.9%, respectively). Specific nucleotide and amino acid comparisons among the isolates are detailed in Figure 3 in the Technical Appendix. According to the proposed classification (), all the detected viruses were iVDPVs (isolated from immunocompromised patients) that spread only to close contacts because they were not detected in local sewage. If we assume that the greater the amount of viral excretion in feces that occurs, the higher number of replicating polioviruses (as well as the potential for greater genetic diversity), the patient had a more active infection (that responded to the therapy) than did the contacts. Fluctuation in homology to the parental OPV strain might be due not only to the calculation method (calculation was made on the basis of the majority-base call at each chromatogram position, and case sequences presented many mixed nucleotide positions) but also to immunotherapy. Treatment appeared to have decreased virus replication, probably by its action mainly on species with greater fitness and higher replication rates (those that were more similar to the original Sabin strain). As a consequence, treatment might produce a bottleneck that unmasked more divergent species. Both the case and contact strains had intertypic Sabin 1/Sabin 2 recombination in nonstructural genes and also shared most of the nucleotide and amino acid substitutions. However, pathologic changes occurred only in the patient whose immunologic mechanisms were affected and whose viral load was consequently much higher. A recent report () suggests that VDPVs can emerge in any country that uses OPV with insufficient vaccine coverage. In a polio-free IPV-user country, poliomyelitis can arise and spread to contacts who are not properly vaccinated. In the case we present here, the high level of vaccination coverage in Spain and the rapid control of close contacts achieved through the surveillance and control programs prevented virus spread. In the global pre-eradication phase, countries are recommended to change vaccination from OPV to IPV. However, IPV-adopting countries commonly share borders with OPV-adopting countries and residents may travel back and forth; thus, although the probability of VDPV circulation decreases, it does not reduce to zero. Therefore, active surveillance, rapid classification of isolates, and molecular characterization of the virus are essential.

Technical Appendix

Paralysis Case and Contact Spread of Recombinant Vaccine-derived Poliovirus, Spain
  10 in total

1.  Retrospective analysis of a local cessation of vaccination against poliomyelitis: a possible scenario for the future.

Authors:  Ekaterina A Korotkova; Renee Park; Elena A Cherkasova; Galina Y Lipskaya; Konstantin M Chumakov; Esfir V Feldman; Olen M Kew; Vadim I Agol
Journal:  J Virol       Date:  2003-12       Impact factor: 5.103

Review 2.  Vaccine-derived polioviruses and the endgame strategy for global polio eradication.

Authors:  Olen M Kew; Roland W Sutter; Esther M de Gourville; Walter R Dowdle; Mark A Pallansch
Journal:  Annu Rev Microbiol       Date:  2005       Impact factor: 15.500

3.  Evolution of a rare vaccine-derived multirecombinant poliovirus.

Authors:  Ioannis Karakasiliotis; Eleni Paximadi; Panayotis Markoulatos
Journal:  J Gen Virol       Date:  2005-11       Impact factor: 3.891

4.  Vaccine-derived polioviruses: is it time to stop using the word "rare"?

Authors:  Walter Dowdle; Olen Kew
Journal:  J Infect Dis       Date:  2006-07-26       Impact factor: 5.226

5.  Spread of vaccine-derived poliovirus from a paralytic case in an immunodeficient child: an insight into the natural evolution of oral polio vaccine.

Authors:  E A Cherkasova; M L Yakovenko; G V Rezapkin; E A Korotkova; O E Ivanova; T P Eremeeva; L I Krasnoproshina; N I Romanenkova; N R Rozaeva; L Sirota; V I Agol; K M Chumakov
Journal:  J Virol       Date:  2005-01       Impact factor: 5.103

6.  Detection and identification of vaccine-related polioviruses by the polymerase chain reaction.

Authors:  C F Yang; L De; B P Holloway; M A Pallansch; O M Kew
Journal:  Virus Res       Date:  1991-07       Impact factor: 3.303

7.  Detection of enteroviral RNA and specific DNA of herpesviruses by multiplex genome amplification.

Authors:  I Casas; A Tenorio; J M Echevarría; P E Klapper; G M Cleator
Journal:  J Virol Methods       Date:  1997-06       Impact factor: 2.014

8.  Molecular characterization of human enteroviruses in clinical samples: comparison between VP2, VP1, and RNA polymerase regions using RT nested PCR assays and direct sequencing of products.

Authors:  I Casas; G F Palacios; G Trallero; D Cisterna; M C Freire; A Tenorio
Journal:  J Med Virol       Date:  2001-09       Impact factor: 2.327

9.  [Laboratory Network within the Polio Eradication Initiative (1998-2003): six years of surveillance for acute flaccid paralysis in Spain].

Authors:  Gloria Trallero; Ana Avellón; Almudena Otero; Teresa de Miguel; Milagros Alonso; Pilar Pérez-Breña
Journal:  Enferm Infecc Microbiol Clin       Date:  2006-03       Impact factor: 1.731

10.  Vaccine-associated paralytic poliomyelitis in a patient with MHC class II deficiency.

Authors:  Nima Parvaneh; Shohreh Shahmahmoudi; Hamideh Tabatabai; Mohsen Zahraei; Taha Mousavi; Abdol-Reza Esteghamati; Mohammad M Gooya; Setareh Mamishi; Rakhshandeh Nategh; Olen M Kew
Journal:  J Clin Virol       Date:  2007-05-16       Impact factor: 3.168

  10 in total
  8 in total

1.  Sporadic isolation of sabin-like polioviruses and high-level detection of non-polio enteroviruses during sewage surveillance in seven Italian cities, after several years of inactivated poliovirus vaccination.

Authors:  A Battistone; G Buttinelli; S Fiore; C Amato; P Bonomo; A M Patti; A Vulcano; M Barbi; S Binda; L Pellegrinelli; M L Tanzi; P Affanni; P Castiglia; C Germinario; P Mercurio; A Cicala; M Triassi; F Pennino; L Fiore
Journal:  Appl Environ Microbiol       Date:  2014-08       Impact factor: 4.792

2.  A Cluster of Paralytic Poliomyelitis Cases Due to Transmission of Slightly Diverged Sabin 2 Vaccine Poliovirus.

Authors:  Ekaterina A Korotkova; Anatoly P Gmyl; Maria L Yakovenko; Olga E Ivanova; Tatyana P Eremeeva; Liubov I Kozlovskaya; Armen K Shakaryan; Galina Y Lipskaya; Irina L Parshina; Nataliya V Loginovskikh; Nadezhda S Morozova; Vadim I Agol
Journal:  J Virol       Date:  2016-06-10       Impact factor: 5.103

3.  Acute Flaccid Paralysis: The New, The Old, and The Preventable.

Authors:  N Macesic; V Hall; A Mahony; L Hueston; G Ng; R Macdonell; A Hughes; G Fitt; M L Grayson
Journal:  Open Forum Infect Dis       Date:  2015-12-09       Impact factor: 3.835

4.  Vaccine-Derived Polioviruses and Children with Primary Immunodeficiency, Iran, 1995-2014.

Authors:  Mohammadreza Shaghaghi; Shohreh Shahmahmoodi; Hassan Abolhassani; Saeed Soleyman-Jahi; Leila Parvaneh; Sussan Mahmoudi; Zahra Chavoshzadeh; Reza Yazdani; Seyed Mohsen Zahraei; Mohsen Ebrahimi; Mohammad H Eslamian; Hamideh Tabatabaie; Maryam Yousefi; Yaghoob M Kandelousi; Aliasghar Oujaghlou; Nima Rezaei; Asghar Aghamohammadi
Journal:  Emerg Infect Dis       Date:  2016-10       Impact factor: 6.883

5.  Are Circulating Type 2 Vaccine-derived Polioviruses (VDPVs) Genetically Distinguishable from Immunodeficiency-associated VDPVs?

Authors:  Kun Zhao; Jaume Jorba; Jing Shaw; Jane Iber; Qi Chen; Kelley Bullard; Olen M Kew; Cara C Burns
Journal:  Comput Struct Biotechnol J       Date:  2017-10-12       Impact factor: 7.271

6.  Case of Poliomyelitis Caused by Significantly Diverged Derivative of the Poliovirus Type 3 Vaccine Sabin Strain Circulating in the Orphanage.

Authors:  Ekaterina A Korotkova; Maria A Prostova; Anatoly P Gmyl; Liubov I Kozlovskaya; Tatiana P Eremeeva; Olga Y Baikova; Alexandr Y Krasota; Nadezhda S Morozova; Olga E Ivanova
Journal:  Viruses       Date:  2020-09-01       Impact factor: 5.048

7.  Evolution and circulation of type-2 vaccine-derived polioviruses in Nad Ali district of Southern Afghanistan during June 2009-February 2011.

Authors:  Salmaan Sharif; Bilal Haider Abbasi; Adnan Khurshid; Muhammad Masroor Alam; Shahzad Shaukat; Mehar Angez; Muhammad Suleman Rana; Syed Sohail Zahoor Zaidi
Journal:  PLoS One       Date:  2014-02-18       Impact factor: 3.240

8.  Acute flaccid paralysis (AFP) surveillance: challenges and opportunities from 18 years' experience, Spain, 1998 to 2015.

Authors:  Josefa Masa-Calles; Nuria Torner; Noemí López-Perea; María de Viarce Torres de Mier; Beatriz Fernández-Martínez; María Cabrerizo; Virtudes Gallardo-García; Carmen Malo; Mario Margolles; Margarita Portell; Natividad Abadía; Aniceto Blasco; Sara García-Hernández; Henar Marcos; Núria Rabella; Celia Marín; Amelia Fuentes; Isabel Losada; Juan García Gutiérrez; Alba Nieto; Visitación García Ortúzar; Manuel García Cenoz; José María Arteagoitia; Ángela Blanco Martínez; Ana Rivas; Daniel Castrillejo
Journal:  Euro Surveill       Date:  2018-11
  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.