Literature DB >> 17953101

Possible autochthonous malaria from Marseille to Minneapolis.

Barbara Doudier1, Hervé Bogreau, Aaron DeVries, Nicolas Ponçon, William M Stauffer, Didier Fontenille, Christophe Rogier, Philippe Parola.   

Abstract

We report 2 cases of Plasmodium falciparum malaria in southern France in a French woman and an American man of Togolese origin who reported no recent travel to malaria-endemic countries. Both infections occurred after a stay near Marseille, which raises the possibility of autochthonous transmission. Entomologic and genotypic investigations are described.

Entities:  

Mesh:

Year:  2007        PMID: 17953101      PMCID: PMC2828086          DOI: 10.3201/eid1308.070143

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Endemic malaria was eradicated from France during the middle of the past century. However, Plasmodium falciparum malaria has recently been reported in several Western European countries in persons with no history of travel or blood transfusion (–). The most recent case of an autochthonous case of vivax malaria was reported in 2006 in Corsica, where susceptible vectors persist (). In southern France, a favorite destination for tourists, the last malaria cases in patients without any recent travel in malaria-endemic areas were reported in 1994 and 2000 (,). We report 2 cases that occurred in southern France during early spring and early summer 2006.

The Cases

On June 30, 2006, a 41-year-old woman was admitted to the North University Hospital in Marseille, France, with a 12-day history of fever, chills, and diarrhea. She had never traveled outside Europe and had no history of blood transfusion or injection drug use. She was born in Marseille and had lived there her entire life. Her home residence was >20 km from the nearest airport and 10 km from the seaport. The case-patient did not work outside the home and did not report any recreational activities near either location. Her neighborhood included families of Comorian descent. Laboratory testing demonstrated low leukocyte and erythrocyte counts and thrombocytopenia. Peripheral blood smear also demonstrated intra-erythrocytic forms consistent with P. falciparum infection with a parasitemia level of 0.1%. P. falciparum antigen was detected (Test NowICT; Fumouze, Levallois-Perret, France) and subsequently confirmed by PCR. Treatment comprised a 3-day regimen of quinine-clindamycin () and the case-patient recovered. A 34-year-old man with tactile fever, bilateral frontal headache, and diarrhea was examined at a clinic in Minneapolis, Minnesota, on May 1, 2006. This man had lived in Togo, his birth country, all of his life until he emigrated to Minnesota in April 2000. Before becoming ill, he had traveled to Paris and from Paris by train to Marseille on April 7, 2006. Also during this timeframe, he reported a day trip to Camargue (Sorgues, France) where he sustained multiple mosquito bites. On April 24, 2006, he returned to Paris by train and then traveled by air a few hours later to Minneapolis. The first symptoms of malaria developed on April 27. His medical history included 4 episodes of malaria in childhood (none in the past decade) and no blood transfusions. On his last visit to Togo in December 2004, the case-patient had reported no chemoprophylaxis for malaria and had experienced no illness or intervening fevers since that time. Physical examination showed a moderately ill person with hematologic test results indicating thrombocytopenia and intra-erythrocytic ring forms consistent with P. falciparum malaria with a 3% parasitemia level. PCR testing confirmed P. falciparum. He was given 4 tablets of atovoquone-proguanil once a day for 3 days and recovered completely. We conducted entomologic surveillance on July 26, 2006, in and around the first case-patient’s residence in Marseille, 26 days after she became ill. No adult mosquitoes were found in the patient’s home, on external staircases, in cellars located around the patient’s home, or in surrounding buildings. Two pools of standing water were identified: a single pool (1 m2, 2 cm deep) within a cellar in her building and another pool (10 m2, 5 cm deep) located 20 m outside the building. No other containers or places that could collect water were identified. Several Culex theileri larvae were identified in the outdoor pool, but there was no evidence of Anopheles larvae. DNA was extracted from blood samples by using the ENZA blood DNA kit according to the manufacturer’s recommendations (Biofidal, Vaulx en Velin, France) and eluted in 100 µL of elution buffer per 250 µL of whole blood. Microsatellites loci (C4M79, Pf2689, TRAP, Pf2802, 7A11, and C4M69) were genotyped by fluorescent end-labeled PCR. Primers sequence, PCR conditions, and methods for genotyping have been described elsewhere (,). Drug-resistant mutations were genotyped. Genotyping of the 2 isolates demonstrated different alleles for the 6 microsatellite loci. We also observed different alleles from codon 59 (dihydrofolate reductase), 437 (dihydropteroate synthase), and 76 (P. falciparum chloroquine-resistance transporter) (Tables 1, 2).
Table 1

Microsatellite loci genotyping and single nucleotide polymorphism in drug-resistant genes

C4M79Pf2689Pf28027A11C4M69TRAP
Autochthonous 1*1908714188378132
Autochthonous 2†2219513899364149
3D7‡2218713894364137
W2‡18887146109319140

*Patient 1, Plasmodium falciparum diagnosed in France.
†Patient 2, P. falciparum diagnosed in the United States.
‡Two parasite strains (3D7 and W2) were genotyped as a positive control; water was used as a negative control.

Table 2

Two strains of Plasmodium falciparum obtained from 2 patients with no recent travel history in malaria-endemic areas*

Dhfr
Dhps
Pfcrt
51161081645961354058143643776
Autochthonous 1†GCAAACATATGTGCCAAAGCGTCTGCTACA
Autochthonous 2‡ATTGCAAACATACGTGCCAAAGCGTCTGGTAAA
3D7§AATGCAAGCATATGTGCCAAAGCGTCTGGTAAA
W2§ATTGCAAACATACGTTCCAAAGCGTTTGGTACA

*Dhfr, dihydrofolate reductase gene; Dhps, dihydropteroate synthase; Pfcrt, P. falciparum chloroquine-resistance transporter. Underlines indicate positions that can be mutated.
†Patient 1, P. falciparum diagnosed in France.
‡Patient 2, P. falciparum diagnosed in the United States.
§Two parasite strains (3D7 and W2) were genotyped as a positive control; water was used as a negative control.

*Patient 1, Plasmodium falciparum diagnosed in France.
†Patient 2, P. falciparum diagnosed in the United States.
‡Two parasite strains (3D7 and W2) were genotyped as a positive control; water was used as a negative control. *Dhfr, dihydrofolate reductase gene; Dhps, dihydropteroate synthase; Pfcrt, P. falciparum chloroquine-resistance transporter. Underlines indicate positions that can be mutated.
†Patient 1, P. falciparum diagnosed in France.
‡Patient 2, P. falciparum diagnosed in the United States.
§Two parasite strains (3D7 and W2) were genotyped as a positive control; water was used as a negative control.

Conclusions

The World Health Organization defines introduced autochthonous malaria as that acquired by mosquito transmission from an imported case in an area where malaria is not a regular occurrence () In France, it is rare to find P. falciparum in a blood smear from patients who have not traveled to a malaria-endemic area in the previous 12 months. History of transfusion, organ transplantation, intravenous drug use, or mother-to-fetus transmission must also be excluded (). In Europe, some recent autochthonous malaria cases have been related to close proximity to airports and shipping ports receiving flights and water craft from malaria-endemic areas (,,). Inadvertent carriage of infective Anopheles mosquitoes by airplane, ship, baggage, or bilge water may be responsible for these occurrences. Also, large populations of migrants from areas highly endemic for malaria () may act as human reservoirs for potential gametocyte carriers. Marseille has a large population of persons of Comorian origin, and most of the patients with imported malaria cases diagnosed in Marseille contracted the disease during a trip to the Comoros Islands (,). Our first case-patient’s malaria may have been linked to her neighborhood, which included Comorian families who had recently traveled to Comoros. Despite the absence of Anopheles larvae near the first patient’s neighborhood, local transmission cannot be excluded during the late spring and summer. Summer temperatures in Marseille induce a short P. falciparum sporogonic cycle (≈11 days at 28°C), which is compatible with mosquitoes’ longevity at that time. The Minnesota case-patient likely represents a second case of autochthonous malaria. First, this patient had no illness to suggest an untreated, active infection since his last trip to Togo. Second, even if he had been persistently infected with P. falciparum and was semi-immune, this case would still represent an extremely long incubation period (16 months). Third, onset of symptoms was acute, hematologic testing showed infection with a 3% parasitemia level, and the case-patient was moderately ill, which suggests a more recent exposure. Moreover, the genotype was monoallelic for each locus, indicating a clonal infection, which would be expected in areas of relatively low transmission frequency. In contrast, in areas of frequent endemic transmission, such as Togo, multiple allelic polymorphisms would be expected (). Finally, genotyping demonstrated different clones of P. falciparum; this finding suggests potential multiple introductions, temporally related, of the parasite into the environment The last malaria focus in continental France occurred near the end of World War II in the Camargue region, which was visited by our second case-patient in April 2006. However, large Anopheles populations, including potential vectors such as An. hyrcanus, An. melanoon, and An. atroparus, are still present from March to November (N. Ponçon and D. Fontenille, unpub.data) in southeastern France, generating an “anophelism without malaria” situation (). Migrants from malaria-endemic countries, climate, and Anopheles populations make southern France a favorable area for sporadic cases of autochthonous malaria in Europe. Given these 2 temporally related cases, clinicians should suspect malaria in patients with unexplained fevers who have recently traveled to areas of southern France.
  14 in total

1.  Controlled trial of 3-day quinine-clindamycin treatment versus 7-day quinine treatment for adult travelers with uncomplicated falciparum malaria imported from the tropics.

Authors:  P Parola; S Ranque; S Badiaga; M Niang; O Blin; J J Charbit; J Delmont; P Brouqui
Journal:  Antimicrob Agents Chemother       Date:  2001-03       Impact factor: 5.191

2.  Marseilles: a surveillance site for malaria from the Comoros Islands.

Authors:  Philippe Parola; Pierre Gazin; Bruno Pradines; Daniel Parzy; Jean Delmont; Philippe Brouqui
Journal:  J Travel Med       Date:  2004 May-Jun       Impact factor: 8.490

3.  A case of autochthonous Plasmodium vivax malaria, Corsica, August 2006.

Authors:  A Armengaud; F Legros; I Quatresous; H Barre; P Valayer; Y Fanton; E D'Ortenzio; F Schaffner
Journal:  Euro Surveill       Date:  2006-11-16

4.  Evaluation of malaria screening in newly arrived refugees to the United States by microscopy and rapid antigen capture enzyme assay.

Authors:  William M Stauffer; Ashley M Newberry; Charles P Cartwright; Jon E Rosenblatt; Kevan L Hanson; Lynne Sloan; Dean T Tsukayama; Charlotte Taylor; Billie Anne Juni
Journal:  Pediatr Infect Dis J       Date:  2006-10       Impact factor: 2.129

5.  Two cases of autochthonous Plasmodium falciparum malaria in Germany with evidence for local transmission by indigenous Anopheles plumbeus.

Authors:  A Krüger; A Rech; X Z Su; E Tannich
Journal:  Trop Med Int Health       Date:  2001-12       Impact factor: 2.622

6.  Genetic diversity and structure of African Plasmodium falciparum populations in urban and rural areas.

Authors:  Hervé Bogreau; François Renaud; Housem Bouchiba; Patrick Durand; Serge-Brice Assi; Marie-Claire Henry; Eric Garnotel; Bruno Pradines; Thierry Fusai; Boubacar Wade; Eric Adehossi; Philippe Parola; Mohamed Ali Kamil; Odile Puijalon; Christophe Rogier
Journal:  Am J Trop Med Hyg       Date:  2006-06       Impact factor: 2.345

7.  Individual cases of autochthonous malaria in Evros Province, northern Greece: serological aspects.

Authors:  Helge Kampen; Efstratios Maltezos; Maria Pagonaki; Klaus-Peter Hunfeld; Walter A Maier; Hanns M Seitz
Journal:  Parasitol Res       Date:  2002-03       Impact factor: 2.289

8.  [Two cases of inexplicable autochthonous malaria in Toulouse, France].

Authors:  M T Baixench; J Suzzoni-Blatger; J F Magnaval; M B Lareng; G Larrouy
Journal:  Med Trop (Mars)       Date:  1998

9.  Rapid genotyping of loci involved in antifolate drug resistance in Plasmodium falciparum by primer extension.

Authors:  Shalini Nair; Alan Brockman; Lucy Paiphun; François Nosten; Tim J C Anderson
Journal:  Int J Parasitol       Date:  2002-06-15       Impact factor: 3.981

10.  Biology and dynamics of potential malaria vectors in Southern France.

Authors:  Nicolas Ponçon; Céline Toty; Grégory L'Ambert; Gilbert Le Goff; Cécile Brengues; Francis Schaffner; Didier Fontenille
Journal:  Malar J       Date:  2007-02-21       Impact factor: 2.979

View more
  21 in total

1.  Potential malaria outbreak in Germany due to climate warming: risk modelling based on temperature measurements and regional climate models.

Authors:  Marcel Holy; Gunther Schmidt; Winfried Schröder
Journal:  Environ Sci Pollut Res Int       Date:  2010-08-31       Impact factor: 4.223

Review 2.  The arrival, establishment and spread of exotic diseases: patterns and predictions.

Authors:  Sarah E Randolph; David J Rogers
Journal:  Nat Rev Microbiol       Date:  2010-04-07       Impact factor: 60.633

3.  Malaria resurgence risk in southern Europe: climate assessment in an historically endemic area of rice fields at the Mediterranean shore of Spain.

Authors:  Sandra Sainz-Elipe; Jose Manuel Latorre; Raul Escosa; Montserrat Masià; Marius Vicent Fuentes; Santiago Mas-Coma; Maria Dolores Bargues
Journal:  Malar J       Date:  2010-07-31       Impact factor: 2.979

4.  Analysis of the causes of spawning of large-scale, severe malarial epidemics and their rapid total extinction in western Provence, historically a highly endemic region of France (1745-1850).

Authors:  Emeline Roucaute; George Pichard; Eric Faure; Manuela Royer-Carenzi
Journal:  Malar J       Date:  2014-02-28       Impact factor: 2.979

5.  Source identification of autochthonous-introduced Plasmodium vivax Malaria, Spain.

Authors:  Laura Barrado; Carmen Ezpeleta; José Miguel Rubio; Carmen Martín; José Manuel Azcona; Miren Arteaga; Xabier Beristain; Ana Navascués; Eva Ongay; Jesús Castilla
Journal:  Infection       Date:  2016-08-26       Impact factor: 3.553

6.  Risk of malaria reemergence in southern France: testing scenarios with a multiagent simulation model.

Authors:  Catherine Linard; Nicolas Ponçon; Didier Fontenille; Eric F Lambin
Journal:  Ecohealth       Date:  2009-05-16       Impact factor: 3.184

7.  Early treatment failure during treatment of Plasmodium falciparum malaria with atovaquone-proguanil in the Republic of Ivory Coast.

Authors:  Nathalie Wurtz; Aurélie Pascual; Adeline Marin-Jauffre; Housem Bouchiba; Nicolas Benoit; Marc Desbordes; Maryse Martelloni; Vincent Pommier de Santi; Georges Richa; Nicolas Taudon; Bruno Pradines; Sébastien Briolant
Journal:  Malar J       Date:  2012-05-02       Impact factor: 2.979

8.  Autochthonous Plasmodium vivax malaria in a Greek schoolgirl of the Attica region.

Authors:  Chariclia V Loupa; Konstantina Tzanetou; Ioannis Kotsantis; Stylianos Panopoulos; Moyssis Lelekis
Journal:  Malar J       Date:  2012-02-21       Impact factor: 2.979

9.  Atypical aetiology of a conjugal fever: autochthonous airport malaria between Paris and French Riviera: a case report.

Authors:  Christelle Pomares-Estran; Pascal Delaunay; Annie Mottard; Eric Cua; Pierre-Marie Roger; Bruno Pradines; Daniel Parzy; Hervé Bogreau; Christophe Rogier; Charles Jeannin; Saïd Karch; Didier Fontenille; Dominique Dejour-Salamanca; Fabrice Legros; Pierre Marty
Journal:  Malar J       Date:  2009-08-23       Impact factor: 2.979

10.  Effects of local anthropogenic changes on potential malaria vector Anopheles hyrcanus and West Nile virus vector Culex modestus, Camargue, France.

Authors:  Nicolas Ponçon; Thomas Balenghien; Céline Toty; Jean Baptiste Ferré; Cyrille Thomas; Alain Dervieux; Grégory L'ambert; Francis Schaffner; Olivier Bardin; Didier Fontenille
Journal:  Emerg Infect Dis       Date:  2007-12       Impact factor: 6.883

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.