| Literature DB >> 18279664 |
Steve A Maxwell1, Gerald J Kochevar.
Abstract
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188bp upstream of the POX transcriptional start site.Entities:
Mesh:
Substances:
Year: 2008 PMID: 18279664 DOI: 10.1016/j.bbrc.2008.01.171
Source DB: PubMed Journal: Biochem Biophys Res Commun ISSN: 0006-291X Impact factor: 3.575