cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid.

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.