Elena K Khlestkina1, Marion S Röder, Elena A Salina. 1. Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Lavrentjeva ave. 10, Novosibirsk, 630090, Russia. khlest@bionet.nsc.ru
Abstract
BACKGROUND: The patterns of expression of homoeologous genes in hexaploid bread wheat have been intensively studied in recent years, but the interaction between structural genes and their homoeologous regulatory genes remained unclear. The question was as to whether, in an allopolyploid, this interaction is genome-specific, or whether regulation cuts across genomes. The aim of the present study was cloning, sequence analysis, mapping and expression analysis of F3H (flavanone 3-hydroxylase - one of the key enzymes in the plant flavonoid biosynthesis pathway) homoeologues in bread wheat and study of the interaction between F3H and their regulatory genes homoeologues - Rc (red coleoptiles). RESULTS: PCR-based cloning of F3H sequences from hexaploid bread wheat (Triticum aestivum L.), a wild tetraploid wheat (T. timopheevii) and their putative diploid progenitors was employed to localize, physically map and analyse the expression of four distinct bread wheat F3H copies. Three of these form a homoeologous set, mapping to the chromosomes of homoeologous group 2; they are highly similar to one another at the structural and functional levels. However, the fourth copy is less homologous, and was not expressed in anthocyanin pigmented coleoptiles. The presence of dominant alleles at the Rc-1 homoeologous loci, which are responsible for anthocyanin pigmentation in the coleoptile, was correlated with F3H expression in pigmented coleoptiles. Each dominant Rc-1 allele affected the expression of the three F3H homoeologues equally, but the level of F3H expression was dependent on the identity of the dominant Rc-1 allele present. Thus, the homoeologous Rc-1 genes contribute more to functional divergence than do the structural F3H genes. CONCLUSION: The lack of any genome-specific relationship between F3H-1 and Rc-1 implies an integrative evolutionary process among the three diploid genomes, following the formation of hexaploid wheat. Regulatory genes probably contribute more to the functional divergence between the wheat genomes than do the structural genes themselves. This is in line with the growing consensus which suggests that although heritable morphological traits are determined by the expression of structural genes, it is the regulatory genes which are the prime determinants of allelic identity.
BACKGROUND: The patterns of expression of homoeologous genes in hexaploid bread wheat have been intensively studied in recent years, but the interaction between structural genes and their homoeologous regulatory genes remained unclear. The question was as to whether, in an allopolyploid, this interaction is genome-specific, or whether regulation cuts across genomes. The aim of the present study was cloning, sequence analysis, mapping and expression analysis of F3H (flavanone 3-hydroxylase - one of the key enzymes in the plant flavonoid biosynthesis pathway) homoeologues in bread wheat and study of the interaction between F3H and their regulatory genes homoeologues - Rc (red coleoptiles). RESULTS: PCR-based cloning of F3H sequences from hexaploid bread wheat (Triticum aestivum L.), a wild tetraploid wheat (T. timopheevii) and their putative diploid progenitors was employed to localize, physically map and analyse the expression of four distinct bread wheatF3H copies. Three of these form a homoeologous set, mapping to the chromosomes of homoeologous group 2; they are highly similar to one another at the structural and functional levels. However, the fourth copy is less homologous, and was not expressed in anthocyanin pigmented coleoptiles. The presence of dominant alleles at the Rc-1 homoeologous loci, which are responsible for anthocyanin pigmentation in the coleoptile, was correlated with F3H expression in pigmented coleoptiles. Each dominant Rc-1 allele affected the expression of the three F3H homoeologues equally, but the level of F3H expression was dependent on the identity of the dominant Rc-1 allele present. Thus, the homoeologous Rc-1 genes contribute more to functional divergence than do the structural F3H genes. CONCLUSION: The lack of any genome-specific relationship between F3H-1 and Rc-1 implies an integrative evolutionary process among the three diploid genomes, following the formation of hexaploid wheat. Regulatory genes probably contribute more to the functional divergence between the wheat genomes than do the structural genes themselves. This is in line with the growing consensus which suggests that although heritable morphological traits are determined by the expression of structural genes, it is the regulatory genes which are the prime determinants of allelic identity.
The flavonoid biosynthesis pathway is central to the formation of the phenolic compounds involved in many plant traits, including resistance to abiotic and biotic stresses [1-4]. One branch of the pathway is responsible for the generation of anthocyanin, which is present in various plant organs in most plant species, including the allohexaploid crop species, bread wheat (Triticum aestivum L.). Two major groups of anthocyanin pigmentation genes are present in wheat: the first includes Rc-1, Pc-1, Pan-1, Plb-1 and Pls-1 which encode the pigmentation in, respectively, the coleoptile, culm, anthers, leaf blades and leaf sheaths; while the second consists of Pp and Ra, which are expressed in, respectively, the pericarp and auricle [5]. The former genes are closely linked to one another on each of the short arms of the homoeologous group 7 chromosomes. An orthologue of maize gene c1 (which encodes a Myb-like transcriptional factor controlling tissue-specific anthocyanin biosynthesis [6]) was mapped earlier on each of the short arms of wheat homoeologous group 7 chromosomes, too [7] in positions highly comparable to those of Rc-1 (red coleoptile) genes [5,8]. Furthermore, it was shown that c1, when transferred to wheat, was able to induce anthocyanin pigmentation in non-pigmented wheat coleoptiles [9]. At the same time Rc-1 was shown to upregulate a number of wheatflavonoid biosynthesis pathway genes – DFR (dihydroflavonol-4-reductase), ANS (anthocyanidin synthase) and UFGT (UDPG flavonol 3-0-glucosyl transferase) [10,11]. Recognizing elements for c1 have also been identified in the promoter sequence of Arabidopsis thalianaF3H gene (flavanone 3-hydroxylase – one of the key enzymes involved in the biosynthesis of flavonoid compounds [12]), suggesting that Rc-1 can probably exert a regulatory role for wheatF3H, too. F3H orthologues have been isolated in barley and maize [13,14] as well as in a range of other plant species , but have yet to be described in wheat.The patterns of expression of homoeologous genes in wheat have been intensively studied in recent years [15-21], but the interaction between structural genes and their homoeologous regulatory genes is unclear. The question remains as to whether, in an allopolyploid, this interaction is genome-specific, or whether regulation cuts across genomes. The Rc-1 and F3H genes are a suitable model to investigate just this issue, as the expression of Rc-1 generates a clear phenotype, and the latter are well-characterized at the molecular level. In this paper, we describe the cloning, sequence analysis, mapping and expression of F3H orthologues in bread wheat and its relatives, and the interaction between F3H and the Rc-1 homoeologues.
Results
Sequence analysis of F3H genes in wheat and its relatives
Nine F3H copies were isolated by PCR cloning from bread wheat (genome AABBDD), the tetraploid wild wheatT. timopheevii (AAGG) and the presumed diploid progenitors of the A, B/G and D genomes (A: T. urartu, B/G:Ae. speltoides, D: Ae. tauschii) (Table 1). Four of the copies were isolated from bread wheat. The length of the coding sequence, which was split into three exons, was 1137 bp, and the first intron varied in length among the homoeologues by some hundreds of base pairs (Figure 1). The sequence of the segments of the first intron of the bread wheat copies F3H1, F3H2 and F3H3 not affected by deletions/insertions shared over 80% homology, but the first intron of F3H4 was quite distinct. Sequence alignment of T. aestivumF3H sequences (coding regions) with barleyF3H [13] is shown in Figure 2a. Sequence comparisons between exon 2 of the Triticum and AegilopsF3H genes (as well as other F3H sequences lodged in GenBank) are illustrated as dendrogram in Figure 2b. The F3H4 sequence departs significantly from that of the other Triticum and Aegilops copies (Figure 2). T. aestivum F3H1 and T. timopheevii F3H1sequences are probably derived from the A genome, whereas F3H2 and F3H2are suggested to belong to the genomes D and G, respectively (Figure 2b). F3H3 occupies an intermediate position between the two main Triticum-Aegilops clusters (Figure 2b). Patterns of sequence divergence across the structural region of wheat F3H1 and F3H2 suggest that the second exon is the most variable at the nucleotide level, but is most well conserved at the amino acid level (Figure 3, Table 2). Exon 2, intron 2 and the beginning of exon 3 (Segment 3, see Figure 1) were re-sequenced from a panel of seven diverse bread wheat genotypes, but no intraspecific variation was detected.
Table 1
Length, Genbank accession numbers and chromosome locations for F3H nucleotide sequences determined in the present study.
Species, gene
Length in base pairs (gene segment specification according Figure 1)
Genbank accession number
Identical wheat ESTs*
Chromosome location
T. aestivum, F3H1
1852, complete structural part of gene (Segments 1+2+3+4)
EF463100
BG262227
2A
T. aestivum, F3H2
1374, complete structural part of gene (Segments 1+4+5)
DQ233636
BJ237068 BJ242608
2D
T. aestivum, F3H3
1626, partial (Segments 2+3+4)
EU402957
BQ240612 BG262749 CA705431
2B
T. aestivum, F3H4
562, partial (Segment 2)
EU402958
BE414777
2B
T. timopheevii, F3H1t
542, partial (Segment 3)
EU402959
BG262227
2A
T. timopheevii, F3H2t
539, partial (Segment 3)
EU402960
-
2G
T. urartu, F3H
542, partial (Segment 3)
EU402961
BG262227
Suggested 2A
Ae. speltoides, F3H
542, partial (Segment 3)
EU402963
-
Suggested 2S
Ae. tauschii, F3H
1326, partial (Segment 5)
DQ233637
BJ237068 BJ242608
Suggested 2D
*Correspondence between F3H copies and ESTs was first determined based on identity at gene copy-specific sights, and then was confirmed by whole sequences comparison (see Figure 10).
Figure 1
The structure of wheat Different gene segments referred in the paper text and tables are indicated in the figure part (a), length of introns of the different T. aestivum F3H gene copies are indicated in part (b); partial sequences are extended with dotted lines, whereas solid lines correspond to sequences cloned and analysed in the present study.
Figure 2
sequences comparison: (a) alignment of complete coding sequences of barley F3H [13] and wheat F3H1 and F3H2 and partial wheat F3H3 and F3H4 copies cloned in the present study (introns are not included into alignment); (b) similarity of part of F3H exon 2 (specified as segment 6 in Figure 1) from various plant species – the species from which F3H copies were cloned and analysed in the present study are underlined, others were obtained from GenBank; for species with more than one F3H gene, each copy is identified by a number in parentheses.
Figure 3
Gene divergence between the hexaploid wheat A and D genome (a) percentage of nucleotide substitutions in exons, (b) ratio of non-synonymous (Ka) to synonymous (Ks) nucleotide substitutions.
Table 2
Sequence homology and divergence among F3H1 and F3H2 genes.
Part of gene
Length: F3H1/F3H2 (in bp)
Nucleotide sequences homology (%)
Ka/Ks*
Exon1
369/369
98
0.125
Intron 1
614/136
There are two major deletion regions, other segments have over 90% homology
Length, Genbank accession numbers and chromosome locations for F3H nucleotide sequences determined in the present study.*Correspondence between F3H copies and ESTs was first determined based on identity at gene copy-specific sights, and then was confirmed by whole sequences comparison (see Figure 10).Sequence homology and divergence among F3H1 and F3H2 genes.*Ka – non-synonymous nucleotide substitutions, Ks – synonymous nucleotide substitutions.The structure of wheat Different gene segments referred in the paper text and tables are indicated in the figure part (a), length of introns of the different T. aestivumF3H gene copies are indicated in part (b); partial sequences are extended with dotted lines, whereas solid lines correspond to sequences cloned and analysed in the present study.sequences comparison: (a) alignment of complete coding sequences of barleyF3H [13] and wheat F3H1 and F3H2 and partial wheatF3H3 and F3H4 copies cloned in the present study (introns are not included into alignment); (b) similarity of part of F3H exon 2 (specified as segment 6 in Figure 1) from various plant species – the species from which F3H copies were cloned and analysed in the present study are underlined, others were obtained from GenBank; for species with more than one F3H gene, each copy is identified by a number in parentheses.Gene divergence between the hexaploid wheat A and D genome (a) percentage of nucleotide substitutions in exons, (b) ratio of non-synonymous (Ka) to synonymous (Ks) nucleotide substitutions.
Chromosomal assignment and physical mapping of F3H genes in hexaploid wheat
Primer pairs amplifying specifically fragments from individual F3H copies (referred further as "gene copy-specific primer pairs") were designed and used in PCR analysis of 'Chinese Spring' nulli-tetrasomic lines. It was shown that F3H1 and 2 are on, respectively, chromosomes 2A and 2D, while 3 and 4 both map to chromosome 2B (Table 1, Figure 4). A deletion line analysis was then used to define the intra-chromosomal location of F3H1 to the sub-terminal bin (2AL3) of chromosome 2AL, both F3H3 and F3H4 to the terminal bin (2BL6) of chromosome 2BL, and F3H2 to the terminal bin (2DL6) of chromosome 2DL (Figure 5). Since the location of F3H3 and F3H4 could not be distinguished by this method, an introgression line derived from the cross T. aestivum × T. timopheevii, which contains a 2BL/2GL breakpoint within chromosome bin 2BL6 between the microsatellite loci Xgwm1067 and Xgwm0526 [22], was used to show that F3H3 and -4 are discrete loci (Figure 6a and 6b, respectively). F3H3 lies proximal to the to the 2BL/2GL breakpoint, whereas F3H4 location is distal. A specific PCR assay for the T. timopheevii F3H2sequence (Figure 6c) proved that it, like T. aestivumF3H3, too lies proximal to the 2BL/2GL breakpoint, thus suggesting that these two loci, along with F3H1 and F3H2, belong to an F3H homoeoallelic series, whereas F3H4 appears to be a non-homoelogous duplication. Accordingly, the genes were re-designated F3H-A1 (F3H1), F3H-B1 (F3H3), F3H-D1 (F3H2), F3H-G1 (F3H2) and F3H-B2 (F3H4).
Figure 4
PCR profiles of the 'Chinese Spring' nulli-tetrasomic lines and the diploid donors of hexaploid wheat, amplified with The length of the PCR products is given in base pairs to the right. Designations '1A', '1B' etc. correspond to 'nulli' chromosome in the certain nulli-tetrasomic line; 'Tu' – T. urartu, 'Aes' – Ae. speltoides, 'Aet' – Ae. tauschii.
Figure 5
Physical mapping of Microsatellite markers (Xgwm) designations are given to the right from each chromosome scheme, chromosome bin names are indicated to the left.
Figure 6
PCR profiles of 'Saratovskaya 29' (1), T. timopheevii (2) and 'Saratovskaya 29'x T. timopheevii introgression line 842 (3), amplified with gene copy-specific primers for T. aestivum F3H3 (a) and F3H4 (b) and T. timopheevii F3H2(c).
PCR profiles of the 'Chinese Spring' nulli-tetrasomic lines and the diploid donors of hexaploid wheat, amplified with The length of the PCR products is given in base pairs to the right. Designations '1A', '1B' etc. correspond to 'nulli' chromosome in the certain nulli-tetrasomic line; 'Tu' – T. urartu, 'Aes' – Ae. speltoides, 'Aet' – Ae. tauschii.Physical mapping of Microsatellite markers (Xgwm) designations are given to the right from each chromosome scheme, chromosome bin names are indicated to the left.PCR profiles of 'Saratovskaya 29' (1), T. timopheevii (2) and 'Saratovskaya 29'x T. timopheevii introgression line 842 (3), amplified with gene copy-specific primers for T. aestivumF3H3 (a) and F3H4 (b) and T. timopheevii F3H2(c).
Expression analysis of F3H in lines with and without pigmented coleoptiles
To explore the role of the Rc-1 (red coleoptile) genes as regulators for F3H expression, eight progeny from the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732', along with a set of six different chromosome 7D introgression lines of Ae. tauschii into 'Chinese Spring', varying with respect to the dominant allele at either Rc-B1 or Rc-D1, were subjected to RT-PCR analysis from cDNA derived from four day old seedlings. The parental genotypes with pigmented coleoptiles ('Chinese Spring' ('Hope' 7B) and 'Chinese Spring (Ae. tauschii 7D) both showed a high level of F3H expression, whereas those with non-pigmented coleoptiles showed either little ('TRI 2732') or none ('Chinese Spring') (Figure 7). When this result was compared with the microsatellite-based genotype of the lines [8,23], the regulator of F3H expression on chromosome 7B was mapped between Xgwm0263 and Xgwm0573, co-segregating with Rc-B1 (Figure 7a); similarly, the equivalent locus on chromosome 7D co-segregated with Rc-D1 within the genetic interval Xgwm0044 and Xgwm0111 (Figure 7b). RT-PCR was also used to study contribution of single genes F3H-A1, F3H-B1, F3H-B2 and F3H-D1 to total F3H expression. It was shown that F3H-B2 is not expressed whether or not the coleoptiles are pigmented (Figure 8). In contrast, F3H-A1, F3H-B1 and F3H-D1 were actively expressed in lines with pigmented coleoptiles ('Chinese Spring' ('Hope' 7B) and respective recombinant lines; Figure 8, lines 1, 3, 4, 9, 10), whereas those with non-pigmented coleoptiles ('TRI 2732' and respective recombinant lines) showed a low level of expression of only F3H-A1 and F3H-B1 (Figure 8: faint bands in lines 2, 5–8, respectively).
Figure 7
RT-PCR analysis of total F3H expression in four day old seedlings of Anthocyanin pigmentation in coleoptiles of the corresponding lines is shown above, whereas the status of chromosomes 7B (a) or 7D (b) of each line is indicated in the lower part of the panel.
Figure 8
copy-specific RT-PCR analysis from four day old seedlings of 'Chinese Spring' ('Hope' 7B) (1), 'TRI 2732' (2) and progeny of the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732' (3–10). Anthocyanin pigmentation in coleoptiles of the corresponding lines is shown below. The length of the RT-PCR products is given in base pairs to the right.
RT-PCR analysis of total F3H expression in four day old seedlings of Anthocyanin pigmentation in coleoptiles of the corresponding lines is shown above, whereas the status of chromosomes 7B (a) or 7D (b) of each line is indicated in the lower part of the panel.copy-specific RT-PCR analysis from four day old seedlings of 'Chinese Spring' ('Hope' 7B) (1), 'TRI 2732' (2) and progeny of the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732' (3–10). Anthocyanin pigmentation in coleoptiles of the corresponding lines is shown below. The length of the RT-PCR products is given in base pairs to the right.
Temporal pattern and the genome specificity of F3H expression
To investigate the possibility of more subtle differences between expression levels of the F3H homoeologues in presence of particular alleles of Rc-1, quantitative RT-PCR was applied to a set of cDNAs sampled from two to six day old seedlings (Figure 9). The test genotypes were 'Chinese Spring' ('Hope' 7A) [Rc-A1b], 'Chinese Spring' ('Hope' 7B) [Rc-B1b] and cv. 'Mironovskaya 808' [Rc-D1b], along with the control 'Chinese Spring' which carries the non-pigmented alleles at all three Rc-1 loci. In the latter, none of the F3H copies was expressed at any time during the sampling period. F3H-B2 was not expressed in any of three test line seedlings, but F3H-A1, F3H-B1 and F3H-D1 were all expressed in these lines. No within genotype significant difference (p = 0.05) in the expression level of the three homoeologues could be detected at any of the sampling times (Table 3). However, the overall level of F3H expression differed very significantly between each pair of lines (Table 4). The level was lowest in 'Mironovskaya 808' and highest in 'Chinese Spring' ('Hope' 7A). The highest expression level in 'Mironovskaya 808' was reached three days after germination, while in 'Chinese Spring' ('Hope' 7A) and 'Chinese Spring' ('Hope' 7B), the maximum was detected on the fourth day. In 'Chinese Spring' ('Hope' 7B), expression started later and declined more rapidly than in 'Chinese Spring' ('Hope' 7A). The delayed start and lower total level of expression in 'Chinese Spring' ('Hope' 7B) was consistent with the observed temporal development of pigmentation in the coleoptiles. Overall, therefore, each Rc-1 gene appeared to regulate the expression of the three F3H homoeologues equally, but the level of F3H expression was dependent on the identity of the dominant Rc-1 allele present.
Figure 9
Quantitative RT-PCR analysis with respect to the various copies of F3H in 'Chinese Spring' (CS), 'Chinese Spring' ('Hope' 7A), 'Chinese Spring' ('Hope' 7B) and 'Mironovskaya 808' (M808).
Table 3
T-values for expression levels of different F3H homoeologues in coleoptiles (p = 0.05 for all presented values).
F3H-A1 vs F3H-B1
F3H-A1 vs F3H-D1
F3H-D1 vs F3H-B1
'Chinese Spring' ('Hope' 7A)
0.28
0.40
0.40
'Chinese Spring' ('Hope' 7B)
0.04
0.48
1.92
'Mironovskaya 808'
1.39
0.27
0.52
Table 4
T-values for F3H expression in different wheat genotypes.
Genotypes compared
'Chinese Spring' ('Hope' 7A) vs 'Chinese Spring' ('Hope' 7B)
'Chinese Spring' ('Hope' 7A) vs 'Mironovskaya 808'
'Chinese Spring' ('Hope' 7B) vs 'Mironovskaya 808'
T
6.17
4.29
2.76
P >
0.999
0.999
0.95
T-values for expression levels of different F3H homoeologues in coleoptiles (p = 0.05 for all presented values).T-values for F3H expression in different wheat genotypes.Quantitative RT-PCR analysis with respect to the various copies of F3H in 'Chinese Spring' (CS), 'Chinese Spring' ('Hope' 7A), 'Chinese Spring' ('Hope' 7B) and 'Mironovskaya 808' (M808).
Discussion
Cloning and analysis of F3H sequences
F3H genes have been isolated from barley, maize and Arabidopsis thaliana [13,14,24] as well as from a range of other plant species . In wheat, only one single partial F3H sequence has been published to date [11]. The relationship between the wheat and Aegilops sp. F3H sequences reported here (with the exception of F3H-B2) and those lodged in GenBank (Figure 2) is consistent with standard taxonomic treatment [25] and with known phylogenies within the Triticum/Aegilops complex [26]. The F3H sequences of diploid progenitors of wheat were useful for the genome assignment of the homoeologous gene copies in polyploid wheat. The substantial structural divergence between F3H-B2 and that of three F3H-1 homoeologues is accompanied by a functional difference. The lack of F3H-B2 expression in pigmented coleoptiles does not reflect its complete non-functionality, since a highly identical root EST has been reported (Table 1, Figure 10). The presence of two B genome copies of F3H is not a particularly unusual result, as F3H copy number in diploids varies from one [13,14,24] to two [27,28]. Silent divergence (Ka/Ks) appears to be homogeneously distributed throughout the coding region of Arabidopsis thalianaF3H, being rarest in the second, and most frequent in the third exon [29]. A similar pattern applies to the wheat A and D genome F3H homoeologues (Figure 3, Table 2).
Figure 10
Comparison of The highest identity value for each EST is indicated with black arrow.
Comparison of The highest identity value for each EST is indicated with black arrow.A PCR-based cloning approach has been used to clone other flavonoid biosynthesis pathway genes in hexaploid wheat (Table 5), whereas in barley and other diploid species they have been isolated from cDNA libraries [13,30]. It has recently become clear that not all members of a homoeologous series in wheat are co-expressed [16,18,31], so the genomic PCR-based cloning approach is probably the more preferable strategy to capture a full set of homoeologues. Although PCR-based cloning has some disadvantages when applied in an allopolyploid (specifically in the generation of PCR chimeras – however, this problem can usually be overcome by the cloning and sequencing of several replicates), it is an effective strategy for the design of gene copy-specific primers, the chromosomal localization of genes and expression analysis.
Table 5
Previously characterised flavonoid biosynthesis pathway genes in wheat.
Previously characterised flavonoid biosynthesis pathway genes in wheat.
Expression of the three homoeologous F3H loci in lines with and without pigmented coleoptiles
The patterns of expression of flavanone 3-hydroxylase in lines with and without pigmented coleoptiles indicated that Rc-B1 and Rc-D1 are coincident with the genes regulating its expression (Figure 7). This is in accordance with the suggestion that Rc-1 genes exert a regulatory role for F3H genes, which could be made on the base of combined results obtained earlier [5-9,12]. The patterns of temporal expression among the F3H homoeologues in the presence of different dominant Rc-1 alleles allowed for an examination as to whether, in an allopolyploid context, there are any genome-specific relationships between the structural and regulatory genes. No such relationship was apparent, since in pigmented coleoptiles, F3H-A1, F3H-B1 and F3H-D1 were all expressed at a similar level (Figure 9). Many sets of wheat homoeologous genes are known to be equally expressed in this way [16,19,21], but in others, the expression of one or more members may be either completely [16,18,31] or partially [15,20,21] suppressed. Generally, when F3H homoeologues are expressed actively (as in pigmented coleoptiles), then they are expressed equally, but where overall F3H transcription level is low, then selective expression of F3H homoeologues could be observed (i.e. F3H-A1 and F3H-B1 were expressed in the green coleoptiles of 'TRI 2732', but F3H-D1 was not; Figure 8). These outcomes are consistent with the activity-selectivity principle [32] acting at the transcriptional level.
Functional difference between homoeologous Rc-1 genes
Whereas each dominant Rc-1 allele affects the expression of each of the three F3H homoeologues equally, overall F3H expression was dependent on the identity of which dominant Rc-1 allele was present (Figure 9). This difference was observed not only at specific time points, but also from the total amounts of F3H mRNA produced over the period of coleoptile pigmentation. The delayed start of expression and the lesser level of transcript present in 'Chinese Spring' ('Hope' 7B) compared to 'Chinese Spring' ('Hope' 7A) was consistent with the observed accumulation of pigmentation in the coleoptile, both in the present experiments and in those reported earlier [33]. In order to test for background effects on F3H expression or variability within transcriptional factors encoded by dominant Rc-1 alleles in other genotypes, it would be of interest to investigate the extent to which the profiles of F3H expression of 'Chinese Spring' ('Hope' 7A), 'Chinese Spring' ('Hope' 7B) and 'Mironovskaya 808' are typical, i.e. for instance to compare profile of 'Mironovskaya 808' to those of some other varieties carrying the same dominant allele (Rc-D1).
Conclusion
There are at least four flavanone 3-hydroxylase gene copies in the hexaploid genome of bread wheat, three of which are the homoeologues on chromosomes 2AL, 2BL and 2DL, highly similar at structural and functional level, while the fourth one represents a distinct non-homoeologous copy on chromosome 2BL with suppressed expression in red coleoptiles.Expression of the F3H homoeologues (F3H-1) in wheat coleoptiles is determined by the presence of dominant alleles in Rc-1 (red coleoptiles) loci. Rc-1 and F3H-1 genes represent a suitable model to investigate relationship between homoeologous regulatory and homoeologous structural genes in allopolyploid wheat genome (which have never been studied before). The lack of any genome-specific relationship between F3H-1 and Rc-1 observed in the present study implies an integrative evolutionary process among the three diploid genomes, following the formation of hexaploid wheat.Furthermore, based on F3H expression analysis it was observed for the first time that activity-selectivity principle [32] acts at the transcriptional level.Our general conclusion is that regulatory genes probably contribute more to the functional divergence between the wheat genomes than do the structural genes themselves. This is in line with the growing consensus which suggests that although heritable morphological traits are determined by the expression of structural genes, it is the regulatory genes which are the prime determinants of allelic identity.
Methods
Plant materials and RNA extraction
The bread wheat cultivars 'Chinese Spring', 'Opata', 'Flair', 'Prinz', 'Golubka', 'Novosibirskaya 67', the synthetic hexaploid wheat 'W7984', tetraploid T. timopheevii k-38555 (AAGG) and the diploids T. urartu TMU06 (AA), Aegilops speltoides TS01 (SS) and Ae. tauschii TQ17 (DD) were used for PCR-based cloning. The complete set of 'Chinese Spring' nulli-tetrasomic lines [34], a subset of homoeologous group 2 chromosome deletion lines [35], introgression line 842 derived from the cross T. aestivum cv. 'Saratovskaya 29' × T. timopheevii [22] were exploited to establish chromosome bin locations. Eight progeny from the cross 'Chinese Spring' ('Hope' 7B) × 'TRI 2732' [8] and a set of six homozygous lines each containing a different chromosome 7D segment derived from Ae. tauschii in a 'Chinese Spring' background [23] were used for RT-PCR. Quantitative examination of F3H expression was measured in 'Chinese Spring' and 'Mironovskaya 808' and the single chromosome substitution lines 'Chinese Spring' ('Hope' 7A) and 'Chinese Spring' ('Hope' 7B). DNA was extracted from seven day old seedlings following the procedure described earlier [36]. RNA was extracted from seedlings grown at 20°C under a 12 h day/12 h night regime using the QIAGEN Plant Rneasy Kit, followed by DNAse treatment. For RT-PCR, RNA was extracted on the fourth day after germination. For quantitative RT-PCR, RNA was extracted every 24 h from two to six day old seedlings.
PCR-based cloning and sequence analysis
The barleyF3H cDNA sequence [13] was aligned with matching wheat ESTs lodged in , employing Multalin v5.4.1 (using absolute alignment score with gap value of 12 and gap length value of 2) [37]. Sets of primers flanking various F3H gene segments were designed using OLIGO software (Table 6) [38], with one primer pair as described earlier [11]. PCR reaction mixtures (50 μl) contained 50 ng template, 67 mM Tris HCl pH8.8, 1.8 mM MgCl2, 0.01% Tween 20, 18 mM (NH4)2SO4, 0.2 mM dNTP, 0.25 mM each primer and 1 U Taq DNA polymerase. PCR amplifications began with a 94°C/5 min incubation, followed by 45 cycles of 94°C/1 min, 60°C/2 min, 72°C/2 min, and a final extension of 72°C/10 min. PCR fragments were recovered from 1% agarose gels, purified using a QIAGEN MinElute Gel Extraction Kit, and cloned with a QIAGEN PCR Cloning Kit. Between five and ten clones per each primer combination per diploid genome were sequenced in both directions to eliminate PCR and sequencing errors or PCR-generated chimeras. Sequencing was effected using an ABI PRISM Dye Terminator Cycle Sequencing ready reaction kit ("Perkin Elmer") with pUC/M13 forward and reverse primers. Full-(or partial) length sequences of various F3H gene copies were constructed from overlapping sequences. Cluster analysis was performed on MEGA v3.1 software [39] using the UPGMA (unweighted pair-group method with arithmetic average) algorithm and 500 bootstrap trials.
Table 6
Primers designed to amplify wheat F3H for cloning, chromosomal localization and for expression analysis.
Purpose
Gene
Gene segment specification (according Figure 1) or former gene name
DNA/cDNA-derived PCR product length (bp)
Forward primers
Reverse primers
PCR-based cloning
F3H
Segment 1
variable
atggcgccggtgagcaac
tttacgtggcatggcatgcat
F3H
Segment 2
variable
atgacgcgcctctctcgcg
tggacggtgatccaggtcttg
F3H
Segment 3
variable
[11]
[11]
F3H
Segment 4
variable
tctcgatcgatcgaccaccaa
ctaggcaagaatttcgttgaggg
F3H
Segment 5
variable
ccggtgagcaacgagacgttc
ggcaagaatttcgttgagggg
Chromosomal assignment and
F3H-A1
T. aestivum F3H1
703/-
gccacctgcaggtatacacgcat
ccaccgcccgtagtccct
physical mapping
F3H-B1
T. aestivum F3H3
333/-
gcgtgctgtccgaggcgc
cgatcgatcgattaaggatt
F3H-B2
T. aestivum F3H4
255/155
gctgcctgccgaggacaagg
aacgcccgtagtcccgtgcc
F3H-D1
T. aestivum F3H2
225/-
gccacctgcaggtacccacacat
ccacctcccgtagtcccg
F3H-G1
T. timopheevii F3H2t
371/-
acgactcatggggctgtca
caattggtggtcgatcgatcag
qRT-PCR, RT-PCR
F3H-A1
T. aestivum F3H1
800/186
atgacacgcctctctcgcg
ccaccgcccgtagtccct
F3H-B1
T. aestivum F3H3
830/183
tgacgcgcctctctcgcgag
accgcccgtagtcccgtgct
F3H-B2
T. aestivum F3H4
255/155
gctgcctgccgaggacaagg
aacgcccgtagtcccgtgcc
F3H-D1
T. aestivum F3H2
281/145
atcgtctccagccacctgcag
cgctgtatcgctccaccacg
Primers designed to amplify wheatF3H for cloning, chromosomal localization and for expression analysis.
Chromosomal assignment and physical mapping of F3H
Specific primer pairs were designed to amplify each wheatF3H copy (Table 6). To obtain a unique amplification product, the 3' end of at least one of the two primers matched the copy-specific sequence. A touchdown PCR protocol was used to amplify from templates of the 'Chinese Spring' nulli-tetrasomic and deletion lines and the T. aestivum × T. timopheevii introgression line 842 in 20 μl reactions by applying a denaturing step of 94°C/2 min, 13 cycles of 94°C/15 s, 65°C/30 s (decreasing by 0.7°C/cycle), 72°C/45 s, 24 cycles of 94°C/15 s, 56/30 s, 72°C/45 s; and a final extension of 72°C/5 min. The specificity of the amplifications was confirmed by cloning and sequencing of the PCR product from 'Chinese Spring'. The microsatellite analysis of the 'Chinese Spring' deletion lines was performed using procedures described earlier [40]. The microsatellite genotypic data of the T. aestivum × T. timopheevii introgression line 842 have been published [22].
RT-PCR and qRT-PCR
Single-stranded cDNA was synthesized from 1 mg total RNA using a (dT)15 primer and the QIAGEN Omniscript Reverse Transcription kit in a 20 μl reaction mixture. RT-PCR was performed with F3H primers published earlier [11] or with F3H gene copy-specific primers (Table 6). The standardization of cDNA template was performed using ubiquitin (UBC) primers [11]. PCR products were separated by 2% agarose gel electrophoresis. F3H gene copy-specific primers were also applied for qRT-PCR, which used a QIAGEN QuantiTect SYBR Green kit. UBC and GAPDH primers were used to standardize the cDNA template. The amplifications were performed in an Applied Biosystems 7900 HT fast real time PCR system. Pre-determined amounts of cloned cDNA were used to generate standard curves. Each sample was run in three replicates. The specificity of the qRT-PCR products was confirmed by 2% agarose gel electrophoresis. Statistical significance of differences in F3H expression level either between F3H homoeologues or between different genotypes was assessed by Student's t-test for matched pairs. When F3H homoeologues were compared, T-values were calculated for each pair (F3H-A1 vs F3H-B1, etc.) in each genotype (Table 3), and 'matched pairs' were represented by expression level values obtained for respective pair of F3H homoeologues at the same day in the same genotype. When comparison was made between genotypes, T-values were calculated for each pair of genotypes ('Chinese Spring' ('Hope' 7A) vs 'Chinese Spring' ('Hope' 7B), etc.; Table 4), and 'matched pairs' were represented by expression level values obtained in respective pair of genotypes at the same day for the same F3H gene copy.
EKK carried out the molecular genetic studies, sequence alignment, primer design and statistical analysis, she conceived of the study, participated in its design and drafted the manuscript. MSR and EAS coordinated the study, contributed to its conception and design, to interpretation of data and to revising the manuscript critically. All authors read and approved the final manuscript.