| Literature DB >> 18255355 |
Dennis Wat1, Colin Gelder, Sam Hibbitts, Fay Cafferty, Ian Bowler, Marcus Pierrepoint, Rachel Evans, Iolo Doull.
Abstract
BACKGROUND: Previous studies have suggested a role played by respiratory viruses in the exacerbation of cystic fibrosis (CF). However, the impact of respiratory viruses could have been underestimated because of the low detection rate by conventional laboratory methods.Entities:
Mesh:
Year: 2008 PMID: 18255355 PMCID: PMC7105190 DOI: 10.1016/j.jcf.2007.12.002
Source DB: PubMed Journal: J Cyst Fibros ISSN: 1569-1993 Impact factor: 5.482
Sequences for primers and molecular beacons
| Virus | Primer identification nuceotide no. | Sequence 5′→ 3′ | Function |
|---|---|---|---|
| HPIV1 | P1: 55 | CGATGGCTGAAAAAGGGA | RT reverse primer |
| P1: 139 | CACCAGCAGGAAGGACACA | RT-PCR reverse primer | |
| P1: 857 | GGCAAGGAGCATAACTGATAA | RT-PCR forward primer | |
| P1: 549 | NASBA P1 primer T7 RNA polymerase tail | ||
| P1: 801 | NASBA P2 primer ECL detection tail | ||
| PR1: 669 | CTTCCCTATATCTGCACATCC | HPIV1 capture probe | |
| HPIV1MB | HPIV1 molecular beacon | ||
| HPIV2 | P2: 309 | CACAGCAAGGCATTATTCA | RT reverse primer |
| P2: 738 | CAATGGGGATAATACAACAAT | RT-PCR reverse primer | |
| P2: 1371 | ATGCAGACCACCAAGAGG | RT-PCR forward primer | |
| P2: 848 | NASBA P1 primer T7 RNA polymerase tail | ||
| P2: 1058 | NASBA P2 primer ECL detection tail | ||
| PR2: 979 | CCCTGTTGTATTTGGAAGAGA | HPIV2 capture probe | |
| HPIV2 MB | HPIV2 molecular beacon | ||
| HPIV3 | P3: 770 | ATAACTGTAAACTCAGACTTGGT | RT reverse primer |
| P3: 896 | ACTCCCAAAGTTGATGAAAGA | RT-PCR reverse primer | |
| P3: 1548 | GACAGATGACACAATGCTCC | RT-PCR forward ptimer | |
| P3: 1052 | NASBA P1 primer T7 RNA polymerase tail | ||
| P3: 1201 | NASBA P2 primer ECL detection tail | ||
| PR3: 1129 | CACCCAGTTGTRTTGCAGATT | HPIV3 capture probe | |
| HPIV3MB | HPIV3 molecular beacon | ||
| HPIV4A and HPIV4B | P4: 359 | GCTTATGGGATCAGACACACA | RT reverse primer |
| P4: 531 | GAAAGAGGCTTGGGTTACACA | RT-PCR reverse primer | |
| P4: 1147 | GCTCTTATCACAGTCTCCAAA | RT-PCR forward primer | |
| P4: 910 | NASBA P1 primer T7 RNA polymerase tail | ||
| P4: 1088 | NASBA P2 primer ECL detection tail | ||
| PR4: 1045 | GGTTCCAGAYAAWATGGGTCT | HPIV4 capture probe | |
| HPIV4 MB | HPIV4 molecular beacon | ||
| 229E | 229E : 1949 | TAAGGCGTCTTCAATAGT | RT reverse primer |
| 229E : 1872 | CATAAGTGGAGCAATCAA | RT-PCR reverse primer | |
| 229E : 1281 | TTGTATGTTTCTTGGAGT | RT-PCR forward primer | |
| 229E : 1658 | NASBA P1 primer T7 RNA polymerase tail | ||
| 229E : 1391 | NASBA P2 primer ECL detection tail | ||
| PR229E | ACCATCTACTCTATCACTCCT | 229E capture probe | |
| 229E MB | 229E molecular beacon | ||
| RSV A and B | RSV RT | GATCAAAAGTGCTCTACTAT | RT reverse primer |
| RSV RT+ | GATCAAAAGTGCTCTACTAT | RT-PCR reverse primer | |
| RSV RT- | AGTTTTGCCATAGCATGACA | RT-PCR forward primer | |
| RSV T7 A+B | NASBA P1 primer T7 RNA polymerase tail | ||
| RSV ECL (A) | NASBA P2 primer ECL detection tail | ||
| RSV ECL (B) | NASBA P2 primer ECL detection tail | ||
| RSV A+B BIO | CDGAGCTGCTTAYRTCTGTTT | RSV A and B capture probe | |
| RSV MB A+B | RSVA and B molecular beacon | ||
| Influenza A | Flu A RT | AGCAGGGTAGATAATCACTC | RT reverse primer |
| Flu A RT+ | AGCAGGGTAGATAATCACTC | RT-PCR reverse primer | |
| Flu A RT− | TTGTGCHGCTGTTTGRAATT | RT-PCR forward primer | |
| Flu A T7 | NASBA P1 primer T7 RNA polymerase tail | ||
| Flu A ECL | NASBA P2 primer ECL detection tail | ||
| Flu A Bio | TAAGAYCGTTTGGTGCCTTG | Influenza A capture probe | |
| Flu A MB | Influenza A molecular beacon | ||
| Influenza B | Flu B RT pol | ACACAATGGCAGAATTTAGTG | RT reverse primer |
| Flu B RT+ | ATCCTGAAYTACARCCAGCA | RT-PCR reverse primer | |
| Flu B RT− | AGGTCCYCCCATTTCAACTT | RT-PCR forward primer | |
| Flu B pol T7 | NASBA P1 primer T7 RNA polymerase tail | ||
| Flu B pol ECL | NASBA P2 primer ECL detection tail | ||
| Flu B pol Bio | CCTTGTCCTTCTAATGCTGTAT | Influenza B capture probe | |
| Flu B pol MB | Influenza B molecular beacon | ||
| HRV | HRVJ P1 | AATTCTAATACGACTCACTATAGGGAGACCAMYWTTYTGYSTWGAWAC | NASBA P1 primer T7 RNA polymerase tail |
| HRVJ P2 | GATGCAAGGTCGCATATGAGCTCCGGCCCCTGAATGYGGCT | NASBA P2 primer ECL detection tail | |
| HRVJ Pro | GAYGGGACCRACTACTTTGG | HRV capture probe | |
| HRVJMB-FAM | HRV molecular beacon FAM | ||
| HRV X PR1 | CGCGCAAGTCCGTGGCGGAA | HRV cross primer 1 | |
| HRV X PR2 | TGGGYAACTCTGCAGCGGAA | HRV cross primer 2 | |
| HRV X PR3 | CGGGCAACTCTGCAGCGGAA | HRV cross primer 3 |
Demographics of patients who enrolled in the study and those who declined to join
| Patients enrolled in study ( | Patients who declined to join the study ( | |
|---|---|---|
| Median age in years (range) | 9 (0–18) | 7 (0–18) |
| M:F ratio | 2.9:1 | 1.2:1 |
| % of F508 homozygous⁎⁎ | 46 | 50 |
| % of F508 heterozygotes⁎⁎⁎ | 49 | 41 |
| % of FEV1 > 80% | 69# | 70## |
| % of | 21 | 18 |
| % of Staph colonisation | 10 | 15 |
⁎⁎denotes percentage of delta F508 homozygous in Caucasian population only.
⁎⁎⁎denotes percentage of delta F508 heterozygote in Caucasian population only.
#51 patients out of 71 in the SNOT population were greater than 5 years of age who were able to perform lung function.
## 40 out of 80 patients who declined to join the study were greater than 5 years of age who were able to perform lung function test.
Respiratory viral detection in different sample types
| Virus | Number detected (%) | Odds ratio | ||
|---|---|---|---|---|
| Routine, | Exacerbation, | |||
| FLU A | 2 (1.5%) | 11 (8.0%) | 0.1723 | |
| RSV | 3 (2.2%) | 4 (2.9%) | 1.000 | 0.7556 |
| PIV 1 | 1 (0.7%) | 2 (1.4%) | 1.000 | 0.5037 |
| PIV 2 | 2 (1.5%) | 1 (0.7%) | 0.621 | 2.015 |
| PIV 3 | 0 (0.0%) | 1 (0.7%) | 1.000 | 0.3358 |
| PIV 4 | 5 (3.7%) | 11 (8.0%) | 0.130 | 0.4407 |
| FLU B | 0 (0.0%) | 10 (7.2%) | 0.045 | |
| Rhinovirus | 10 (7.4%) | 22 (15.9%) | 0.4185 | |
| Coronavirus | 2 (1.5%) | 1 (0.7%) | 0.621 | 2.015 |
| Any | 24 (17.6%) | 50 (36.2%) | ||
| 25 | 63 | |||
| 136 | 138 | |||
| 18.3% | 46% | |||
(“Any” in the table refers to the number of samples that contained one or more virus of any type.) ⁎p-values are for Chi-squared tests in the case of FLU A, PIV4, RHINO and ANY and Fisher's exact test for all other variables, since expected counts were low.