Literature DB >> 18936773

Lack of MD-2 expression in human corneal epithelial cells is an underlying mechanism of lipopolysaccharide (LPS) unresponsiveness.

Jing Zhang1, Ashok Kumar, Michelle Wheater, Fu-Shin X Yu.   

Abstract

In the present study we tested the responsiveness of human corneal epithelial cells (HCECs) and corneal fibroblasts to lipopolysaccharide (LPS), a Toll-like receptor (TLR) 4 ligand. Purified Pseudomonas aeruginosa LPS was used to stimulate telomerase-immortalized HCECs (HUCL) and stromal fibroblast (THK) cell lines. Exposure of cells to LPS induced a time-dependent activation of NF-kappaB in THK but not in HUCL cells, as assessed by an increase in IkappaB-alpha phosphorylation and degradation. Concomitant with NF-kappaB activation, LPS-treated THK cells, but not HUCL cells, produced a significantly larger number of cytokines than control untreated cells. A cell surface biotinylation assay revealed that HUCL cells express TLR4 intracellularly, whereas TLR5 is expressed on the cell surface. Furthermore, reverse transcriptase-PCR analysis revealed that HUCL and primary HCECs, in contrast to THK cells, do not express myeloid differentiation (MD)-2. Thus, our results demonstrate that the LPS unresponsiveness of HCECs might be due to deficient expression of MD-2, an essential component for LPS-TLR4 signaling.

Entities:  

Mesh:

Substances:

Year:  2008        PMID: 18936773      PMCID: PMC2645480          DOI: 10.1038/icb.2008.75

Source DB:  PubMed          Journal:  Immunol Cell Biol        ISSN: 0818-9641            Impact factor:   5.126


Introduction

The Gram-negative bacterium P. aeruginosa is an opportunistic bacterial pathogen and a leading cause of bacterial keratitis with increased incidence among contact lens users with extended wearing. 1,2 If left untreated, infections could lead to perforation of the cornea resulting in permanent loss of vision and potential loss of the eye. 3,4 P. aeruginosa elaborates a multitude of factors including glycocalyx, lipopolysaccharide (LPS), endotoxin, and flagellin.5,6 These factors, notably LPS, may induce the release of multiple proinflammatory cytokines and chemokines from resident corneal cells and this initial inflammatory response plays a key role in containment of the infection. 6,7 LPS, a major component of the outer membrane of P. aeruginosa, is a virulence factor that can cause inflammatory responses in tissues, the consequences of which can be severe and even lethal.8 LPS activates monocytes and macrophages which produce several inflammatory cytokines including TNF-α, IL-1, IL-6, IL-8 and IL-12, leading to serious systemic disorders. 9,10 LPS also induces inflammatory responses in endothelial cells 11,12 and respiratory, gastric, and bladder epithelial cells.13–16 Other epithelium, such as intestinal epithelial 17,18 and well-differentiated human airway epithelial cells 19, are hyporesponsive to LPS. In contrast others have reported that intestinal epithelial cells recognize and respond to the internalized LPS.20,21 These studies also revealed that the inflammatory response induced by LPS in epithelial and other cell types is related to Toll-like receptor (TLR) 4. The major advancement in understanding the molecular mechanism of TLR4 in transducing LPS-mediated signals was the discovery of myeloid differentiation (MD)-2.22 MD-2 is a glycoprotein of approximately 17–25 kDa, co-expressed with TLR4 at the surface of various cell types, principally those of myeloid and endothelial lineages.23,24 Shimazu et al found that when MD-2 was co-transfected into HEK293 cells, it bound to TLR4 and greatly enhanced the response of TLR4-transfected cells to LPS.22 In another study, a forward genetic screen of CD14-transfected CHO cells revealed that MD-2 is essential for LPS responses and MD-2 can be supplied as a soluble receptor component to a TLR4-positive cell. 25 In addition, MD-2 has been suggested to play a role in the trafficking of TLR4 to the cell surface, at least in murine cells.26 Many mucosal epithelial cells such as those in the intestine 27 and in the airway19,28 have a limited response to LPS, and low or absent expression of MD-2 was suggested as the underlying mechanism for these cells. TLRs recognize repetitive patterns, thus they are termed pattern-recognizing receptors (PRRs). These patterns are present on diverse microbes including Gram-positive and Gram-negative bacteria and viruses and are key components of innate immunity. 29,30 An early study revealed that HCECs expressed TLR4 and its co-receptor CD14 and responded to LPS challenge to produce proinflammatory cytokines within 24 h. 31 Recently, Ueta et al reported that the incubation of human corneal epithelial cells with LPS did not lead to the activation of NF-κB or the secretion of inflammation-associated molecules such as IL-6, IL-8, and human beta-defensin-2. 32 However, the application of LPS to abraded corneal epithelium in vivo resulted in the secretion of proinflammatory cytokines that mediate recruitment of neutrophils to the corneal stroma, thus inducing stromal edema and structural changes in corneal architecture in a MyD88-dependent manner. 33 In contrast to the other TLRs, TLR4 is unique as its downstream signaling can occur via two independent pathways 34. The first pathway depends on the MyD88 signal adaptor protein which is critical for the production of several proinflammatory cytokines, e.g., IL-6 and TNF-α, and in the recognition of Gram-negative bacteria. 35–37 In contrast, the MyD88-independent pathway, which depends on the Toll IL-1 receptor (TIR) domain-containing adaptor-inducing IFN-β (TRIF) signal adaptor protein, is mainly involved in production of type I IFN. 38 To date, although corneal fibroblasts (keratocytes) have been implicated in playing a role in keratitis 4, the putative involvement of keratocytes in innate immune responses as part of corneal host defense has not been characterized. Thus, we hypothesize that in addition to epithelial cells, other resident corneal cells such as stromal keratocytes, might be involved in recognizing and formulating an innate response for the cornea to LPS challenge. We tested this hypothesis in-vitro, using primary and immortalized human corneal epithelial and stromal keratocyte cell lines, by assessing LPS- mediated signal transduction and the production of proinflammatory cytokines/chemokines.

Results

In epithelial cells, the transcription factor NF-κB plays a central role in regulating genes that govern the onset of mucosal inflammatory responses. The primary consequences of TLR activation is NF-κB activation and cytokine secretion in epithelial cells. To investigate LPS-triggered NF-κB activation, we first determined the dose response by treating HUCL cells with different concentration of LPS ranging from 1 ng to 10 µg/ml. We observed that LPS did not induce NF-κB as assessed by IκB-α phosphorylation in HUCL cells up to 10 µg/ml, whereas 1 µg/ml LPS significantly induced NF-κB activation in THK cells (data not shown). A time-course study (Figure 1) showed that LPS (1 µg/ml) in KBM had no apparent effect on the levels of phospho-IκB-α and IκB-α in HUCL cells for up to 8 h (Figure 1A). However, M9-conditioned medium derived from PAO1 culture (1:20 dilution) induced IκB-α phosphorylation and degradation in a time-dependent manner, suggesting that HCECs are responsive to PAO1 exoproducts (Figure 1A). In contrast, in THK cells LPS stimulated rapid IκB-α phosphorylation and IκB-α degradation that was maximal at 15 min post-stimulation (Figure 1B). Thus, LPS induced NF-κB activation in THK, but not in HUCL cells.
Figure 1

LPS stimulated IκB-α phosphorylation and degradation in THK, but not HUCL cells

HUCL (A) or THK (B) cells were stimulated with phenol-extracted LPS (1 µg/ml) for the indicated times. As a positive control, HUCL cells were also treated with 5% supplemented P. aeruginosa-conditioned medium (PA-CM) in KBM or KBM alone (Con). Total protein was extracted, and 20 µg of protein were subjected to SDS-PAGE followed by phospho-IκB-α (p-IκB-α) and IκB-α immunoblotting using a chemiluminescence technique. The results are representative of two independent experiments.

To assess the biological relevance of induced NF-κB activation, we measured the effect of LPS on proinflammatory cytokine expression and production (secretion) in HCECs and keratocytes. The effect of LPS on IL-8 mRNA expression was determined by RT-PCR. IL-8 mRNA was not detectable in untreated or 1 µg/ml LPS-challenged HUCL cells (Figure 2A). However, a PCR product of the expected size (347 bp) was observed in HUCL cells 30 min post-stimulation with P. aeruginosa conditioned medium; the band intensity increased, peaked at 2 h, and was still detectable at 6 h (Figure 2B). Similar to HUCL cells, IL-8 mRNA in unstimulated THK cells was barely detectable. However, incubation with LPS resulted in an increase in the expression of IL-8 mRNA in THK cells in a time-dependent manner.
Figure 2

LPS induced IL-8 mRNA expression in THK, but not HUCL cells

(A) HUCL were incubated with 1 µg/ml LPS for the indicated times; as a control, cells were also treated with 5% SMCM. (B) THK cells were treated with 1 µg/ml LPS for the indicated times. Total RNA was extracted, reverse transcripted, and amplified using IL-8 primers with GAPDH as control. PCR products were separated and stained as described in Materials and Methods. Results are representative of three independent experiments.

The effect of LPS on IL-6 and IL-8 secretion by HUCL cells was assessed by ELISA. Consistent with a lack of NF-κB activation, there was no induced accumulation of IL-6 and IL-8 in HUCL cells treated with either 100 ng/ml or 1 µg/ml LPS (Figure 3A). These cells however, responded to a challenge of 250 ng/ml flagellin that served as a positive control by producing significantly more IL-8 (5.8 fold) and IL-6 (2.6 fold) as compared to the control untreated cells (p<0.01). To examine whether CD14 or LPS binding protein (LBP) is responsible for the unresponsiveness of HUCL cells to LPS challenge, human serum that provides soluble CD14 and/or LBP 31,39 was added to the culture. No significant increase in IL-6 or IL-8 production was observed in LPS-challenged HUCL cells with or without human serum. THK cells, on the other hand, produced significantly more IL-6 and IL-8 in response to the LPS challenge even without the addition of serum. 100 ng/ml LPS was as effective as 1 µg/ml LPS in inducing the secretion of the cytokines (Figure 4). Taken together, LPS differentially stimulates resident corneal cells by inducing IL-6 and IL-8 production in THK, but not in HUCL cells.
Figure 3

LPS failed to induce IL-6 and IL-8 secretion in HUCL cells

(A) HUCL cells were stimulated with phenol-extracted LPS (1 µg/ml and 100 ng/ml) or medium alone (control) for 8 h; as a positive control, cells were also treated with 250 ng/ml purified flagellin for 8h. (B) HUCL cells were treated with 1 µg/ml phenol-extracted LPS with or without 0.1% human serum for 24 h. The effects of LPS and flagellin on IL-6 and -8 secretion were measured in cell culture supernatants by ELISA. Data are representative of triplicate experiments and are expressed as the mean ± SD. Statistically significant differences in secreted IL-6 and IL-8 in LPS-treated cells were determined by ANOVA with probabilities shown both for overall significance and pairwise comparison (*P<0.01).

Figure 4

LPS stimulated IL-6 and IL-8 secretion in THK cells

THK cells were treated with phenol-extracted LPS (1 µg/ml) for 8 h, and with medium alone at the same time point as control. The effects of LPS on IL-6 and -8 secretion were measured in THK culture supernatants by ELISA. Data are representative of triplicate experiments and are expressed as the mean ± SD. Statistically significant differences in secreted IL-6 and IL-8 in LPS-treated cells were determined by ANOVA with pair-wise comparison (*P<0.01).

Recently, Ueta et al reported the intracellular localization of TLR4 in HCECs. To confirm TLR4 localization in HCECs, HUCL cells were biotinylated with plasma membrane-impermeable NHS-LC-biotin, followed by avidin precipitation of biotinylated proteins and Western blotting with TLR antibodies. While HUCL cells expressed abundant TLR4, there was no surface biotinylated TLR4 detected. Under identical conditions, TLR5 was found to be labeled at the cell surface (Figure 5A).
Figure 5

Lack of TLR4 cell surface expression and MD-2 expression in HCECs

(A) HUCL monolayers were labeled with NHS-LC-biotin. Biotinlyated proteins were either directly analyzed by Western blotting (C) or precipitated from the cell lysate by streptavidin-conjugated agarose and analyzed using Western blotting (M) with TLR4- or TLR5-specific antibodies. The figure is representative of three independent experiments. (B) HUCL, THK and THP-1 cells were extracted and the obtained RNA was reverse transcripted and amplified using human MD2 primers with GAPDH as control. PCR products were separated and stained. Results are representative of three independent experiments.

To understand the underlying mechanism of the hyporesponsiveness of HCECs to LPS, we assessed the expression of TLR4 co-receptors known to be required for LPS-TLR interaction. While CD14 was expressed in both epithelial and stromal fibroblasts (data not shown), MD-2 was found to be abundantly expressed in THK cells as well as in THP-1 cells (a human monocytic leukemia cell line, sensitive to LPS), but not in HCECs, including both the HUCL cell line and primary HCECs (Figure 5B). Little or no RT-PCR amplicons of MD-2 were detected in either HUCL cells or primary HCECs.

Discussion

In this study, we showed that P. aeruginosa LPS stimulates the activation of the NF-κB signaling pathway and pro-inflammatory cytokine and chemokine production in human corneal stromal fibroblast cells, but fails to activate an inflammatory response in HCECs. We demonstrated that HCECs express abundant TLR4 intracellularly. However, there was no detectable increase in LPS-induced NF-κB activation or production of proinflammatory cytokines in these cells exposed to LPS for up to 24 h. This finding is consistent with that reported by Ueta et al. 32 We further demonstrated that the unresponsiveness of HCECs to LPS challenge is likely due to the lack of MD-2 expression in HCECs. Human corneal stromal fibroblast cells, on the other hand, expressed TLR4 and MD-2 and responded to LPS challenge by secreting proinflammatory cytokines. Thus, the cornea is able to recognize LPS once it has penetrated into the stroma, and mounts an innate immune response to the invading pathogens by producing proinflammatory cytokines that recruit PMN into the site of infection. Bacterial endotoxins (LPS) are among the most potent inducers of innate immune responses and are a major virulence factor of Gram-negative bacteria including P. aeruginosa. The structural analysis of LPS divides the molecule into a hydrophobic lipid A region, which replaces phospholipids in the outer membrane, a central core oligosaccharide region, and a repeating polysaccharide portion referred to as O antigen or O polysaccharide. 40 The O-antigen portion of the P. aeruginosa LPS is responsible for conferring serogroup specificity, which is defined by antibodies specific to the different variants of this antigen. Recent studies revealed that the inflammatory response to LPS in cells is mediated by its interaction with TLR4. 41,42 Molecular interaction studies showed that TLR4 is essential for the recognition of the lipid A portion of bacterial LPS,43 and mediates both effective host resistance to infection as well as some of the pathology associated with LPS-induced shock. 44 Therefore, it should be noted that the Pseudomonas LPS used in this study is unlikely to influence TLR4 signaling regardless of its serotype. A previous study by Pier et al showed that P. aeruginosa LPS induces less inflammation and lower overall host responses compared with that induced by enterobacterial (E. coli) LPS. 45 However, more recent studies showed a high degree of variability in the P. aeruginosa lipid A structure that can be synthesized depending on the strain and growth conditions, and have also shown that TLR4-mediated responses are highly dependent on the level of acylation of lipid A .46 A maximally sensitive response to LPS requires the sequential participation of several extracellular and cell-surface LPS-binding proteins, including LBP, CD14, MD-2, and TLR4. Briefly, LBP binds to Gram-negative bacteria or aggregates of LPS, thus decreasing the binding energy of LPS monomers. The LPS molecule is shuttled to CD14, which transfers the LPS to MD-2. The binding of lipid A to MD-2 causes the rearrangement of TLR4, leading to the association of its intracellular TIR domains and the recruitment of adapter proteins. Therefore, MD-2 plays a pivotal role in LPS sensing, bridging the recognition of endotoxins initiated by LBP and CD14 in response to the activation of TLR4 to pro-inflammatory cytokine and chemokine production. 18,41,42,47 The responsiveness of epithelial cells to LPS appears to be tissue-specific; respiratory, gastric and bladder epithelial cells have been shown to be activated by LPS, whereas intestinal and oral epithelial cells fail to recognize and respond to LPS. 18,48,49 The reason for endotoxin hyporesponsiveness of intestinal epithelial cells is low levels of TLR4 and/or MD-2.18 In the cornea, an early study showed that HCECs express TLR4 and CD14 and respond to LPS stimulation through the production of IL-6, IL-1α, IL-8 and TNF-α. 31 However, a recent study by Ueta et al revealed that HCECs are unresponsive to LPS challenge. 32 Our results are consistent with that reported by Ueta et al. 32 We also confirmed intracellular localization of TLR4 in HCECs. The intracellular expression of TLR4 was suggested to be an underlying mechanism for the immunosilent environment at the ocular mucosal epithelium. 32 Similarly, TLR4 was also found intracellularly in pulmonary and intestinal epithelial cells, but intracellular TLR4 in these cells is capable of recognizing internalized LPS. Since we showed that HCECs respond to flagellin through TLR5 50, which shares the MyD88-dependent signaling pathways with TLR430, the unresponsiveness of HCECs to TLR4 ligand is not due to defects in intracellular signal transduction, but more likely due to the lack of molecules required for proper LPS-TLR4 interaction. CD14 and MD-2 are critical co-receptors for TLR4 signaling.51 MD-2 and LPS form complexes that induce TLR4-expressing epithelial cells to secrete IL-6,, IL-8, andMD-2. Thus, the LPS-MD-2 complex plays a crucial role in the LPS response by activating epithelial cells in the inflammatory microenvironment. 19,52–54 Our results have shown that there was little or no MD-2 mRNA detected in HCECs, in both HUCL cell lines as well as in primary cultured cells. In line with our study, the low level of MD2 expression in intestinal epithelial cells was attributed to the hyporesponsiveness of these cells to LPS. 18 Although the role of MD2 in LPS internalization has not been reported, the lack of MD-2 expression may also be responsible for the failure of HCECs to internalize LPS in vitro and in vivo. 32,55 A more recent study also showed that human conjunctival epithelial cells are unresponsive to LPS due to the lack of MD2 expression 56. Thus, we conclude that the lack of MD-2 is a major factor which is responsible for the LPS signaling defect in HCECs, and for the tolerance of the cornea towards the constant exposure of bacteria and non-threatening amounts of bacterial endotoxins. While HCECs are unresponsive to LPS, the underlying stromal fibroblasts, keratocytes, are rapidly activated by LPS. Unlike epithelia, stromal cells are not constantly exposed to bacteria or their products. When tissues such as the cornea are exposed to bacteria, the barrier function of epithelium would prevent bacteria from direct interaction with TLRs which are usually located in the inner cell layers of stratified epithelium 50 or on the basolateral side of simple epithelium57. Because of the barrier function and the unique localization of TLRs, the released endotoxin may also exhibit minimal effects on epithelial cells. However, once the barrier is breached and bacteria invade the epithelial layer, the pattern recognizing receptors, such as TLR5 58,59, recognize the pathogens in the epithelial layer and initiate corneal innate immune responses by producing antimicrobial molecules such as hBD2 60,61 and recruiting neutrophils via IL-8. Many pathogens may be eliminated upon initial contact by this mechanism 62. However, this initial defense may be overwhelmed by the pathogens, leading to the penetration of bacteria or released endotoxin into the stromal layer 55. In other mucosal epithelial cells (urinary, intestinal, and pulmonary), flagellin and TLR5 is the major responsive unit, not LPS-TLR4. We believe that the unresponsiveness of epithelial cells is a way to avoid unwanted inflammation as these epithelial linings, unlike immune cells, are constantly exposed to LPS, though not to flagellin. This exception occurs because flagellin is a protein which is usually not detected in the fluids that cover the epithelial lining in the body. The presence of bacterial products such as flagellin and/or LPS in the stroma should act as a sign of stromal infection and a rapid response on the part of the resident cells is necessary for clearing the pathogens. The expression of functional TLR4, including its coreceptors CD14 and MD-2, and TLR5 (Yu et al, unpublished result) in keratocytes should allow the cells to rapidly recognize infection, and the release of proinflammatory cytokines and chemokines that recruit more neutrophils and monocytes to the infected stroma. It is interesting to note that corneal stromal fibroblasts stimulated with LPS secrete higher levels of cytokines than flagellin-stimulated HCECs when normalized with cellular proteins: over 2 times more IL-6 and approximately 15 times more IL-8 is secreted by THK cells. IL-8 is the major chemoattractant in the cornea for PMN infiltration. 63,64. Thus, the increased level of IL-8 released from keratocytes may attract a large number of PMN to the stroma that clear the pathogen and may also cause severe local inflammation, leading to the development of keratitis. In summary, the data presented in this study demonstrate thatHCECs failed to respond to LPS. The unresponsiveness of HCECs is likely due to the lack of MD-2 expression, which is an important component of LPS-TLR4 signaling. Since the cornea is constantly exposed to environmental stimuli including LPS, these findings suggest that the human corneal epithelium possesses a regulatory mechanism, similar to that observed in intestinal epithelial cells, for the inhibition of TLR4-mediated innate immunity. However, the breakdown of the epithelial barrier during infection or trauma leads to a direct interaction of bacterial products with submucosal cells, i.e stromal keratocytes. Therefore these cells participate in innate immune responses by sensing and responding to bacterial products, such as LPS, that have penetrated into the subepithelial compartment of the cornea. Thus, targeting TLR4-mediated signaling pathways in keratocytes may permit the development of novel, specific therapies that could promote innate defense and prevent some of the destructive consequences of ocular Gram-negative bacterial infections.

Materials and Methods

Purification and preparation of P. aeruginosa LPS and conditioned medium

Commercially available LPS derived from P. aeruginosa (Catalog no. L9143, Sigma-Aldrich, St. Louis, MO) was resuspended in 1 ml of endotoxin-free water containing 0.2% triethylamine (TEA) and extracted with water-saturated phenol as previously described 65. Purified LPS was re-suspended in keratinocyte basic medium (KBM, Biowittaker Inc., Walkersville, MD). One hundred percent recovery was assumed. This was referred to as “phenol re-extracted LPS”. P. aeruginosa (PAO1 strain) was cultured in supplemented M9 medium for 72 h and the culture media was centrifuged to remove bacteria and sterilized by filtration through a 0.2 µm filter.66 The conditioned media was stored at 4°C and used at 5% concentration (i.e 5 % of saturated P. aeruginosa growth medium and 95% PBS). The flagellin of P. aeruginosa was purified as previously described 50.

Cell culture and stimulation

Human telomerase-immortalized corneal epithelial (HUCL) cells,67 kindly provided by Dr. Rheinwald and Dr. Gipson, were cultured in defined keratinocyte-SFM (Invitogen Life Technologies, Carlsbad, CA) at 37°C in a humidified incubator with 95% room air, 5%CO2. HUCL cells were cultured in KBM overnight before experimentation (growth factor starvation). Human corneal stromal fibroblast cells (THK) were provided by Dr. James Jester 68 and were cultured in DMEM/F12 medium (Invitrogen-Life Technologies, Carlsbad, CA) with 10% fetal bovine serum (Mediatech Inc., Herndon, VA) at 37°C in a humidified incubator with 95% room air, 5%CO2. Before treatment, THK cells were washed with PBS two times and cultured in serum-free DMEM/F12 medium overnight for serum starvation. Both epithelial and stromal fibroblasts were treated with phenol re-extracted LPS in KBM or serum-free DMEM/F12 media for various times and then processed for Western blotting and cytokine measurement. Primary HCECs were isolated from human donor corneas obtained from the Michigan Eye Bank. The epithelial sheet was separated from underlying stroma after overnight dispase treatment at 4°C. The dissected epithelial sheet was trypsinized, and cells were then collected by centrifugation. Primary HCECs were grown in defined keratinocyte SFM in a humidified 5% CO2 incubator at 37°C and then used at passage 3.

RT-PCR

RNA was isolated with extraction reagent (TRIzol; Invitrogen), and 2 µg of the total RNA was reverse-transcribed for cDNA synthesis using MLV-RT (SuperScript; Invitrogen). cDNA was amplified by PCR with specific primers for human IL-6 (sense: CTCCTTCTCCACAAGCGCCTTC, anti-sense: GCGCAGAATGAGATGAGTTGTC, product: 583bp), IL-8 (sense: GCAGTTTTGCCAAGGAGTGCT, anti-sense: GCATCTGGCAACCCTACAACA, product: 347bp), MD-2 (sense: TATTGGGTCTGCAACTCAT and anti-sense: CTCCCAGAAATAGCTTCAAC, product: 358 bp) and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sense: CACCACCAACTGCTTAGCAC and antisense CCCTGTTGCTGTAGCCAAAT, product: 515 bp). IL-6, IL-8 and MD-2 were amplified at 26, 32 and 28 cycles, respectively, with annealing temperature 58°C (45 sec) and extension temperature 72°C (1 min). GAPDH was amplified 20 cycles under the same conditions. The PCR products (5 µL) were subjected to electrophoresis on 2% agarose gels containing ethidium bromide. Staining was captured by digital camera (Gel logic 100 system; Eastman Kodak, Rochester, NY).

Cytokine ELISA

IL-6 and IL-8 secretion was determined by ELISA. HUCL cells or THK cells were plated at 4 × 105cells/well in 12-well plates. After growth factor/serum starvation, cells were treated with 100 ng/ml or 1µg/ml phenol re-extracted LPS for the indicated time; the supernatants were harvested for the measurement of IL-6 and IL-8 using ELISA which was performed according to the manufacturer's instructions (R& D Systems, Minneapolis, MN). The amount of IL-6 and IL-8 in culture media was normalized with the total amount of cellular protein lysed with RIPA buffer (150 mM NaCl, 100 mM Tris-HCl, pH 7.5, 1% deoxycholate, 0.1% SDS, 1% Triton X-100, 50 mM NaF, 100 mM sodium pyrophosphate, 3.5 mM sodium orthovanadate, proteinase inhibitor cocktails, and 0.1 mM PMSF). The protein concentration of cell lysate was determined with a Micro BCA kit (Pierce Biotechnology, Rockford. IL). Results were expressed as the mean pg of cytokine per mg cell lysate ± SE (n=3); P values were determined via ANOVA.

Western blot Analysis

LPS-treated HUCL and THK cells were lysed with RIPA buffer and protein concentration was determined with the Micro BCA kit (Pierce). IκB-α phosphorylation and degradation were detected with rabbit anti-IκB-α and anti-phospho-IκB-α which were purchased from Cell Signaling Technology (Beverly, MA) and developed with Supersignal reagents from Pierce.

Cell Surface Biotinylation

Cells grown in 100 mm dishes were rinsed 6 times with HBSS (Mediatech, Inc., Herndon, VA), supplemented with 0.1 mM CaCl2 and 1 mM MgCl2, and then incubated with freshly-prepared NHS-LC-Biotin (Pierce) diluted in the same solution (1mg/ml) for 5 minutes at room temperature. The reaction was quenched with 50 mM NH4Cl, and cells were washed with PBS and lysed with a solution containing 1% Triton X-100, 20 mM Tris (pH 8.0), 50 mM NaCl, 5 mM EDTA, and 0.2% BSA supplemented with protease inhibitors. Cell extract supernatant was incubated with immobilized streptavidin agarose (Pierce) for 16 hours at 4°C to bind biotinylated proteins. Proteins bound to the agarose slurry were solubilized with Laemmli buffer and analyzed by SDS-PAGE and Western blotting with purified rabbit antibodies against TLR4 and TLR5 from Santa Cruz Biotechnology (Santa Cruz, CA).
  68 in total

Review 1.  Toll-like receptor signalling.

Authors:  Shizuo Akira; Kiyoshi Takeda
Journal:  Nat Rev Immunol       Date:  2004-07       Impact factor: 53.106

2.  Intracellularly expressed TLR2s and TLR4s contribution to an immunosilent environment at the ocular mucosal epithelium.

Authors:  Mayumi Ueta; Tomonori Nochi; Myoung-Ho Jang; Eun Jeong Park; Osamu Igarashi; Ayako Hino; Satoshi Kawasaki; Takashi Shikina; Takachika Hiroi; Shigeru Kinoshita; Hiroshi Kiyono
Journal:  J Immunol       Date:  2004-09-01       Impact factor: 5.422

3.  Role of EGFR transactivation in preventing apoptosis in Pseudomonas aeruginosa-infected human corneal epithelial cells.

Authors:  Jing Zhang; Hui Li; Jinzhao Wang; Zheng Dong; Shahzad Mian; Fu-Shin X Yu
Journal:  Invest Ophthalmol Vis Sci       Date:  2004-08       Impact factor: 4.799

4.  A20 inhibits toll-like receptor 2- and 4-mediated interleukin-8 synthesis in airway epithelial cells.

Authors:  Yasuhiro Gon; Yasukiyo Asai; Shu Hashimoto; Kenji Mizumura; Itsuro Jibiki; Tatsuya Machino; Chisei Ra; Takashi Horie
Journal:  Am J Respir Cell Mol Biol       Date:  2004-05-13       Impact factor: 6.914

5.  Innate immune response of corneal epithelial cells to Staphylococcus aureus infection: role of peptidoglycan in stimulating proinflammatory cytokine secretion.

Authors:  Ashok Kumar; Jing Zhang; Fu-Shin X Yu
Journal:  Invest Ophthalmol Vis Sci       Date:  2004-10       Impact factor: 4.799

6.  Modulation of corneal epithelial innate immune response to pseudomonas infection by flagellin pretreatment.

Authors:  Ashok Kumar; Jia Yin; Jing Zhang; Fu-Shin X Yu
Journal:  Invest Ophthalmol Vis Sci       Date:  2007-10       Impact factor: 4.799

7.  MD-2 controls bacterial lipopolysaccharide hyporesponsiveness in human intestinal epithelial cells.

Authors:  Christelle Lenoir; Catherine Sapin; Alexis H Broquet; Anne-Marie Jouniaux; Sabine Bardin; Isabelle Gasnereau; Ginette Thomas; Philippe Seksik; Germain Trugnan; Joëlle Masliah; Maria Bachelet
Journal:  Life Sci       Date:  2007-12-17       Impact factor: 5.037

8.  Endotoxin responsiveness of human airway epithelia is limited by low expression of MD-2.

Authors:  Hong Peng Jia; Joel N Kline; Andrea Penisten; Michael A Apicella; Theresa L Gioannini; Jerrold Weiss; Paul B McCray
Journal:  Am J Physiol Lung Cell Mol Physiol       Date:  2004-04-30       Impact factor: 5.464

9.  Dual signaling of MyD88 and TRIF is critical for maximal TLR4-induced dendritic cell maturation.

Authors:  Hua Shen; Bethany M Tesar; Wendy E Walker; Daniel R Goldstein
Journal:  J Immunol       Date:  2008-08-01       Impact factor: 5.422

10.  Flagellin suppresses the inflammatory response and enhances bacterial clearance in a murine model of Pseudomonas aeruginosa keratitis.

Authors:  Ashok Kumar; Linda D Hazlett; Fu-Shin X Yu
Journal:  Infect Immun       Date:  2007-10-15       Impact factor: 3.441

View more
  21 in total

Review 1.  Toll-like receptors in ocular surface disease.

Authors:  Rachel L Redfern; Alison M McDermott
Journal:  Exp Eye Res       Date:  2010-03-24       Impact factor: 3.467

2.  Radioiodination of an endotoxin·MD-2 complex generates a novel sensitive, high-affinity ligand for TLR4.

Authors:  Athmane Teghanemt; Jerrold P Weiss; Theresa L Gioannini
Journal:  Innate Immun       Date:  2013-02-25       Impact factor: 2.680

3.  Interferon-gamma-induced MD-2 protein expression and lipopolysaccharide (LPS) responsiveness in corneal epithelial cells is mediated by Janus tyrosine kinase-2 activation and direct binding of STAT1 protein to the MD-2 promoter.

Authors:  Sanhita Roy; Yan Sun; Eric Pearlman
Journal:  J Biol Chem       Date:  2011-05-13       Impact factor: 5.157

4.  Inhibition of Corneal Inflammation by the Resolvin E1.

Authors:  Ji-Eun Lee; Yan Sun; Per Gjorstrup; Eric Pearlman
Journal:  Invest Ophthalmol Vis Sci       Date:  2015-04       Impact factor: 4.799

5.  The role of toll-like receptor 4 in corneal epithelial wound healing.

Authors:  Medi Eslani; Asadolah Movahedan; Neda Afsharkhamseh; Herve Sroussi; Ali R Djalilian
Journal:  Invest Ophthalmol Vis Sci       Date:  2014-09-02       Impact factor: 4.799

6.  Exogenous MD-2 confers lipopolysaccharide responsiveness to human corneal epithelial cells with intracellular expression of TLR4 and CD14.

Authors:  Li-Li Lang; Lin Wang; Lin Liu
Journal:  Inflammation       Date:  2011-10       Impact factor: 4.092

7.  Expression of toll-like receptor 4 contributes to corneal inflammation in experimental dry eye disease.

Authors:  Hyun Soo Lee; Takaaki Hattori; Eun Young Park; William Stevenson; Sunil K Chauhan; Reza Dana
Journal:  Invest Ophthalmol Vis Sci       Date:  2012-08-17       Impact factor: 4.799

8.  Flagellin-induced corneal antimicrobial peptide production and wound repair involve a novel NF-kappaB-independent and EGFR-dependent pathway.

Authors:  Nan Gao; Ashok Kumar; Jeevan Jyot; Fu-Shin Yu
Journal:  PLoS One       Date:  2010-02-26       Impact factor: 3.240

Review 9.  Host defense at the ocular surface.

Authors:  Eric Pearlman; Yan Sun; Sanhita Roy; Mausita Karmakar; Amy G Hise; Loretta Szczotka-Flynn; Mahmoud Ghannoum; Holly R Chinnery; Paul G McMenamin; Arne Rietsch
Journal:  Int Rev Immunol       Date:  2013-02       Impact factor: 5.311

Review 10.  When Clarity Is Crucial: Regulating Ocular Surface Immunity.

Authors:  William Foulsham; Giulia Coco; Afsaneh Amouzegar; Sunil K Chauhan; Reza Dana
Journal:  Trends Immunol       Date:  2017-12-14       Impact factor: 16.687

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.