Anaplasma platys in dogs, Chile.

We conducted a 16S rRNA nested PCR for the genus Ehrlichia and Ehrlichia spp. with blood samples from 30 ill dogs in Chile. Phylogenetic analysis was performed by using groESL gene amplification. We identified Anaplasma platys as 1 of the etiologic agents of canine ehrlichiosis.

Ehrlichioses are recognized as important emerging tickborne diseases in humans and wild and domestic animals. The brown dog tick, Rhipicephalus sanguineus, is the main tick that infests dogs in Chile (). This tick species is a vector of Ehrlichia canis and has been implicated, but not confirmed, as a vector of Anaplasma platys (). Serologic and clinical evidence of canine ehrlichiosis and serologic evidence of human ehrlichiosis have been reported in Chile (,). The purpose of this study was to identify the etiologic agent of canine ehrlichiosis in Chile.

The Study

Blood samples were obtained from 30 pet dogs seen in a private veterinary clinic in Santiago, Chile, with tick infestation and clinical signs compatible with ehrlichiosis (hemorrhagic manifestations and thrombocytopenia). We performed a nested PCR to amplify a portion of the 16S rRNA gene by using specific primers for the genus Ehrlichia and for Ehrlichia spp. DNA was extracted from 300 μL of whole blood by using the Wizard Genomic DNA Purification kit (Promega, Madison, WI, USA). For Ehrlichia genus–specific PCR, 2.5 μL of DNA was amplified by using outer primers EHR-OUT1 and EHR-OUT2 and inner primers GE2F and EHRL3-IP2 in 1 reaction with a final volume of 25 μL () (Table 1).

Table 1

Ehrlichia/Anaplasma spp. PCR primers used in this study

Ehrlichia/Anaplasma spp. (primer type)	Primer	Primer sequence (5′→3′)	Region	Reference
Ehrlichia spp., A. phagocytophilum, E. canis, E. chaffeensis, E. ewingii, A. platys (outer)	EHR-OUT1	CTGGCGGCAAGCCTAACACATGCCAACAT	16S rRNA	(5)
	EHR-OUT2	GCTCGTTGCGGGACTTAACCCAACATCTCACGAC	16S rRNA	(5)
Ehrlichia spp. (inner)	GE2F	GTTAGTGGCATACGGGTGAAT	16S rRNA	(5)
	EHRL3-IP2	TCATCTAATAGCGATAAATC	16S rRNA	(5)
A. phagocytophilum (inner)	ge9f	AACGGATTATTCTTTATAGCTTGCT	16S rRNA	(6)
	ge2	GGCAGTATTAAAAGCAGCTCCAGG	16S rRNA	(6)
E. canis, E. chaffeensis, E. ewingii (inner)	HE3-R	CTTCTATAGGTACCGTCATTATCTTCCCTAT	16S rRNA	(5)
E. canis (inner)	E. canis	CAATTATTTATAGCCTCTGGCTATAGGAA	16S rRNA	(5)
E. chaffeensis (inner)	E. chaffeensis	CAATTGCTTATAACCTTTTGGTTATAAATA	16S rRNA	(5)
E. ewingii (inner)	E. ewingii	CAATTCCTAAATAGTCTCTGACTATT	16S rRNA	(5)
E. equi (inner)	E. equi-3-IP2	GTCGAACGGATTATTCTTTATAGCTTG	16S rRNA	(5)
E. platys (inner)	EHRL3-IP2	TCATCTAATAGCGATAAATC	16S rRNA	(5,7)
	E. platys	GATTTTTGTCGTAGCTTGCTA	16S rRNA	(7)
E. platys (outer)	EEgro1F	GAGTTCGACGGTAAGAAGTTCA	groESL	(8)
	EEgro2R	CAGCGTCGTTCTTACTAGGAAC	groESL	(8)
A. platys (inner)	SQ3F	ATTAGCAAGCCTTATGGGTC	groESL	(9)
	SQ5F	TCAGTGTGTGAAGGAAGTTG	groESL	(9)
	SQ4R	CTTTAGGCTATCAAGAGATG	groESL	(9)
	SQ6R	TGCTTCCTATGTTCTTATCG	groESL	(9)

The first-round amplification included 20 cycles of denaturation at 94°C for 45 s, annealing at 72°C for 1.5 min, and chain extension at 72°C for 1.5 min. The second-round amplification included 50 cycles of denaturation at 94°C for 45 s, annealing at 50°C for 1 min, and chain extension at 72°C for 1 min, followed by a final extension at 72°C for 5 min. Amplification products were analyzed by agarose gel electrophoresis. The expected size of the amplification product was 120 bp. A. phagocytophilum DNA was used as a positive control (provided by Didier Raoult). For Ehrlichia spp.–specific amplification, we used the same set of outer primers for Anaplasmataceae and specific inner primers for A. phagocytophilum (), E. chaffeensis, E. ewingii, and E. canis () (Table 1). For A. platys amplification, we used inner primers developed by Kordick et al. (EHRL3-IP2–E. platys) () (Table 1). Expected sizes of amplification products were 546, 395, 395, 389, and 151 bp, respectively.

The Ehrlichia genus PCR resulted in the expected DNA band in 6 of 30 dogs (dogs 7, 12, 17, 19, 23, and 25). These 6 samples were positive only for A. platys, showing the expected 151-bp product, and negative for other species tested (Figure 1, panel A). A. platys PCR was also conducted on the remaining 24 Ehrlichia-negative samples; none were positive.

Figure 1

A) Anaplasma platys nested PCR products of 30 blood samples from dogs in Chile. Positive samples from dogs 7, 12, 17, 19, 23, and 25 are indicated by a 150-bp band. –, PCR-negative control; dog 13, negative control; M, 50-bp DNA ladder. Value on the right is in basepairs. B) Second-round A. platys groESL nested PCR products of dog DNA samples with 3 sets of primers. Group A, SQ5F/SQ4R (790 bp); group B, SQ3F/SQ4R (1,170 bp); group C, SQ3F/SQ6R (360 bp). M, GeneRuler 1-kb DNA ladder (Fermentas, Hanover, MD, USA); Dog 13, negative control; –, PCR-negative control. Values on the left are in basepairs.

DNA obtained from 3 16S rRNA PCR products (dogs 7, 17, and 25) was purified by using a commercial kit (Rapid Gel Extraction System; Marligen Biosciences, Ljamsville, Germany) and sequenced twice with an ABI 3100 genetic analyzer (Model 3100; Applied Biosystems, Foster City, CA, USA). The 16S rRNA sequences obtained were compared by using BLAST (www.ncbi.nlm.nih.gov/blast) with sequences available at GenBank. Sequences obtained were similar to that of A. platys strain Okinawa 1 (GenBank accession no. AF536828), with similarities of 98%, 95%, and 98%, respectively. GenBank accession nos. for 16S rRNA sequences of A. platys strains obtained in this study are DQ125260 and DQ125261, which correspond to strains from dogs 7 and 17, respectively.

For phylogenetic analysis, the groESL gene of A. platys was amplified from samples positive for A. platys 16S rRNA that had sufficient amounts of DNA (dogs 17, 23, and 25) and from 1 negative sample (dog 13). Reactions contained 2 μL of purified DNA as template in a total volume of 25 μL. Amplifications contained 1.25 U Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), 3 mmol/L MgCl2, 2.5 mmol/L deoxynucleotide triphosphates (Invitrogen), and 0.2 pmol/L of primers EEgro1F and EEgro2R () (Table 1). DNA was denatured by heating at 95°C for 10 min. PCR amplification included 40 cycles of denaturation at 95°C for 1.5 min, annealing at 52°C for 2 min, and extension at 72°C for 1.5 min, followed by a final extension at 72°C for 10 min. For nested amplifications, 1 μL of primary PCR products was used as the template in a total volume of 25 μL. Reaction conditions were the same as for primary amplifications. The primers used were SQ3F, SQ5F, SQ4R, and SQ6R () (Table 1). PCR products were analyzed by 1.5% agarose gel electrophoresis.

We amplified 3 overlapping fragments (790, 1,170, and 360 bp) in 3 16S rRNA–positive samples (Figure 1, panel B). These DNAs were purified by using a commercial kit (Rapid Gel Extraction System; Marligen), sequenced, and analyzed for phylogenetic relationships. Multiple alignment analysis was performed with the ClustalW program (www.ebi.ac.uk/clustalw). Calculation of distance matrices and construction of a phylogenetic tree were made with MEGA 3.1 software (www.megasoftware.net). A phylogenetic tree was constructed by the neighbor-joining method and distance matrices for the aligned sequences were calculated by using the Kimura 2-parameter method. Stability of the tree was estimated by bootstrap analysis of 1,000 replications. A final sequence of 686 bp obtained from the overlapping fragments was used for comparison and showed 100% identity between the 3 Chilean sequences and 99.8% similarity with sequences of the A. platys groESL gene deposited in GenBank (Table 2). Phylogenetic relationships of Chilean A. platys strains with other Anaplasmataceae species are shown in Figure 2. GenBank accession no. for the groESL gene sequence of A. platys is EF201806 (corresponding to dogs 17, 23, and 25).

Table 2

Nucleotide sequence differences among groESL genes from different strains of Anaplasma platys

Strain	Similarity,* %	Nucleotide position†
		591	1259	1271
A. platys Sommieres	100	G	A	C
A. platys Lara	100	–	–	–
A. platys RDC	100	–	–	–
A. platys Okinawa	100	–	–	–
A. platys Louisiana	99.7	–	G	T
Dog 17	99.8	T	–	–
Dog 23	99.8	T	–	–
Dog 25	99.8	T	–	–

*Percentages of nucleotide sequence identities for 686-bp region determined from pairwise alignment.
†Nucleotide positions of A. platys Sommieres strain, GenBank accession no. AY0441621. –, same base as the type strain.

Figure 2

Phylogenetic relationship between 3 Chilean Anaplasma platys strains and other strains of the families Rickettsiaceae and Anaplasmataceae based on the groESL gene nucleotide sequences. GenBank accession nos. of groESL sequences used to construct the phylogenetic tree were the following: A. platys France Sommieres AY044161; A. platys Lara Venezuelan dog AF399916; A. platys from Rhipicephalus sanguineus ticks in the Democratic Republic of Congo AF478129; A. platys from a dog in Okinawa, Japan AY077621; A. platys from a dog in Louisiana, USA AY008300; A. marginale AF165812; Ehrlichia equi AF172162; E. phagocytophyla U96729; E. chaffeensis L10917; E. canis U96731; E. muris AF210459; Ehrlichia sp. from Ixodes ovatus AB032711; E. ruminantium U13638; Neorickettsia risticii U96732; N. sennetsu U88092; Rickettsia prowazekii Y15783; and Bartonella henselae U96734. Scale bar at the lower left indicates 0.05 substitutions per nucleotide.

Conclusions

We identified A. platys DNA in the blood of 6 dogs with clinical signs indicative of ehrlichiosis. These findings support the conclusion that A. platys is an etiologic agent of canine ehrlichiosis in Chile.

Since its first report in the United States in 1978 (), A. platys has been described in several countries as the etiologic agent of cyclic thrombocytopenia in dogs. A tick vector of A. platys has not been determined, although R. sanguineus is the most suspected species (). Because R. sanguineus is the only tick species that infests dogs in Santiago (), our results support the conclusion that this species is the vector of A. platys in Chile.

A wide range of clinical manifestations of canine cyclic thrombocytopenia has been described. Cases from the United States have been described as mild or asymptomatic (), and cases from Spain have more severe symptoms (), which also seems to be the case in Chile. This variability in clinical symptoms of infection has not been clearly associated with strain variations (–).

Low diversity was observed when groESL gene sequences of Chilean strains were compared with other A. platys strains available in GenBank. This finding has also been observed in strains from different geographic origins (). Recent studies have shown more genetic variability when sequences of the gltA gene were used (,).

Evidence of the zoonotic potential of A. platys is scarce. In Venezuela, a few symptomatic human cases have been diagnosed since 1992 by the presence of platelet morulae in blood smears (). Monocytic and platelet morulae were reported in a 17-month-old girl with fever and rash (). However, none of these cases have been confirmed by molecular assays. Further studies that investigate the pathogenic and zoonotic role of A. platys should be conducted.