Literature DB >> 17963498

Missense mutations in desmocollin-2 N-terminus, associated with arrhythmogenic right ventricular cardiomyopathy, affect intracellular localization of desmocollin-2 in vitro.

Giorgia Beffagna1, Marzia De Bortoli, Andrea Nava, Michela Salamon, Alessandra Lorenzon, Manuela Zaccolo, Luisa Mancuso, Luca Sigalotti, Barbara Bauce, Gianluca Occhi, Cristina Basso, Gerolamo Lanfranchi, Jeffrey A Towbin, Gaetano Thiene, Gian Antonio Danieli, Alessandra Rampazzo.   

Abstract

BACKGROUND: Mutations in genes encoding desmosomal proteins have been reported to cause arrhythmogenic right ventricular cardiomyopathy (ARVC), an autosomal dominant disease characterised by progressive myocardial atrophy with fibro-fatty replacement. We screened 54 ARVC probands for mutations in desmocollin-2 (DSC2), the only desmocollin isoform expressed in cardiac tissue.
METHODS: Mutation screening was performed by denaturing high-performance liquid chromatography and direct sequencing. To evaluate the pathogenic potentials of the DSC2 mutations detected in patients affected with ARVC, full-length wild-type and mutated cDNAs were cloned in eukaryotic expression vectors to obtain a fusion protein with green fluorescence protein (GFP); constructs were transfected in neonatal rat cardiomyocytes and in HL-1 cells.
RESULTS: We identified two heterozygous mutations (c.304G>A (p.E102K) and c.1034T>C (p.I345T)) in two probands and in four family members. The two mutations p.E102K and p.I345T map to the N-terminal region, relevant to adhesive interactions. In vitro functional studies demonstrated that, unlike wild-type DSC2, the two N-terminal mutants are predominantly localised in the cytoplasm.
CONCLUSION: The two missense mutations in the N-terminal domain affect the normal localisation of DSC2, thus suggesting the potential pathogenic effect of the reported mutations. Identification of additional DSC2 mutations associated with ARVC may result in increased diagnostic accuracy with implications for genetic counseling.

Entities:  

Mesh:

Substances:

Year:  2007        PMID: 17963498      PMCID: PMC2190757          DOI: 10.1186/1471-2350-8-65

Source DB:  PubMed          Journal:  BMC Med Genet        ISSN: 1471-2350            Impact factor:   2.103


Background

Arrhythmogenic right ventricular cardiomyopathy (ARVC) (MIM #107970) is a myocardial disease in which myocardium of the right ventricular free wall is partially or almost entirely replaced by fibro-fatty tissue [1], leading to structural and functional abnormalities of the right ventricle, electrocardiographic depolarization/repolarization changes and arrhythmias of right ventricular origin [2]. Clinical symptoms are manifested in the early adulthood. The disease is transmitted as an autosomal dominant trait with reduced penetrance. Although pathogenic mutations underlying ARVC were detected in RyR2 (cardiac ryanodine receptor) [3] and in TGFβ3 (transforming growth factor-β3) [4] genes, finding mutations in genes encoding desmosomal proteins, namely Desmoplakin (DSP), Plakophilin-2 (PKP2) and Desmoglein-2 (DSG2) [5-7] led to current idea that ARVC is due to desmosomal dysfunction [8]. This was further strengthened by two recent studies that reported mutations in the desmosomal desmocollin-2 (DSC2) gene as the cause of ARVC [9,10]. Actually, also the autosomal recessive form of ARVC, known as Naxos syndrome, associated with palmoplantar keratoderma and peculiar woolly hairs (MIM #601214) is due to mutation in the desmosomal protein Plakoglobin (JUP) [11]. Moreover, intercalated discs ultrastructural abnormalities consisting of decreased desmosome number and intercellular gap widening were observed in ARVC biopsy samples [12]. Desmosomes anchor stress-bearing intermediate filaments at sites of strong intercellular adhesion; the resulting scaffold plays a key role in providing mechanical integrity of tissues which undergo high mechanical stress, such as epidermis and heart [13]. Desmosomes include proteins from at least three distinct gene families: cadherins, armadillo proteins and plakins [14]. Desmosomal cadherins include DSGs and DSCs; members of both subfamilies are single-pass transmembrane glycoproteins, mediating Ca2+-dependent cell-cell adhesion. We report here two novel mutations of the DSC2 gene detected in patients affected with ARVC and their functional characterization.

Methods

Clinical evaluation

Clinical diagnosis of ARVC was based on major and minor criteria established by the European Society of Cardiology/International Society and Federation of Cardiology Task Force [15]. The study involved a cohort of 54 patients of Italian descent. Each patient underwent cardiological examination. The clinical study protocol included 12-lead electrocardiogram (ECG), signal-averaged ECG (SAECG), 24-hour Holter ECG, and 2-dimensional echocardiography, performed according to previously reported methods [2]. All clinical investigations and blood sampling for DNA analysis were performed under informed consent, according to the pertinent Italian legislation and in compliance with Helsinki declaration.

Mutation screening

Fifty-four Italian probands (33 males and 21 females), which proved negative for mutations of DSP, PKP2, DSG2 and TGFβ3 genes, were screened for DSC2 mutations by denaturing high-performance liquid chromatography (DHPLC) and direct sequencing. Primers flanking each exon of the human DSC2 gene were designed by PRIMER3. PCR amplifications were performed in a final volume of 25 μl, containing 50 ng of genomic DNA, 400 nmol/l of each primer (Sigma Genosys), 100 μmol/l of each dNTP, 1.5 μmol/l MgCl2, and 0.8 U of Taq DNA Polymerase (TaqGold, Applied Biosystems). PCR primers and DHPLC conditions are reported in Table 1. DHPLC analysis was performed with the use of WAVE Nucleic Acid Fragment Analysis System 3500 HT (Transgenomic Ltd NE, USA). Samples showing a change in DHPLC pattern were directly sequenced. DSC2 sequences were compared to reference sequence NM_024422.
Table 1

PCR primers and conditions for DHPLC analysis of DSC2 gene

EXONbpT°C DHPLCForward 5' 3'Reverse 5' 3'
1+5'UTR708Direct sequencingTCAGACCTCGCTCTGTAATTGATATCCCCGTTCCCCTAGTTT
2199Direct sequencingACACATTAAAGTTTTCTTTTTATGGCGTATATGTACCACAGCA
340054,8/55,4CCCCACGTGCATACATTACTTGGTTTTCATTCGTCTTTAAGC
426955,6/58.5CCCCTACCCAGCTAATCCTCGGAAACTATAGACTCCCACAGCA
533256,5/57,2TGAAAGCTCTGCTGAAATAAAGAGGAGTAGCCAGAGCATTGGT
626654.7GCCAAAATGAATTTGAAGCATACTTGAAACACAGTTAATTTGCCATA
738455/58/59,5CATAGAACATGTGAATGTTTTGGACAAAACCAGCATACTCCAAGG
825254,3/55.6GTTGGTGCTTTCCCCCAATAAGGCCAGAGATGTGCATATTA
932452.2/53.5/55.3CATCGTGTTCAATTTTTGTGACCTTTCTTTCCATTAAATTCTAGC
1037456,5/57,9ACTCGTTAGCATTGCCAAATTAACGTAACAAAATAAGCTA
1137551,7/56CAAGAAGTAGCAGTGGCATAAGGAACAGAGTGCATGTATCCAGCTT
1234557/58/59GTGTTCAGTGCATACTTTTGTGGGCAGACATCCTGATGTTGAAAA
1335657,2/58TGTTCAGAAGAAATCAGTGACAGTGTCTTGAAAGTTACTTTAAAGG
1426357.7GATTTATGTGTGTATTAACCATTGCGCATTATAAGCGAATTCATCC
15a 19456.2/60.6/61.8CATAATTTTGTGTTCCTCTCTGTAGGATTCCGAGGTCTGGTGT
b 33261/61,4/62,2GGCTTCACAACCCAAACTGTTGAAAATTATAGTCAGAATCCAGT
15'22653,7/55,2GCCACATGCGTGACTTTTAGACTTTCTGCCAAGGGGAAAA
1639756,3/56,8CAATGAAAGGTAAATCAAAGCAAAAAAACCCCCACAAATAGCA
PCR primers and conditions for DHPLC analysis of DSC2 gene A control group of 250 healthy and unrelated subjects (500 chromosomes) from Italian population was used for assessing possible polymorphism of detected DNA variants. All controls were matched to the probands by ancestry. Presence of the missense mutations p.E102K and p.I345T was confirmed by restriction digest of PCR amplicons with TspR1 restriction enzyme (NEW ENGLAND BioLabs).

Cell cultures

Cardiac ventricular myocytes from one to three days old Crl:(WI)BR-Wistar rats (Charles River Laboratories, Wilmington, MA) were prepared as previously described [16]. All animal procedures were followed according to institutional guidelines. HL-1 cardiac myocytes were maintained as previously reported [17].

Plasmid construction

The cDNA of human DSC2a was kindly provided by Dr W.W. Franke (Heidelberg, Germany) and human DSC2a full-length coding sequence (GenBank NM_024422) was PCR-amplified with the following primers: DSC2a-clonF: ATTATGGAGGCAGCCCGCCC; DSC2a-clonR: GTCTCTTCATGCATGCTTCTGCTAG. The resulting fragment was cloned into pcDNA3.1/CT-GFP-topo eukaryotic expression vector (Invitrogen) which contains cDNA coding for green fluorescent protein (GFP), and verified by sequence analysis.

Site directed mutagenesis

Site-directed mutagenesis was performed on DSC2a-pcDNA3.1/CT-GFP, in order to reproduce two DSC2 naturally occurring mutations: p.E102K (EF017811), and p.I345T (EF017812). We used the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene) and the following mutagenic primers: E102K-F: TACCATATTACTTTCCAACACTAAGAACCAAGAAAAGAAGAAAAT; E102K-R: ATTTTCTTCTTTTCTTGGTTCTTAGTGTTGGAAAGTAATATGGTA; I345T-F: CAACTTCAACTTGTATCATTAACACTGATGATGTAAATGACCACTTGC; I345T-R: GCAAGTGGTCATTTACATCATCAGTGTTAATGATACAAGTTGAAGTTG. All clones were verified by sequence analysis.

Transfection of neonatal rat cardiomyocytes and HL-1 cells with wild-type and mutant DSC2a-pcDNA3.1/CT

After 1 day in culture, cardiomyocytes were transfected with 3 μg of plasmid DNA per well and 8 μl of transfection reagent (transfectin lipid reagent Biorad). After 24 hours of transfection, cells were fixed for 20 minutes with 4% paraformaldehyde in phosphate-buffered saline, and then permeabilized with 0.1% Triton X-100 for 10 minutes. HL-1 cells were transfected with 0.8 μg of plasmid DNA per plate, 6.4 μl of enhancer reagent, and 8 μl of effectene reagent (Qiagen). At 48 hours post-transfection, HL-1 cells were fixed with cold methanol/acetone (1:1) for 20 minutes at -20°C. Each set of subsequent experiments was performed in triplicate in 24 mm glass coverslips and was repeated 3 times.

Immunostaining and confocal imaging on neonatal rat cardiomyocytes and HL-1 cells

Neonatal rat cardiomyocytes were stained with anti-alpha actinin antibody (Sigma) for two hours at room temperature, washed three times with PBS and incubated with Alexa fluor 543-conjugated antimouse antibody (Molecular Probes, Eugene, Ore). HL-1 cells were incubated with the murine mAb (clone DG3.10) against bovine dsg (PROGEN, Heidelberg, Germany), which reacts with a carboxy terminal epitope of desmoglein for 30 min at 37°C, washed three times with PBS, and incubated with TRITC conjugated antibodies (DAKO). Slides were inspected and photographed using a Radiance 2000 confocal microscope (BioRad) with a 60× oil objective.

Results

Genetic analysis

Exon-by-exon analysis of coding sequences of DSC2 gene was performed on genomic DNA of 54 ARVC probands negative for mutation screening of genes known to be associated with ARVC. Two heterozygous point substitutions c.304G>A and c.1034T>C were detected in two patients (Figure 1). None of the detected nucleotide changes was found in a control group of 250 healthy and unrelated subjects (500 control chromosomes) from Italian population. Mutations were confirmed by restriction digest.
Figure 1

a) Evolutionary conservation of the DSC2 missense mutations p.E102K and p.I345T among 7 species: H. sapiens (AAH63291.1), C. familiaris (CAA05309.1), predicted B. taurus (XP_615164.2), predicted M. mulatta (XP_001102096.1), predicted P. troglodytes (XP_512077.2), M. musculus (AAH57867.1) and R. norvegicus (NP_001028860.1). The mutated amino acids are coloured, and the identities across species are indicated by a different background. b) Pedigrees of ARVC probands carrying DSC2 mutations. Black, white, and grey symbols represent clinically affected individuals, unaffected individuals, and individuals of unknown disease status, respectively. SD indicates sudden death. Presence (*) or absence (-) of the DSC2 mutation is indicated. Arrows indicate index cases. Sequence electropherograms, on the right side of the pedigrees, show the two DSC2 missense mutations (c.304G>A (p.E102K) and c.1034T>C (p.I345T)). Numbering of the nucleotides starts at ATG and refers to GenBank Accession number NM_024422.

a) Evolutionary conservation of the DSC2 missense mutations p.E102K and p.I345T among 7 species: H. sapiens (AAH63291.1), C. familiaris (CAA05309.1), predicted B. taurus (XP_615164.2), predicted M. mulatta (XP_001102096.1), predicted P. troglodytes (XP_512077.2), M. musculus (AAH57867.1) and R. norvegicus (NP_001028860.1). The mutated amino acids are coloured, and the identities across species are indicated by a different background. b) Pedigrees of ARVC probands carrying DSC2 mutations. Black, white, and grey symbols represent clinically affected individuals, unaffected individuals, and individuals of unknown disease status, respectively. SD indicates sudden death. Presence (*) or absence (-) of the DSC2 mutation is indicated. Arrows indicate index cases. Sequence electropherograms, on the right side of the pedigrees, show the two DSC2 missense mutations (c.304G>A (p.E102K) and c.1034T>C (p.I345T)). Numbering of the nucleotides starts at ATG and refers to GenBank Accession number NM_024422. Variations c.304G>A and c.1034T>C result in predicted p.E102K and p.I345T amino acid substitutions. The mutated amino acids had completely different physico-chemical properties when compared to the wild type. Mutation p.E102K replaced a negatively-charged residue by a positively-charged one, whereas mutation p.I345T replaced a non polar hydrophobic amino acid by a polar hydrophilic amino acid. Mutation p.E102K is located in the propeptide domain, whereas mutation p.I345T is located in the second extracellular cadherin (EC2) domain and altered the third amino acid of the EC domain consensus sequence [L/I/V-x-L/I/V-x-D-x-N-D-N/H-x-P] [18]. Cadherin domains are important for adhesive interactions and form Ca2+ dependent rodlike structures. Both these changes occurred in a residue highly conserved among species (Figure 1a), although in mouse and rat dsc2 protein, E102 is replaced by aspartic acid. However, these two amino acids show very similar physico-chemical properties.

Clinical findings

Main clinical findings of patients carrying DSC2 mutations are reported in Table 2.
Table 2

Clinical and genetic findings in DSC2 mutation carriers

Proband# (Family #)SexAge at diagnosis/Last follow-upFamily history12-lead ECGSAECGArrhythmiasRV size/functionLV involvDiagnostic criteriaNucleotide changeAA changeGenBank accession number
MajorMinorNegative T waves preocordial leadsNegative T waves inferior leadsIncomRBBBEpsilon wavePVCs >1000/24 h NSVTLBBB SVTVFMajorMinor

I1 (Fam149)M58-+-----------1 mc.304G>Ap.E102KEF017811
II1 (Fam149)M22-+--+------+-3 mc.304G>Ap.E102KEF017811
II2 (Fam149)M19----+-++--+-+1 M/3 mc.304G>Ap.E102KEF017811
II3 (Fam149)M25-+---------+-2 mc.304G>Ap.E102KEF017811
II1 (Fam170)M50-+V4–V6--++-+-+-+2 M/3 mc.1034T>Cp.I345TEF017812
III2 (Fam170)F15-+---------+-2 mc.1034T>Cp.I345TEF017812

LBBB indicates left bundle-branch block; LV, left ventricular; NSVT, nonsustained ventricular tachycardia; RV, right ventricular; SVT, sustained ventricular tachycardia; VF, ventricular fibrillation; and M, major diagnostic criteria, m, minor diagnostic criteria

Clinical and genetic findings in DSC2 mutation carriers LBBB indicates left bundle-branch block; LV, left ventricular; NSVT, nonsustained ventricular tachycardia; RV, right ventricular; SVT, sustained ventricular tachycardia; VF, ventricular fibrillation; and M, major diagnostic criteria, m, minor diagnostic criteria

p.E102K

The proband (II,2, Fam #149) (Figure 1b) was examined at the age of 19 years due to premature ventricular beats with left bundle branch block morphology. The ECG showed the presence of incomplete right bundle branch block, whereas late potentials were present at 40–80 filter setting. Two-D echocardiogram demonstrated a dilated right ventricle with kinetic abnormalities and decreased ejection fraction. The left ventricle was dilated as well. His father and the two brothers carrying the same missense mutation did not fulfilled the current diagnostic criteria for ARVC.

p.I345T

The proband (II,1, Fam #170) (Figure 1b) was diagnosed at the age of 50 years, due to a sustained VT episode for which he received an implantable cardioverter defibrillator. The 12-lead ECG showed negative T wave in V4–V6, whereas late potentials were present at 40–80/250 filters. Two-D echocardiogram demonstrated a right ventricular enlargement with moderately depressed ejection fraction; the left ventricle was segmentary involved. The 15 years-old daughter, who did not show any arrhythmic symptom, was found to carry the same DSC2 mutation. The 2D-echocardiogram revealed mild right ventricular abnormalities, whereas 12-lead ECG was normal. All family members not carrying DSC2 mutations were negative at clinical investigation.

Functional Analysis of N-terminal Mutant Desmocollins

To evaluate the pathogenic potentials of the DSC2 missense mutations reported in the present study, full-length wild-type cDNA was directionally cloned in eukaryotic expression vector to obtain a fusion protein with GFP. Mutated proteins carrying p.E102K and p.I345T were obtained by site directed mutagenesis of the wild-type construct. Constructs were transfected in neonatal rat cardiomyocytes and in the desmosome-forming cell line HL-1. In neonatal rat cardiomyocytes, wild-type fusion protein was localised at the cell membrane, only at the interface between two neighbouring cells (Figure 2, panel A). By contrast, protein carrying the p.E102K mutation was distributed in dots both in the membrane and in the cytoplasm (Figure 2, panel B), whereas protein carrying p.I345T mutation was predominantly localised in the cytoplasm (Figure 2, panel C). Moreover, the membrane localisation of both mutated proteins was not restricted to cell-cell junctions (see arrows in Figure 2 panel B" and C").
Figure 2

Transfection studies in cultured neonatal rat cardiomyocytes (top panels) and HL-1 cells (bottom panels). Note the WT-DSC2a-GFP was localised at the cell membrane between two cardiomyocytes and HL-1 cells (panel A and D), whereas E102K and I345T-DSC2a-GFP were mainly detected in the cytoplasm (panel B, C, E and F). As a reference, in cardiomyocytes immunostaining of the same cells with a monoclonal anti-alpha-actinin (panel A', B' and C') and overlay of the DSC2a-GFP and alpha-actinin staining (panel A", B" and C") are shown. In HL-1 cells immunostaining with monoclonal desmoglein antibody DG 3.10 showed both the presence of well-assembled desmosomes (panel D', E' and F') and the reduced co-localisation between endogenous dsg and mutated DSC2 (yellow dots in panel E", F").

Transfection studies in cultured neonatal rat cardiomyocytes (top panels) and HL-1 cells (bottom panels). Note the WT-DSC2a-GFP was localised at the cell membrane between two cardiomyocytes and HL-1 cells (panel A and D), whereas E102K and I345T-DSC2a-GFP were mainly detected in the cytoplasm (panel B, C, E and F). As a reference, in cardiomyocytes immunostaining of the same cells with a monoclonal anti-alpha-actinin (panel A', B' and C') and overlay of the DSC2a-GFP and alpha-actinin staining (panel A", B" and C") are shown. In HL-1 cells immunostaining with monoclonal desmoglein antibody DG 3.10 showed both the presence of well-assembled desmosomes (panel D', E' and F') and the reduced co-localisation between endogenous dsg and mutated DSC2 (yellow dots in panel E", F"). In transfected HL-1 cells, wild-type fusion protein was detected in the cell membrane, into cell-cell contact regions (Figure 2, panel D), and co-localised with the endogenous dsg, which was marked with monoclonal desmoglein antibody (Figure 2, panel D' and D"). This co-localisation suggests that the wild-type fusion protein has been integrated into normal-appearing desmosomes. p.E102K and p.I345T mutant fusion proteins showed the same distribution observed in neonatal rat cardiomyocytes (Figure 2, panel E and F). In addition, immunostaining with monoclonal desmoglein antibody showed both the presence of well-assembled desmosomes in transfected HL-1 cells (Figure 2, panel E', F') and the reduced co-localisation between endogenous dsg and mutated DSC2 (Figure 2, panel E", F").

Discussion

In the present study, we identified two mutations in DSC2 gene associated with ARVC, a genetically determined heart muscle disease characterized by structural, electrical, and pathological abnormalities of the right ventricle. Thus far, only 3 DSC2 mutations have been reported in ARVC patients [9,10]. On the basis of present data and of those previously reported [9,10], DSC2 mutations account for only a small percentage of ARVC probands. Desmosomal cadherins, DSGs and DSCs, mediate cell-cell adhesion by interacting laterally and transcellularly with each other and by recruiting cytoplasmic plaque proteins which facilitate attachment of intermediate filaments. In particular, DSCs dimerise laterally via homophilic and heterophilic interactions at the cell surface and also make head-to-head contacts across the intercellular gap to form the so-called "adhesive zipper" [19]. Moreover, it has been suggested that DSC2 expressed at cell surface might act as nucleation centres for subsequent assembly of functional desmosomes [20]. Desmocollins bind desmosomal cadherins through their extracellular domains, while the cytoplasmic domains have binding sites for desmosomal plaque proteins. DSCs occur as "a" and "b" splice variants, with the "a" variant having a slightly longer cytoplasmic domain. It has been shown that the "a" variant can support desmosomal assembly [21], but there is no known function for the "b" form. In humans, there are three desmocollin isoforms (DSC1–3); DSC2 is almost ubiquitous in human tissues, but it is the only desmocollin isoform expressed in cardiac tissue [22]. DSC2 is a membrane glycoprotein composed of four highly conserved extracellular subdomains (EC1–4), a more variable extracellular anchor domain (EA), a single transmembrane domain (TM), an intracellular anchor domain (IA) and a cytoplasmic region that can show two different isoforms. Cadherins are synthesized as inactive precursor proteins containing a prosequence followed by the cadherin domains. The N-terminal prosequence is proteolytically cleaved off in the late Golgi and the mature cadherin is then transported to the plasma membrane. Proteolytic removal of the prosequence results in structural rearrangements within EC1 domain with the activation of adhesive properties [23]. Mutation p.E102K alters a conserved amino acid located in the propeptide region. Mutation p.I345T is located in the EC2 domain, which forms, together with EC1, the "minimal essential unit" to mediate cell adhesion, through cis and trans interactions among desmosomal cadherins [24]. In vitro functional studies on neonatal rat cardiomyocytes and on HL-1 cells demonstrate that the two missense mutations in the N-terminal domain affect the normal localisation of DSC2. As previously reported, the wild-type DSC2a-GFP fusion protein was efficiently incorporated into desmosomes and did not exert dominant-negative effect when overexpressed [25]. A lower amount of GFP signal was detected in the cytoplasm, since proteins were still not fully trafficked to the membrane. Unlike wild-type DSC2, the N-terminal mutants were predominantly located in the cytoplasm. Further investigation will be needed to determine whether the mutations could induce "null alleles" potentially leading to haploinsufficiency (i.e. through cytoplasmic degradation) or the mutant proteins could be present in the tissue and act in a dominant fashion (i.e. gain-of-function). While the involvement of genes encoding desmosomal proteins in ARVC suggests that disruption of desmosomal integrity might be among primary molecular defects [8], pathogenetic mechanisms leading to ARVC remain to be elucidated. Recent data from Garcia-Gras et al. on cardiac restricted dsp-deficient mice would point at a novel molecular mechanism through suppression of Wnt/β-catenin signaling by nuclear plakoglobin [26]. DSC2 mutations were detected in two ARVC probands and in four family members who met only minor diagnostic criteria. This is consistent with incomplete penetrance of the disease, as previously reported in ARVC patients family members carrying DSP, PKP2 and DSG2 mutations [7,27-29]. However, due to the young age of most of the family members carrying the DSC2 mutations, we cannot exclude that some of them could later show clinical signs of the disease. None of the probands carrying the pathogenic mutations showed gross skin/hair abnormalities. All DSC isoforms are expressed in the epidermal tissues, whereas DSC2 is the only one expressed in the myocardium. We may hypothesize that compensation by other DSC isoforms might take place in the epidermis but not in the myocardium of DSC2 mutation carriers, thus accounting for the cardiac-specific phenotype.

Conclusion

In conclusion, we identified two novel missense mutations in DSC2 gene associated with ARVC. In vitro functional test demonstrated that N-terminal mutated DSC2 is almost exclusively distributed throughout the cytoplasm, thus suggesting the potential pathogenic effect of the reported mutations. Identification of additional DSC2 mutations associated with ARVC may result in early detection of asymptomatic carriers and in increased diagnostic accuracy in the clinical evaluation of family members.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

GB performed the mutation screening of DSC2 gene in ARVC patients and carried out the in vitro functional studies. MDB, AL and LS set up DHPLC conditions and performed the mutation screening of DSC2 gene in ARVC patients. AN, BB, CB and GT were in charge of the clinical management of all patients. MS and GL performed the transfection experiments on HL-1 cells. MZ and LM performed transfection experiments on neonatal rat cardiomyocytes. GO designed the PCR primers and conditions used in the mutation screening. JT, head of the NIH project that partially funded our studies, organized the collaborative aspect of the project and provided a critical revision of the paper. GAD contributed to the original design of the study and actively participated in the writing of paper. AR supervised and coordinated the whole project and co-wrote the paper with GB. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here:
  29 in total

1.  Clinical expression of plakophilin-2 mutations in familial arrhythmogenic right ventricular cardiomyopathy.

Authors:  Petros Syrris; Deirdre Ward; Angeliki Asimaki; Srijita Sen-Chowdhry; Hatim Y Ebrahim; Alison Evans; Nobuhiko Hitomi; Mark Norman; Antonios Pantazis; Anthony L Shaw; Perry M Elliott; William J McKenna
Journal:  Circulation       Date:  2006-01-16       Impact factor: 29.690

2.  Identification of mutations in the cardiac ryanodine receptor gene in families affected with arrhythmogenic right ventricular cardiomyopathy type 2 (ARVD2).

Authors:  N Tiso; D A Stephan; A Nava; A Bagattin; J M Devaney; F Stanchi; G Larderet; B Brahmbhatt; K Brown; B Bauce; M Muriago; C Basso; G Thiene; G A Danieli; A Rampazzo
Journal:  Hum Mol Genet       Date:  2001-02-01       Impact factor: 6.150

3.  Desmosomal dysfunction due to mutations in desmoplakin causes arrhythmogenic right ventricular dysplasia/cardiomyopathy.

Authors:  Zhao Yang; Neil E Bowles; Steven E Scherer; Michael D Taylor; Debra L Kearney; Shuping Ge; Vyacheslav V Nadvoretskiy; Gilberto DeFreitas; Blasé Carabello; Lois I Brandon; Lisa M Godsel; Kathleen J Green; Jeffrey E Saffitz; Hua Li; Gian Antonio Danieli; Hugh Calkins; Frank Marcus; Jeffrey A Towbin
Journal:  Circ Res       Date:  2006-08-17       Impact factor: 17.367

4.  Identification of a deletion in plakoglobin in arrhythmogenic right ventricular cardiomyopathy with palmoplantar keratoderma and woolly hair (Naxos disease).

Authors:  G McKoy; N Protonotarios; A Crosby; A Tsatsopoulou; A Anastasakis; A Coonar; M Norman; C Baboonian; S Jeffery; W J McKenna
Journal:  Lancet       Date:  2000-06-17       Impact factor: 79.321

5.  Suppression of canonical Wnt/beta-catenin signaling by nuclear plakoglobin recapitulates phenotype of arrhythmogenic right ventricular cardiomyopathy.

Authors:  Eduardo Garcia-Gras; Raffaella Lombardi; Michael J Giocondo; James T Willerson; Michael D Schneider; Dirar S Khoury; Ali J Marian
Journal:  J Clin Invest       Date:  2006-07       Impact factor: 14.808

6.  Plakophilin-2 mutations are the major determinant of familial arrhythmogenic right ventricular dysplasia/cardiomyopathy.

Authors:  J Peter van Tintelen; Mark M Entius; Zahurul A Bhuiyan; Roselie Jongbloed; Ans C P Wiesfeld; Arthur A M Wilde; Jasper van der Smagt; Ludolf G Boven; Marcel M A M Mannens; Irene M van Langen; Robert M W Hofstra; Luuk C Otterspoor; Pieter A F M Doevendans; Luz-Maria Rodriguez; Isabelle C van Gelder; Richard N W Hauer
Journal:  Circulation       Date:  2006-03-27       Impact factor: 29.690

7.  Clinical profile and long-term follow-up of 37 families with arrhythmogenic right ventricular cardiomyopathy.

Authors:  A Nava; B Bauce; C Basso; M Muriago; A Rampazzo; C Villanova; L Daliento; G Buja; D Corrado; G A Danieli; G Thiene
Journal:  J Am Coll Cardiol       Date:  2000-12       Impact factor: 24.094

8.  Clinical profile of four families with arrhythmogenic right ventricular cardiomyopathy caused by dominant desmoplakin mutations.

Authors:  Barbara Bauce; Cristina Basso; Alessandra Rampazzo; Giorgia Beffagna; Luciano Daliento; Gianfranco Frigo; Sandro Malacrida; Luca Settimo; GianAntonio Danieli; Gaetano Thiene; Andrea Nava
Journal:  Eur Heart J       Date:  2005-06-07       Impact factor: 29.983

Review 9.  The cadherin superfamily: diversity in form and function.

Authors:  B D Angst; C Marcozzi; A I Magee
Journal:  J Cell Sci       Date:  2001-02       Impact factor: 5.285

10.  Ultrastructural evidence of intercalated disc remodelling in arrhythmogenic right ventricular cardiomyopathy: an electron microscopy investigation on endomyocardial biopsies.

Authors:  Cristina Basso; Elzbieta Czarnowska; Mila Della Barbera; Barbara Bauce; Giorgia Beffagna; Elzbieta K Wlodarska; Kalliopi Pilichou; Angelo Ramondo; Alessandra Lorenzon; Olgierd Wozniek; Domenico Corrado; Luciano Daliento; Gian Antonio Danieli; Marialuisa Valente; Andrea Nava; Gaetano Thiene; Alessandra Rampazzo
Journal:  Eur Heart J       Date:  2006-06-14       Impact factor: 29.983

View more
  28 in total

Review 1.  Genetic testing for inherited cardiac disease.

Authors:  Arthur A M Wilde; Elijah R Behr
Journal:  Nat Rev Cardiol       Date:  2013-07-30       Impact factor: 32.419

Review 2.  Cell-cell connection to cardiac disease.

Authors:  Farah Sheikh; Robert S Ross; Ju Chen
Journal:  Trends Cardiovasc Med       Date:  2009-08       Impact factor: 6.677

3.  Molecular genetics and pathogenesis of arrhythmogenic right ventricular cardiomyopathy: a disease of cardiac stem cells.

Authors:  Raffaella Lombardi; A J Marian
Journal:  Pediatr Cardiol       Date:  2011-01-26       Impact factor: 1.655

4.  Familial evaluation for diagnosis of arrhythmogenic right ventricular dysplasia.

Authors:  Brian T Palmisano; Jeffrey N Rottman; Quinn S Wells; Thomas G DiSalvo; Charles C Hong
Journal:  Cardiology       Date:  2011-08-04       Impact factor: 1.869

5.  The p.A897KfsX4 frameshift variation in desmocollin-2 is not a causative mutation in arrhythmogenic right ventricular cardiomyopathy.

Authors:  Marzia De Bortoli; Giorgia Beffagna; Barbara Bauce; Alessandra Lorenzon; Gessica Smaniotto; Ilaria Rigato; Martina Calore; Ilena E A Li Mura; Cristina Basso; Gaetano Thiene; Gerolamo Lanfranchi; Gian Antonio Danieli; Andrea Nava; Alessandra Rampazzo
Journal:  Eur J Hum Genet       Date:  2010-03-03       Impact factor: 4.246

Review 6.  Mechanisms of disease: molecular genetics of arrhythmogenic right ventricular dysplasia/cardiomyopathy.

Authors:  Mark M Awad; Hugh Calkins; Daniel P Judge
Journal:  Nat Clin Pract Cardiovasc Med       Date:  2008-04-01

Review 7.  Intercalated discs: cellular adhesion and signaling in heart health and diseases.

Authors:  Guangze Zhao; Ye Qiu; Huifang M Zhang; Decheng Yang
Journal:  Heart Fail Rev       Date:  2019-01       Impact factor: 4.214

8.  Desmosomal molecules in and out of adhering junctions: normal and diseased States of epidermal, cardiac and mesenchymally derived cells.

Authors:  Sebastian Pieperhoff; Mareike Barth; Steffen Rickelt; Werner W Franke
Journal:  Dermatol Res Pract       Date:  2010-06-30

Review 9.  Alterations in cell adhesion proteins and cardiomyopathy.

Authors:  Jifen Li
Journal:  World J Cardiol       Date:  2014-05-26

Review 10.  The junctions that don't fit the scheme: special symmetrical cell-cell junctions of their own kind.

Authors:  Werner W Franke; Steffen Rickelt; Mareike Barth; Sebastian Pieperhoff
Journal:  Cell Tissue Res       Date:  2009-08-14       Impact factor: 5.249

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.