Literature DB >> 18334966

A novel connexin 50 (GJA8) mutation in a Chinese family with a dominant congenital pulverulent nuclear cataract.

Ming Yan1, Chenling Xiong, Shui Qing Ye, Yongmei Chen, Min Ke, Fang Zheng, Xin Zhou.   

Abstract

PURPOSE: To identify the genetic cause responsible for the autosomal dominant hereditary cataract in a Chinese family.
METHODS: A whole family of a proband who has a dominant congenital pulverulent nuclear cataract was recruited into Zhongnan Hospital. The lenses of patients were observed by a slit-lamp microscope, and the lenses of the proband's mother were analyzed by scanning electron microscopy. Mutation screening was performed in the cataract candidate genes coding for crystallins and connexin 50 by sequencing of polymerase chain reaction (PCR) products amplified from blood leukocyte DNA samples of eight family members. The identified mutation was then investigated in other participated family members, 200 normal controls, and 40 senile cataract patients by the restriction fragment length polymorphism (RFLP) method.
RESULTS: The structure of the lens opacities of the proband's mother is puffy, and the fibers are tangled under a scanning electron microscope. A novel C>T transition at nucleotide position 827 was determined in the connexin 50 (GJA8) gene. This mutation led to a serine (S) to phenylalanine (F) amino acid substitution in amino acid position 276 where the secondary structure prediction suggested a helix replaced by a sheet. And the mutation was neither found in the 200 controls nor in the 40 senile cataract patients.
CONCLUSIONS: A novel GJA8 gene mutation was found to be associated with hereditary cataract in a Chinese congenital cataract family.

Entities:  

Mesh:

Substances:

Year:  2008        PMID: 18334966      PMCID: PMC2268715     

Source DB:  PubMed          Journal:  Mol Vis        ISSN: 1090-0535            Impact factor:   2.367


Introduction

Cataract accounts for about 41.06% of blindness and is the leading cause of visual impairment in China [1]. Furthermore, the incidence of cataract continues to rise. So far, only surgical intervention could prevent or delay the occurrence and development of cataract. New therapeutic modalities are needed, but their development has been impeded by the incomplete understanding of cataract formation mechanisms. Although there are multiple factors involved in the etiology and development of cataract, accumulating evidence indicates that genetic background plays an important role in the whole process. Research on hereditary congenital cataracts led to the identification of several classes of candidate genes [2] that encode proteins such as the crystalline proteins (CRYAA, CRYAB, CRYBA1/A3,CRYBB1, CRYBB2, CRYBB3, CRYGC, CRYGD, and CRYGS) [3,4], the gap junction protein [5], major intrinsic protein (MIP/MIP26) [6], lens integral membrane protein 2 (LIM2/MP19), the beaded filament protein (BFSP2) [7], paired-like homeodomain transcription factor 3 (PITX3) [8], heat shock protein (HSF4) [9], and galactokinase [10]. Knowledge of the structures and functions of those candidate genes as well as the pathophysiology effect of their disease-associated mutations on their functions will provide hints for understanding the mechanisms of cataracts. In this paper, we report a novel S276F (827C>T) mutation in the connexin 50 gene in a Chinese five-generation family with the pulverulent nuclear cataract. This is a missense mutation that has not been reported previously with an inherited cataract.

Methods

Family data

A Chinese family was recruited into Zhongnan Hospital, Wuhan, China. The pedigree is presented in Figure 1A. Ethical approval for this study was obtained from the Zhongnan Hospital Research Ethics Committee. Informed written consent was obtained from all adult individuals and the parents of children under 16 years of age.
Figure 1

Family pedigree in this study and lens photograph of the proband (IV: 7). The pedigree is a large five-generation Chinese family (A). Females are represented by circles and males by squares. Ophthalmologist confirmed affected individuals are colored black. The phenotype exhibits the appearance of pulverulent nuclear cataract (B). The optical section shows lens opacities in the proband. The fetal nucleus and the embryonal nucleus both display white granular opacities (C).

Family pedigree in this study and lens photograph of the proband (IV: 7). The pedigree is a large five-generation Chinese family (A). Females are represented by circles and males by squares. Ophthalmologist confirmed affected individuals are colored black. The phenotype exhibits the appearance of pulverulent nuclear cataract (B). The optical section shows lens opacities in the proband. The fetal nucleus and the embryonal nucleus both display white granular opacities (C). The proband is a 39-year-old man. He was diagnosed with a congenital pulverulent nuclear cataract (Figure 1B,C), and the cataract began around seven years of age with progression. Full ophthalmic assessment was performed in the participated subjects. Ten affected and sixteen unaffected members in the family participated in the study.

Electron microscope analysis

The lenses of the proband’s mother were removed during operation and prefixed in a solution containing 2% glutaraldehyde at room temperature for two days. The lenses were washed in 0.1 M phosphate buffer saline (pH 7.2) three times, postfixed in 1% aqueous OsO4 for 2 h, and then washed again three times in 0.1 M phosphate buffer saline (pH 7.2). The samples were replaced in isoamyl acetate for 20 min before being dehydrated in a series of ethanol-water washes (25%, 50%, 75%, two 95%, and three 100% ethanol). Finally, samples were dried using a critical point drying apparatus, firmly mounted, and sputter coated with a thin layer of gold before examination under a HITACHI S-570 electron microscope.

DNA isolation

The genomic DNA was extracted from venous blood leukocytes of subjects using the improved NaI method [11].

Mutation detection

Mutation screening in the known candidate genes for hereditary cataracts such as CRYAB, CRYAA, CRYBB2, CRYGC, CRYGD, and GJA8 was performed by polymerase chain reaction (PCR) amplification of the exonic regions of those genes and by direct DNA sequencing of those PCR amplicons. The sets of primer pairs used in the PCR amplifications are listed in Table 1.
Table 1

Primers used to screen mutations.

Gene symbol and accession numberSequenceAmplified fragmentAnnealing temperature*Size
GJA8
GI:6942063F:CGGGGCCTTCTTTGTTCTCTAGTCC
R:AGGCCCAGGTGGCTCAACTCCThe first part of exonic fragment60877 bp
F:CAGCCGGTGGCCCTGCC
R:GTTGCCTGGAGTGCACTGCCCThe second part of exonic fragment69907 bp
CRYGC
GI: 37551287F:TCAATCATATAGACAGAGCCA
R:ATGTCCATCTAACCCTTAGGTExons 1 and 255784 bp
F:AATGACAATTCCATGCCACA
R:CCCACCCCATTCACTTCTTAExon 355534 bp
CRYGD
GI: 37551287F:TGATAGCAATCCGAATACTCCA
R:GGGTAATACTTTGCTTATGTGGGGAGExons 1 and 255776 bp
F:GTCCTCACCAAGCTGGACTG
R:CCATTTGCCTCGTGTGTGTAExon 355496 bp
CRYBB2
GI: 16168698F:CACTGTGTCCAAGGTCACACAGCTAAGC
R:CCCCTCGTTCACCCTCCCATCAExon 669506 bp
CRYAA
GI: 37559293F:CTCCAGGTCCCCGTGGTA
R:AGGAGAGGCCAGCACCACExon 160251 bp
F:CTGTCTCTGCCAACCCCAG
R:CTGTCCCACCTCTCAGTGCCExon 265220 bp
F:GGCAGCTTCTCTGGCATG
R:GAGCCAGCCGAGGCAATGExon 360309 bp
CRYAB
GI: 27540935F:AGGATGAATTACCCGGACAGAAAG
R:ACCCCTGATCCCGACTGTTATExon 265360 bp
F:TGAGTTCTGGGCAGGTGATAATAGTT
R:AGCTTGATAATTTGGGCCTGCCExon 360391 bp

F: forward primer, R: reverse primer. The genomic DNA was amplified in a 25 μl reaction volume with 10 pmol forward primers and reverse primers. The asterisk (*) indicates that the PCR conditions were the following: denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 95 °C for 45 s, annealing at the Annealing Temp for 30 s, and extension at 72 °C for 30 s with the last extension for 10 min at 72 °C.

F: forward primer, R: reverse primer. The genomic DNA was amplified in a 25 μl reaction volume with 10 pmol forward primers and reverse primers. The asterisk (*) indicates that the PCR conditions were the following: denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 95 °C for 45 s, annealing at the Annealing Temp for 30 s, and extension at 72 °C for 30 s with the last extension for 10 min at 72 °C. To amplify the second fragment of the exonic region in GJA8, genomic DNA extracted from the proband was amplified in a 25 μl reaction volume. The PCR conditions are as follows: denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 95 °C for 45 s, annealing at 69 °C for 30 s, and extension at 72 °C for 30 s with the last extension for 10 min at 72 °C. The PCR products of 907 bp were purified and sequenced using an ABI Genetic Analyzer 3730 (Invitrogene Ltd, Shanghai, China). The sequencing results were analyzed using Chromas 2.3 and blasted in the NCBI database.

Restriction analysis

Segregation of the mutation in the other participating family members was determined by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with the restriction enzyme Hpy188I (New England Biolab, Beijing, China). We redesigned a pair of primers using Primer Premier 5.0 to amplify the DNA fragment of 239 bp that contained the mutation site based on the published human connexin 50 DNA sequence (GenBank accession number AF217524, GI: 6942063). The primer sequences were as follows: forward primer (GJA8ZF1), 5′-TCA TCC TGT TCA TGT TGT CTG TGG C −3′; reverse primer (GJA8ZF2), 5′–AAC CTC GGT CAA GGG GAA ATA GT G-3′. The C base (underlined) at base pair 24 of the reverse primer was mutated from G to C to produce a recognition site for the restriction enzyme Hpy188I (TCNˇGA). If there was a mutation of C to T, the recognition site of restriction enzyme Hpy188I would have been abolished. PCR conditions were the following: 1 cycle at 95 °C for 5 min; 35 cycles at 95 °C for 45 s, 60 °C for 45 s, and 72 °C for 45 s; then 1 cycle at 72 °C for 10 min. The PCR product was digested with 10 U of Hpy188I at 37 °C for 12 h. The digested PCR products were separated on 8% polyacrylamide gel (acrylamide: bisacrylamide=29:1) in 1×TBE for 1.5–2 h at a constant voltage of 100 V. The PCR products that were amplified from samples of individuals with the wild-type genotype were digested into fragments of 215 and 24 bp while the presence of the 827C>T mutation resulted in fragments of 239, 215, and 24 bp. The schema for the mutation screening in GJA8 by PCR-sequencing and RFLP methods is shown in Figure 2.
Figure 2

Schema for the mutation screening in GJA8. One pair of primers (GJA8–2F and GJA8–2R) were used to amplify the big fragment of the exon in GJA8, and the other pair (GJA8ZF1 and GJA8ZF2) was used to detect the mutation by RFLP.

Schema for the mutation screening in GJA8. One pair of primers (GJA8–2F and GJA8–2R) were used to amplify the big fragment of the exon in GJA8, and the other pair (GJA8ZF1 and GJA8ZF2) was used to detect the mutation by RFLP.

The secondary structure prediction

The secondary structure of mutant and wild-type amino acid sequences were analyzed by Antheprot 2000 V 6.0 software.

Results

In the proband’s mother, there are opacities in the fetal nucleus and embryonal nucleus. The structure of the opacities is puffy, and the fibers are tangled (Figure 3).
Figure 3

Cross section of the lens of the proband’s mother (III: 2) under the scanning electron microscope. The normal lens tissue was shown in a square while the opacity was shown in a circle (A). The parallel aligned strap fiber cells are represented in the longitudinal section (B). The structure of the opacities are puffy and irregularly aligned while floccules were observed and the fiber is tangled (C,D).

Cross section of the lens of the proband’s mother (III: 2) under the scanning electron microscope. The normal lens tissue was shown in a square while the opacity was shown in a circle (A). The parallel aligned strap fiber cells are represented in the longitudinal section (B). The structure of the opacities are puffy and irregularly aligned while floccules were observed and the fiber is tangled (C,D).

Mutation screening

Sequencing of the exonic region of GJA8 in eight participants (three affected and five unaffected) showed a heterozygous mutation 827C>T in all the affected members (Figure 4B). This mutation was also screened in other participated members in the five-generation Chinese family by restriction enzyme digestion with Hpy188I (Figure 4C). The mutation was segregated with the phenotype of all affected family members who participated in this study. It was not present in the unaffected family members or in the 200 controls. Furthermore, 40 Chinese senile patients with age-related nuclear cataract were screened, and the mutation failed to be detected. These results suggested that this 827C>T mutation was associated with the dominant congenital pulverulent nuclear cataract. This nucleotide transversion replaced an evolutionarily conserved serine (S) with phenylalanine (F) at amino acid position 276 in the cytoplasmic COOH-terminal domain of connexin 50 (Figure 5).
Figure 4

Mutation analysis of GJA8. Sequence chromatograms of the wild-type allele (A) demonstrate a nucleotide sequence encoding a serine (Ser) at codon 276, and the chromatograms of the mutant allele (B) demonstrate a C to T transition resulting in the substitution of serine (Ser) by phenylalanine (Phe). Confirmation of segregation of the S276F mutation was given by the PCR-RFLP method (C). M is the DNA ladder; Lane 1 shows the digestions of the PCR products amplified from samples of the patients by Hpy188I. Lane 2 and 4 show the PCR products amplified from samples of one patient or the unaffected member in the pedigree. Lane 3 illustrates the digestions of the PCR products amplified from samples of the unaffected family member by Hpy188I. The mutant primer results in the gain of Hpy188I sites producing digested fragments of 215 and 24 bp with wild-type GJA8 alleles, and the mutation in the GJA8 gene leads to an abolition of this site, remaining undigested (239 bp).

Figure 5

A multiple alignment of amino acid sequence of GJA8. A multiple alignment of amino acid sequence of GJA8 with different connexin species. Identical residues are highlighted with a dark background. The amino acid marked with an arrow is the mutant amino acid at codon 276, where it is highly conserved throughout all connexins.

Mutation analysis of GJA8. Sequence chromatograms of the wild-type allele (A) demonstrate a nucleotide sequence encoding a serine (Ser) at codon 276, and the chromatograms of the mutant allele (B) demonstrate a C to T transition resulting in the substitution of serine (Ser) by phenylalanine (Phe). Confirmation of segregation of the S276F mutation was given by the PCR-RFLP method (C). M is the DNA ladder; Lane 1 shows the digestions of the PCR products amplified from samples of the patients by Hpy188I. Lane 2 and 4 show the PCR products amplified from samples of one patient or the unaffected member in the pedigree. Lane 3 illustrates the digestions of the PCR products amplified from samples of the unaffected family member by Hpy188I. The mutant primer results in the gain of Hpy188I sites producing digested fragments of 215 and 24 bp with wild-type GJA8 alleles, and the mutation in the GJA8 gene leads to an abolition of this site, remaining undigested (239 bp). A multiple alignment of amino acid sequence of GJA8. A multiple alignment of amino acid sequence of GJA8 with different connexin species. Identical residues are highlighted with a dark background. The amino acid marked with an arrow is the mutant amino acid at codon 276, where it is highly conserved throughout all connexins. The mutation S276F leads to the replacement of an original helix by a sheet, a significant difference in coding position 276 of the secondary structures of gap junction protein 50 (Figure 6).
Figure 6

The predicted secondary structures of the mutant and the wild type amino acid sequences. The predicted secondary structures of the mutant amino acid sequence (A) and the wild-type amino acid sequence (B) is shown. The target sequences were labeled by a black circle, which indicated that there is a helix in the wild-type replaced by a sheet in the mutant type. Grey: helix; Black: sheet.

The predicted secondary structures of the mutant and the wild type amino acid sequences. The predicted secondary structures of the mutant amino acid sequence (A) and the wild-type amino acid sequence (B) is shown. The target sequences were labeled by a black circle, which indicated that there is a helix in the wild-type replaced by a sheet in the mutant type. Grey: helix; Black: sheet.

Discussion

Cataracts are defined as lens opacities. The lens is composed of post-mitotic fiber cells. The final differentiation of fiber cells includes the complete removal of all cellular organelles and its inability to undergo protein synthesis, DNA replication, and RNA transcription [12]. All lens fiber cells are retained in the aqueous humor; they are completely avascular in lenses. The fiber cells are connected by intercellular gap junctions. Gap junctions are composed of hundreds of gap junction channels and provide pathways for the exchanges of small molecules such as amino acids, calcium, cyclic adenosine monophosphate (cAMP), inositol triphosphane (IP3), etc. in different vertebrate tissues such as the lens, brain, heart, and liver [13-15]. Gap junction channels in the lens maintain the homeostasis required for lens transparency. A gap junction channel is oligomerized by 12 connexin proteins. There are various gap junction proteins, and among them, connexin 46 and connexin 50 (Cx50 or GJA8) are major lens connexins [15]. Cx50 contains four transmembrane domains, three intracellular regions (the NH2-terminus, a cytoplasmic loop, and the COOH-terminus), and two extracellular loops (E1 and E2) [16]. The coding region of Cx50 is completely contained within one exon. The size of the Cx50 translation region from the transcript start codon to the terminating codon TGA is 1,299 nucleotides. It encodes a polypeptide containing 432 amino acids with a molecular weight of 48,171 daltons [17]. The connexin 46 genes and Cx50 genes, when disrupted in the mouse, lead to congenital cataract [18,19]. Mutations in connexin 46 (α3, Gja3) and connexin 50 (α8, Gja8) genes lead to congenital cataract in human and mice [20,21]. Xia et al. [22] provided evidence that different mechanisms modulated by various gap junction proteins influenced the formation of primary and secondary fiber cells during lens development. It was concluded that mutants in diverse connexins caused different phenotypes of cataract. The nuclear pulverulent cataract described in our study was associated with a mutation in GJA8. The 827C>T transversion resulted in a serine (S) to phenylalanine (F) amino acid substitution in the cytoplasmic COOH-terminal domain of connexin 50. This non-conservative mutation replaces α-amino-β-hydroxy-propionic acid with α-amino-β-phenyl-propionic acid; the hydroxy was replaced by the phenyl (Figure 5). The secondary structure of the mutant protein was predicted, and the helix was replaced by a sheet, which may be the reason for the dysfunction of the mutant protein (Figure 6). So far, there are nine missense mutations of GJA8 found in different hereditary cataract pedigrees; they are R23T, V44E, E48K, V79L, V64G, P88S, P88Q, R198Q, and I247M [5,21,23-28] (Table 2). Among these mutations, only I274M was located in the cytoplasmic COOH-terminus, where a new mutation S276F was identified in this study. I274M was found in a Russian family in 2001, and it was related to a zonular pulverulent cataract [25].
Table 2

Summary of identified mutations in the human connexin 50 gene.

MutationAmino acid changePopulationLocationReference
68G>CR23TIranianNH2-terminus5
131T>AV44EIndianFirst transmembrane domain23
142G>AE48KPakistaniE124
191T>GV64GChineseE125
235G>CV79LIndianSecond transmembrane domain27
262C>TP88SEnglishSecond transmembrane domain26
262C>AP88QEnglishSecond transmembrane domain21
593G>AR198QIndianE223
741T>GI247MRussianthe COOH-terminus28
827C>TS276FChinesethe COOH-terminusThis paper
Autosomal dominant cataracts are morphologically and genetically heterogeneous. Similar phenotypes can map to different loci. Cataract caused by the same genetic defect in members of the same family and even in each lens of the same patient showed variable morphologies [29,30]. Further study is needed to elucidate the pathophysiological consequences of this newly identified mutation in relation to the pathogenesis of cataract. It may lead to a new therapeutic target for cataract.
  28 in total

1.  A novel GJA8 mutation in an Iranian family with progressive autosomal dominant congenital nuclear cataract.

Authors:  C E Willoughby; Sara Arab; R Gandhi; S Zeinali; Seddigheh Arab; D Luk; G Billingsley; F L Munier; E Héon
Journal:  J Med Genet       Date:  2003-11       Impact factor: 6.318

2.  A novel mutation in GJA8 associated with autosomal dominant congenital cataract in a family of Indian origin.

Authors:  Vanita Vanita; Hans Christian Hennies; Daljit Singh; Peter Nürnberg; Karl Sperling; Jai Rup Singh
Journal:  Mol Vis       Date:  2006-10-18       Impact factor: 2.367

3.  An efficient and simple method of DNA extraction from whole blood and cell lines to identify infectious agents.

Authors:  V N Loparev; M A Cartas; C E Monken; A Velpandi; A Srinivasan
Journal:  J Virol Methods       Date:  1991-09       Impact factor: 2.014

4.  Mutation in the connexin 50 gene (GJA8) in a Russian family with zonular pulverulent cataract.

Authors:  A V Polyakov; I A Shagina; O V Khlebnikova; O V Evgrafov
Journal:  Clin Genet       Date:  2001-12       Impact factor: 4.438

5.  Immunohistochemical analysis of rat liver using a monoclonal antibody (HAM8) against gap junction.

Authors:  Y Fujikura; H Ohta; T Hirai; T Fukumoto
Journal:  Anat Rec       Date:  1993-03

6.  A juvenile-onset, progressive cataract locus on chromosome 3q21-q22 is associated with a missense mutation in the beaded filament structural protein-2.

Authors:  Y P Conley; D Erturk; A Keverline; T S Mah; A Keravala; L R Barnes; A Bruchis; J F Hess; P G FitzGerald; D E Weeks; R E Ferrell; M B Gorin
Journal:  Am J Hum Genet       Date:  2000-03-22       Impact factor: 11.025

7.  [Data analysis on epidemiologic survey of cataract in China].

Authors:  S Zhang
Journal:  Zhonghua Yan Ke Za Zhi       Date:  1999-09

Review 8.  Molecular genetic basis of inherited cataract and associated phenotypes.

Authors:  M Ashwin Reddy; Peter J Francis; Vanita Berry; Shomi S Bhattacharya; Anthony T Moore
Journal:  Surv Ophthalmol       Date:  2004 May-Jun       Impact factor: 6.048

Review 9.  Molecular genetics of cataract.

Authors:  J Fielding Hejtmancik; Nizar Smaoui
Journal:  Dev Ophthalmol       Date:  2003

10.  Mutant DNA-binding domain of HSF4 is associated with autosomal dominant lamellar and Marner cataract.

Authors:  Lei Bu; Yiping Jin; Yuefeng Shi; Renyuan Chu; Airong Ban; Hans Eiberg; Lisa Andres; Haisong Jiang; Guangyong Zheng; Meiqian Qian; Bin Cui; Yu Xia; Jing Liu; Landian Hu; Guoping Zhao; Michael R Hayden; Xiangyin Kong
Journal:  Nat Genet       Date:  2002-06-24       Impact factor: 38.330

View more
  27 in total

Review 1.  Gap junctions or hemichannel-dependent and independent roles of connexins in cataractogenesis and lens development.

Authors:  J X Jiang
Journal:  Curr Mol Med       Date:  2010-12       Impact factor: 2.222

Review 2.  Inherited Congenital Cataract: A Guide to Suspect the Genetic Etiology in the Cataract Genesis.

Authors:  Olga Messina-Baas; Sergio A Cuevas-Covarrubias
Journal:  Mol Syndromol       Date:  2017-02-07

Review 3.  Lens gap junctions in growth, differentiation, and homeostasis.

Authors:  Richard T Mathias; Thomas W White; Xiaohua Gong
Journal:  Physiol Rev       Date:  2010-01       Impact factor: 37.312

4.  Mutant connexin 50 (S276F) inhibits channel and hemichannel functions inducing cataract.

Authors:  Yuanyuan Liu; Chen Qiao; Tanwei Wei; Fang Zheng; Shuren Guo; Qiang Chen; Ming Yan; Xin Zhou
Journal:  J Genet       Date:  2015-06       Impact factor: 1.166

5.  A novel Cx50 (GJA8) p.H277Y mutation associated with autosomal dominant congenital cataract identified with targeted next-generation sequencing.

Authors:  Chong Chen; Qiao Sun; Mingmin Gu; Kun Liu; Yong Sun; Xun Xu
Journal:  Graefes Arch Clin Exp Ophthalmol       Date:  2015-05-07       Impact factor: 3.117

6.  Dense cataract and microphthalmia (dcm) in BALB/c mice is caused by mutations in the GJA8 locus.

Authors:  Baskar Bakthavachalu; Sarmishtha Kalanke; Sanjeev Galande; B Ramanamurthy; Pradeep Parab; Kalidas N Kohale; Vasudevan Seshadri
Journal:  J Genet       Date:  2010-08       Impact factor: 1.166

7.  Association between gap junction protein-alpha 8 polymorphisms and age-related cataract.

Authors:  Yuanyuan Liu; Min Ke; Ming Yan; Shuren Guo; Mane Emily Mothobi; Qiang Chen; Fang Zheng
Journal:  Mol Biol Rep       Date:  2010-06-27       Impact factor: 2.316

8.  Advancement of congenital cataract in the responsible gene.

Authors:  Li Peng; Qing Xie
Journal:  Int J Ophthalmol       Date:  2010-09-18       Impact factor: 1.779

9.  The unfolded protein response is activated in connexin 50 mutant mouse lenses.

Authors:  Bhagwat V Alapure; Jaime K Stull; Zeynep Firtina; Melinda K Duncan
Journal:  Exp Eye Res       Date:  2012-06-17       Impact factor: 3.467

10.  A novel GJA8 mutation (p.I31T) causing autosomal dominant congenital cataract in a Chinese family.

Authors:  Kaijie Wang; Binbin Wang; Jing Wang; Shiyi Zhou; Bo Yun; Peisu Suo; Jie Cheng; Xu Ma; Siquan Zhu
Journal:  Mol Vis       Date:  2009-12-16       Impact factor: 2.367

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.