BACKGROUND AND AIMS: Understanding Ph1, a dominant homoeologous chromosome pairing suppressor locus on the long arm of chromosome 5B in wheat Triticum aestivum L., is the core of the investigation in this article. The Ph1 locus restricts chromosome pairing and recombination at meiosis to true homologues. The importance of wheat as a crop and the need to exploit its wild relatives as donors for economically important traits in wheat breeding programmes is the main drive to uncover the mechanism of the Ph1 locus and regulate its activity. METHODS: Following the molecular genetic characterization of the Ph1 locus, five additional deletion mutants covering the region have been identified. In addition, more bacterial artificial chromosomes (BACs) were sequenced and analysed to elucidate the complexity of this locus. A semi-quantitative RT-PCR was used to compare the expression profiles of different genes in the 5B region containing the Ph1 locus with their homoeologues on 5A and 5D. PCR products were cloned and sequenced to identify the gene from which they were derived. KEY RESULTS: Deletion mutants and expression profiling of genes in the region containing the Ph1 locus on 5B has further restricted Ph1 to a cluster of cdk-like genes. Bioinformatic analysis of the cdk-like genes revealed their close homology to the checkpoint kinase Cdk2 from humans. Cdk2 is involved in the initiation of replication and is required in early meiosis. Expression profiling has revealed that the cdk-like gene cluster is unique within the region analysed on 5B in that these genes are transcribed. Deletion of the cdk-like locus on 5B results in activation of transcription of functional cdk-like copies on 5A and 5D. Thus the cdk locus on 5B is dominant to those on 5A and 5D in determining the overall activity, which will be dependent on a complex interplay between transcription from non-functional and functional cdk-like genes. CONCLUSIONS: The Ph1 locus has been defined to a cdk-like gene cluster related to Cdk2 in humans, a master checkpoint gene involved in the initiation of replication and required for early meiosis.
BACKGROUND AND AIMS: Understanding Ph1, a dominant homoeologous chromosome pairing suppressor locus on the long arm of chromosome 5B in wheatTriticum aestivum L., is the core of the investigation in this article. The Ph1 locus restricts chromosome pairing and recombination at meiosis to true homologues. The importance of wheat as a crop and the need to exploit its wild relatives as donors for economically important traits in wheat breeding programmes is the main drive to uncover the mechanism of the Ph1 locus and regulate its activity. METHODS: Following the molecular genetic characterization of the Ph1 locus, five additional deletion mutants covering the region have been identified. In addition, more bacterial artificial chromosomes (BACs) were sequenced and analysed to elucidate the complexity of this locus. A semi-quantitative RT-PCR was used to compare the expression profiles of different genes in the 5B region containing the Ph1 locus with their homoeologues on 5A and 5D. PCR products were cloned and sequenced to identify the gene from which they were derived. KEY RESULTS: Deletion mutants and expression profiling of genes in the region containing the Ph1 locus on 5B has further restricted Ph1 to a cluster of cdk-like genes. Bioinformatic analysis of the cdk-like genes revealed their close homology to the checkpoint kinase Cdk2 from humans. Cdk2 is involved in the initiation of replication and is required in early meiosis. Expression profiling has revealed that the cdk-like gene cluster is unique within the region analysed on 5B in that these genes are transcribed. Deletion of the cdk-like locus on 5B results in activation of transcription of functional cdk-like copies on 5A and 5D. Thus the cdk locus on 5B is dominant to those on 5A and 5D in determining the overall activity, which will be dependent on a complex interplay between transcription from non-functional and functional cdk-like genes. CONCLUSIONS: The Ph1 locus has been defined to a cdk-like gene cluster related to Cdk2 in humans, a master checkpoint gene involved in the initiation of replication and required for early meiosis.
Meiosis is a specialized type of cell division in which two rounds of chromosome segregation follow a single round of DNA replication. During the onset of meiosis, homologues must recognize each other and then intimately align (pairing and synapsis). In most eukaryotes this is a prerequisite for genetic recombination and balanced segregation of half-bivalents at anaphase I. Many components of the meiotic recombination machinery are known, especially in yeast, as well as some of the structural components of the synaptonemal complex. However, little is known about how homologous chromosomes recognize each other and become competent to pair. Hexaploid wheat (Triticum aestivum; 2n = 6x = 42; genome AABBDD) possesses three ancestral genomes or seven sets of six related chromosomes. For hexaploid wheat to be highly fertile, only true homologues may pair within each set of the six related chromosomes during meiosis. The major locus controlling this pairing behaviour is Ph1, which is a single dominant locus located on chromosome 5B (Riley and Chapman, 1958). Mutants carrying a deletion of the Ph1 locus exhibit a degree of pairing of related (homoeologous) chromosomes and hence multivalent formation at metaphase I (Sears, 1977; Roberts ). So what is the Ph1 locus? Absence of Ph1 activity in diploid relatives of wheat suggests that the Ph1 locus arose on polyploidization (Chapman and Riley, 1970). Studies have shown a lack of phenotypic variation, apart from dosage effects and the failure of ethylmethane sulfonate treatment to yield mutants (Wall ). This suggests that Ph1 is complex in structure. Recently a two-part strategy for the molecular characterization of Ph1 was used to dissect the complex structure. The first part revealed the gene content of the wheatPh1 region using conservation of gene order between the highly repetitive, 16 000 Mb hexaploid wheat genome and the smaller genomes of rice and Brachypodium sylvaticum, thus providing markers with which to saturate the wheat region. The second part of the strategy used deletion lines to dissect the Ph1 locus physically. By these approaches, the Ph1 locus was localized to a 2·5 Mb region of wheat chromosome 5B containing a structure consisting of a segment of sub-telomeric heterochromatin that inserted into a cluster of cdc2 (cdk)-related genes following polyploidization (Griffiths ). Here, further characterization of the Ph1 region is presented exploiting new deletions and expression analysis studies.
MATERIALS AND METHODS
Plant material and growth conditions
The following hexaploid wheat (Triticum aestivum; 2n = 6x = 42; genome AABBDD) lines were used: euploid Chinese Spring (CS), euploid Paragon, CSPh1 mutant line (ph1b) (Sears, 1977) and CS nullisomic/tetrasomic lines N5AT5B, N5BT5D and N5DT5A (Sears, 1966). Plants were grown in a controlled-environment growth room at 20 ºC (day) and 15 ºC (night) with 16 h of light and 85% humidity.
Mutagenesis and cytogenetical analysis
The X-ray-irradiated populations were created by X-ray mutagenesis of F1 hybrid seed between CS and the ph1b deletion mutant. Batches of at least 500 seed were subjected to 5, 10, 20, 30, 50 or 100 Gy of X-rays in a Linac-3 machine at Norfolk and Norwich Hospital. Five (M2) seed from each of the M1 plants were germinated and DNA extracted from 6-week-old leaf material. PCR amplification was performed on the extracted DNA. The γ-irradiated populations were created by γ-mutagenesis of seeds from hexaploid wheat variety Paragon. The irradiation was performed by the International Atomic Energy Agency (IAEA), Seibersdorf, Austria. Batches of at least 500 seed were subjected to between 150 and 250 Gy of γ-irradiation. Five M2 seeds were sampled per M1 surviving plant. The seeds were cut in half with a razor blade and the embryo halves retained. DNA preparations were made from the individual endosperm ends. PCR amplification was performed on the extracted DNA. The embryos identified as carrying informative deletions from these PCR assays were germinated and the chromosome pairing scored at meiosis in the resulting plant and its progeny. Chromosome pairing of control and deletion lines was analysed in 30 pollen mother cells at meiotic prophase I in Feulgen-stained preparations. Wild-type pairing was confirmed by the presence of >19 ring bivalents per cell in both the M2 and resulting M3 plants. Line γ250-214 did not yield M3 progeny, so its pairing phenotype could not be confirmed.
BAC library analysis
The bacterial artificial chromosome (BAC) library (TAACSPALLhA) from T. aestivum L. cv. CS was analysed as described by Griffiths and Allouis . Sub-cloning from some BACs was carried out using the Invitrogen TOPO® Shotgun Subcloning Kit. DNA was extracted using QIAGEN Miniprep Kit QIAprep® Spin. Both kits were used as described by the manufacturers. The BAC sequence analysis was carried out using contiging and homology searching software (Altschul ; Ewing ) as described previously by Griffiths . Within the BAC sequence, only the genes were accurately annotated. The rest of the sequence was identified as being homologous to repetitive elements but the structure of these elements was not extensively annotated. The cdk-like sequences have been submitted to the EMBL database.
Analysis of expression by RT–PCR
Wheat leaf tissues and immature inflorescences from CS and the ph1b mutant of wheat were harvested at growth stages 6–7 (Feekes scale) and stored in liquid nitrogen. Seeds were imbibed for 24 h in water immediately prior to RNA extraction. RNA was extracted using an RNeasy plant mini kit (QIAGEN) according to the manufacturer's instructions. PCR amplification was performed on the cDNA using intron-spanning, gene-specific primer pairs or coding region primers, depending upon each gene structure. The primers for the genes were as follows: FIM, F-TCAACGTCTGGATCGAGCAC, R-CTCAATAAGAGTGCGGAGG; Clk (clv), F-AAGAAGATGTGGTCGCCGGA, R-ACGTCGCTCTTCTCGCTGAT; pep, F-GGACAATTC TATGGCCTTCG, R-ATGGAG GAGCAATGGCTTGT; spG1, F-AGGCAGCTTGCTCGACCATA, R-AGGCAGCTTGCT CGACCATA; spG2, F-GCTCTGCTATAT TTGCCTCA, R-GCTCTGCTATATTTGCCT CA; OshypII, F-TCAACGTCTGGATCGAGCAC, R-GCTCAATAAGAGTGCGGAGG; KH hyp4, F-ATGTGCTGCTGCCCGAGCAA, R-GCGAGGTTGAGGTGGCCGTA; slp (sub), F-CTTCAACTCCGAGTCCGGCA, R-CAGAGGAAGTGGAGGTAGTC; zip (zinc), F-GACCATCAGCCTGCACAAGA, R-ACGACTGCGATGACACCGAC; sbp (selenium), F-TCGCTGTGAAGTGTGGTTGGC, R-CTCACTCTGGCTGCAGCATC; gtl (chick), F-CAT CACCGACGTCTACCACA, R-CACATGCTTGCGGTTGGGCA; h5l (hap5), F-TCAGGTGTTCTGGGCGGAGC R-TGCCGCAATGTCGGACTTCT; raf (ra8), F-GACGCCATCCTCGAGCTCCT, R-GACGCCATCCTCGAGCTCCT; mic1 (AthypVII), F-CAGCAAGCTCGCCACCTTACC, R-GTATCGTCGATGTCGCGGAGC; Marcks, F-GGGAATGGTGATTTGTATGC, R-GTAGCTTGCTATTGTATAGCG; CCOM, F-TGTGAACACGCCGACCTCGA, R-GCCGGAAGCAGCCTCTACAG; WRKY, F-GCAAACTGTTCGTTGCTTCAG, R-TCGGCACTGTCCTTGGCTGC; and AthypV, F-CGCAAGACAAAAGCCAAAGC, R-AAGCTGCTCAATGTACAGTGTC. Cdk-like-specific primers were designed based upon SNP (single nucleotide polymorphism) differences identified within their DNA sequences (primers for: cdk-like 1B, F- ATCCACCGACTACCAGGAGAT, R-GCCGTGCTGGCCGTACGGTA; cdk-like 2B, F-TCCACCGCGACATCAAGACA, R-CCTTGAGGACTTCGAAATTC; cdk-like 3B, F-GCTCCGCATCATCCACGGCA, R-GCTGTTGCGTCGTCGTCCCG; cdk-like 6B, F-TCTCCGTGGTCATGGAGTGC, R-GCCAGAGCAACCACGCACGTC; cdk-like 7B, F-ATGTCCTTCCACGAGCACCAC, R-CGAAGAGTGGCTTCCCGGAC; cdk-like 2A, F-GCCCCTTCGCCGGGAAGCT, R-GTGGATGATGTCATGATGCG; cdk-like 1D, F-CCGACTTCAAGGTGGACATG, R-TGCCGTGCTGGCCGTACGGA; and cdk-like 2D, F-CCCCTTGGCCGGCAAGCTCG, R-CGGCGAGCGGCAAGGACTT). In addition, primers were designed for the cdk-like genes based on the conserved domain identified across all the cdk-like genes (F-GACTTCAAGGTGGACACCAGC, R-GATGCCGGCGCCCTCGTGGGC).Reverse transcription was carried out using reverse transcription super script RNase H (Invitrogen). PCR products were cloned using a p-GEM T easy vector kit (Promega). PCR products for sequencing were purified using MinEluteTM 96 UF or Qiaquick® PCR Purification kits from QIAGEN. All kits were used as described in the manufacturer's instructions. Sequencing was carried out in the Genome Laboratory at the John Innes Centre and BAC sequencing at Washington University-Genome Sequencing Center, St Louis, MO, USA.
RESULTS
Characterization of wheat mutants carrying deletions encompassing the Ph1 region
Prior to the present study, the Ph1 locus had been defined to a 2·5 Mb region on chromosome 5B of hexaploid wheat (Griffiths ). This region had been characterized at the molecular level and found to contain approx. 36 genes including a cdk-like gene cluster containing a segment of sub-telomeric heterochromatin as shown in Fig. 1. By exploiting the genomic information gained from the analysis of this region, a systematic screen of mutagenized wheat populations was undertaken to assess the efficiency of generating deletions localized within the 2·5 Mb region. Wheat seeds were treated with either 5, 10, 20, 30, 50 or 100 Gy of X-ray or 150, 200 or 250 Gy of γ-irradiation. The mutagenized populations derived from the seed were then screened using a multiplex PCR-based assay with markers derived from the Ph1 region. The multiplex PCR assay had been previously described by Griffiths . No deletion mutants were identified from screening 500 individuals of M2 populations irradiated with 5–150 Gy. However, two and three plants carrying a deletion in the Ph1 region were identified after screening 500 and 900 individuals from the 200 and 250 Gy treatments, respectively. One of the five plants (γ250-19) revealed a wild-type chromosome pairing phenotype and carried the smallest deletion of approx. 500 kb in size (Fig. 1). It eliminated eight genes as being responsible for the Ph1 phenotype (hyp5, ugg1, cmt1, hsp20-1, at1, plp1, wdb1 and hyp6) (Fig. 1). Another mutant plant (γ250-214) carried a deletion of approx. 1 Mb in size which overlapped with the γ250-19 deletion (Fig. 1). This deletion encompassed a further 11 genes in this region which flanked the sub-telomeric insertion (Fig. 1). However, it was not possible to score the pairing phenotype of this plant accurately because it did not survive. The other three remaining mutants carried larger deletions than those described above, ranging from 1 to >10 Mb. This work clearly demonstrated that wheat seeds treated with 200–250 Gy of γ-irradiation can yield a range of deletion sizes with relatively high frequency. The deletion analysis still defined the Ph1 locus to the region containing the cdk-like (locus) cluster and the segment of heterochromatin (Fig. 1).
F
Schematic diagram of the deletion mutants and annotated genes in the region containing the Ph1 locus on chromosome 5B compared with the equivalent regions on chromosomes 5A and 5D. The three horizontal blue bars represent part of chromosome 5B and its homoeologous regions on chromosome 5A and 5D. The yellow box within the 5B chromosome bar represents the inserted sub-telomeric repeats. The two rectangles with red dotted lines represent the regions deleted in the two γ-irradiated mutant lines. Grey dots represent genes outside the Ph1 locus. The magenta dots represent cdk-like genes. The green dots represent the storage protein-like genes (SP) where G1, G2 and G3 indicate that there are differences at the protein level. The stars represent the expression pattern of different genes: uncoloured stars represent genes that are mainly expressed from 5A or 5D, magenta stars represent genes expressed from 5B and genes lacking stars are not expressed. Apart from the cdk-like locus, the gene content presented is as described in Griffiths . A more detailed analysis of the cdk-like loci is provided in Fig. 4.
Schematic diagram of the deletion mutants and annotated genes in the region containing the Ph1 locus on chromosome 5B compared with the equivalent regions on chromosomes 5A and 5D. The three horizontal blue bars represent part of chromosome 5B and its homoeologous regions on chromosome 5A and 5D. The yellow box within the 5B chromosome bar represents the inserted sub-telomeric repeats. The two rectangles with red dotted lines represent the regions deleted in the two γ-irradiated mutant lines. Grey dots represent genes outside the Ph1 locus. The magenta dots represent cdk-like genes. The green dots represent the storage protein-like genes (SP) where G1, G2 and G3 indicate that there are differences at the protein level. The stars represent the expression pattern of different genes: uncoloured stars represent genes that are mainly expressed from 5A or 5D, magenta stars represent genes expressed from 5B and genes lacking stars are not expressed. Apart from the cdk-like locus, the gene content presented is as described in Griffiths . A more detailed analysis of the cdk-like loci is provided in Fig. 4.
Expression profiling in leaf, spike and seed of all genes in the 2·5 Mb Ph1 region of 5B and their homoeologues in the corresponding regions on 5A and 5D
Expression analysis of genes within the 2·5 Mb region containing the Ph1 locus had previously revealed that the overall level of transcription of the genes within this region showed no significant differences whether the 5B region was present or absent (Griffiths ). Recently, more genomic sequences were obtained in this region. A more detailed analysis was therefore undertaken to assess the levels of transcription of the genes on 5B, 5D and 5A (three homoeologues) in the presence of Ph1, and any changes in the level of transcription of the genes located on the 5A and 5D genomes when the 5B chromosome region was deleted. The sequence analysis of the coding regions of the homoeologues enabled the design of conserved primers which could be used for all three homoeologues but which would yield PCR products carrying distinct SNPs for each homoeologue (see Materials and Methods). RT–PCR was carried out on the cDNA using these conserved primers. PCR products were cloned and 24 clones were sequenced for each gene. The transcript products were then assigned to the correct homoeologue based on the SNPs within the sequence. The relative contributions made by the homoeologues were calculated as a percentage (Fig. 2). No expression was detected for genes clk1, pep1, storage protein-like G1 (spG1), rlp1, rdr1 and raf1 from either wild-type wheat (CS) or the Ph1 mutant (ph1b) (Fig. 1). Analysis of the 2·5 Mb region revealed that the genes accounting for most of the transcription were located in the 5A chromosomal region (Fig. 2). This explains why there was apparently no major effect on the total level of transcription when the 5B region was deleted. However, there was a region where the expression was derived mainly from the 5B genes, namely the region containing the cdk-like and the spG1 clusters and hyp3 (Fig. 1). The Ph1 phenotype is specific to 5B and the Ph1 locus was therefore defined to this region containing specific expression from the 5B genes. In fact there was very little transcription from the genes on 5B flanking the Ph1 region, with mic1 being the only other gene which was transcribed to a significant level in the 2·5 Mb chromosomal region. Of the genes transcribed from 5B within the Ph1 region, hyp3 was not found in the equivalent region of the related grass Triticum timopheevi which has Ph1 activity, and hyp1 and hyp2 (Griffiths ) are now known to encode storage-like proteins in wheat (Kawaura ). Interestingly, when the 5B region was deleted, the loss of transcription of these genes was compensated by the homoeologues on the remaining genomes (5A and 5D) so that there was no apparent difference in the overall level of transcription in the presence or absence of Ph1 (Figs 2 and 3). In some cases, the compensation was provided by homoeologous genes lying on other chromosomes such as observed for transcription in both spike and seeds for hyp3 and in leaf for Slp1 genes. Thus, only the cdk-like gene cluster remained for more detailed analysis with respect to the Ph1 function.
F
Expression pattern of genes within the 2·5 Mb region covering the Ph1 locus on 5B and equivalent regions on 5A and 5D. Total RNA was extracted from leaf, spike and seeds of Chinese Spring and Ph1 mutant (ph1b). For each gene, RT–PCR products were cloned and 24 clones were sequenced. SNPs enabled a semi-quantification of the expression from the genes on chromosomes B, A and D. Results are presented in the form of pie charts where the sizes of the blue, green and orange sectors correspond to the proportion of transcription contributed by genes on chromosomes 5B, A and D, respectively. A white sector indicates that the sequenced transcript did not correspond to any of these genes.
F
Transcription of specific genes in the presence or absence of the Ph1 locus. Semi-quantitated RT–PCR products were amplified from total RNA extracted from the spikes of Chinese Spring (CS) and the Ph1 mutant. Primers were designed in the conserved regions of elp1, mic1 and the storage protein-like gene spG3b. The glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene was used as a semi-quantitative positive control.
Expression pattern of genes within the 2·5 Mb region covering the Ph1 locus on 5B and equivalent regions on 5A and 5D. Total RNA was extracted from leaf, spike and seeds of Chinese Spring and Ph1 mutant (ph1b). For each gene, RT–PCR products were cloned and 24 clones were sequenced. SNPs enabled a semi-quantification of the expression from the genes on chromosomes B, A and D. Results are presented in the form of pie charts where the sizes of the blue, green and orange sectors correspond to the proportion of transcription contributed by genes on chromosomes 5B, A and D, respectively. A white sector indicates that the sequenced transcript did not correspond to any of these genes.Transcription of specific genes in the presence or absence of the Ph1 locus. Semi-quantitated RT–PCR products were amplified from total RNA extracted from the spikes of Chinese Spring (CS) and the Ph1 mutant. Primers were designed in the conserved regions of elp1, mic1 and the storage protein-like gene spG3b. The glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene was used as a semi-quantitative positive control.
Structural complexity of the cdk cluster
Before undertaking a detailed analysis of the expression of the cdk-like genes in euploid wheat (CS) in comparison with the Ph1 mutant (ph1b), the CS BAC library was screened with specific probes for cdk-like and storage protein-like genes. DNA was prepared from >60 BACs identified. Southern blot analyses were carried out, with blots being probed with the conserved regions of the cdk-like and the storage protein-like genes. Primers were designed in the most conserved domains of all known cdk-like genes already identified in the Ph1 region and corresponding regions in 5A and 5D. These primers were used to amplify DNA from euploid wheat, ph1b, CS nullisomic/tetrasomic lines N5AT5B, N5BT5D and N5DT5A, and all the BACs identified as containing cdk-like genes. The PCR products were then cloned and sequenced. Sequence analysis revealed that the cdk loci on 5B and 5A were more complex than initially thought. There were higher numbers of both cdk-like and storage protein-like genes within this region. BAC and genomic analyses showed that seven, five and two cdk-like genes were present in the corresponding regions of 5B, 5A and 5D chromosomes, respectively (Figs 1 and 4). The number of storage protein-like genes was also more than initially predicted, and at least four genes on each chromosome were identified (Figs 1 and 4). The main finding was that there had been gene duplication of both cdk-like and storage protein-like genes (Figs 1 and 4). This made BAC analysis more complex because of similar size fragments containing cdk-like or storage protein-like genes, requiring them to be distinguished by sequencing. Interestingly, the gene duplication differed between 5B, 5A and 5D, indicating that these clusters arose at different times.
F
Detailed schematic diagram of the cdk cluster on chromosome 5B and homoeologous regions on chromosomes 5A and 5D. The homoeologous regions of 5B, 5A and 5D are defined in three white boxes. Pale pink blocks represent the BACs. Blocks in magenta represent the cdk-like genes, large green cylinders represent storage protein-like genes (sp) where G1, G2 and G3 indicate that there are differences at the protein level; smaller green cylinders represent fragments of storage protein-like genes. The solid blue horizontal line indicates that the genes are found on the same BAC sequence contig. Sub-telomeric heterochromatin is shown inserted between cdk-like genes 6 and 7 on 5B.
Detailed schematic diagram of the cdk cluster on chromosome 5B and homoeologous regions on chromosomes 5A and 5D. The homoeologous regions of 5B, 5A and 5D are defined in three white boxes. Pale pink blocks represent the BACs. Blocks in magenta represent the cdk-like genes, large green cylinders represent storage protein-like genes (sp) where G1, G2 and G3 indicate that there are differences at the protein level; smaller green cylinders represent fragments of storage protein-like genes. The solid blue horizontal line indicates that the genes are found on the same BAC sequence contig. Sub-telomeric heterochromatin is shown inserted between cdk-like genes 6 and 7 on 5B.
Sequence analysis of cdk-like genes in the clusters on 5B, 5A and 5D
From the BAC and genomic analyses, the complete sequence of the seven cdk-like genes on 5B, five cdk-like genes on 5A and the two cdk-like genes on 5D was available (Fig. 5). Within the 5B and 5A cdk-like loci, there were also fragments of storage-like protein genes present. The sequence analysis of the three cdk-like genes (A3, A4 and A5) within 5A BAC 1898B19 revealed that in contrast to the flanking regions, the sequence of the three cdk-like genes differed every time these cdk-like genes were sequenced either from sub-clones, PCR products or the BAC itself (data not shown). Therefore, although these 5A cdk-like genes apparently carry frameshifts and stop codons, these may reflect sequencing errors. Moreover, the translation of the sequence of the cdk-like genes on 5A suggests that they differ at the protein level in comparison with other cdk-like genes in 5B and 5D loci. Again this may reflect the problems in sequencing these specific genes (Figs 4 and 5). The sub-telomeric heterochromatin segment inserted between the two cdk-like genes, cdk-like B6 and B7 (Fig. 4). Cdk-like B7 was found to be a pseudo-gene at the protein level and cdk-like B6 was fused in-frame with a small non-autonomous CACTA transposon (Fig. 6). DNA and protein sequence analyses showed that cdk-like D1 and D2 are functional genes and are related to cdk-like B4 (Figs 5 and 6). The cdk-like genes are related to the protein kinase gene Cdk2 from humans (Fig. 7; Marston and Amon 2004). Of the 15 invariant amino acids found in the conserved sub-domains of these protein kinases, 11 of these amino acids were found in the products of Ph1's cdk-like genes (Fig. 7).
F
Sequence alignment of cdk-like genes on 5B, 5A and 5D. The sequences are in order from top to bottom: cdk-like B1–B7, cdk-like A1–A5 and cdk-like D1 and D2. The CACTA transposon has been removed from the sequence of cdk-like B7 for this comparison. As explained within the text, 5A cdk-like gene sequences may contain errors.
F
Protein alignment of cdk-like genes on 5B, 5A and 5D. The protein sequences are in order from top to bottom: cdk-like B1–B7, cdk-like A1–5 and cdk-like D1 and D2.
F
Protein alignment of cdk-like D2 with kinase Cdk2 from humans. Protein alignment of the meiotic checkpoint gene in humans (Debondt ) with the cdk-like protein D2 gene. The shaded areas represent the overall homology to these two known genes. Eleven of 15 functional domains are conserved between kinases (underlined).
Sequence alignment of cdk-like genes on 5B, 5A and 5D. The sequences are in order from top to bottom: cdk-like B1–B7, cdk-like A1–A5 and cdk-like D1 and D2. The CACTA transposon has been removed from the sequence of cdk-like B7 for this comparison. As explained within the text, 5A cdk-like gene sequences may contain errors.Protein alignment of cdk-like genes on 5B, 5A and 5D. The protein sequences are in order from top to bottom: cdk-like B1–B7, cdk-like A1–5 and cdk-like D1 and D2.Protein alignment of cdk-like D2 with kinase Cdk2 from humans. Protein alignment of the meiotic checkpoint gene in humans (Debondt ) with the cdk-like protein D2 gene. The shaded areas represent the overall homology to these two known genes. Eleven of 15 functional domains are conserved between kinases (underlined).
Transcription from the cdk-like gene clusters in the 5B Ph1 and 5A and 5D equivalent regions
Conserved primers were designed in the N-terminal part of the coding region of the cdk-like genes. The use of conserved primers provided the opportunity to semi-quantitate the contribution each gene in the cluster made to the total level of transcription, by sequencing RT–PCR products and then assigning the product to a particular gene based on SNP detection. Different sets of conserved primers were designed and tested on cDNA derived from spike RNA of euploid and Ph1 mutants as well as from genomic DNA of these plants. The PCR products (200 bp) were then cloned and a minimum of 300 clones sequenced. Results were inconclusive in terms of quantification because, in addition to the known cdk-like genes on 5B and 5D chromosomes, there were other unknown variants being generated in both euploid and Ph1 mutant samples. Within the euploid sample, 56 % of the clones were derived from 5B cdk-like genes, 24 % from 5D cdk-like genes and 20 % were unknown cdk-like genes, while within the Ph1 mutant sample, 68 % were unknown cdk-like genes and 36 % derived from 5D cdk-like genes. These unknown cdk-like variants were mostly absent in the PCR products generated by the conserved primers of DNA derived from the nullisomic/tetrasomic line N5AT5B. This suggests that the cdk-like unknown variants are being derived from the 5A cdk-like genes (unpublished). As described previously, the BAC sequence analysis indicated that variants were being generated from products derived from three cdk-like genes (A3, A4 and A5). Despite this issue, the expression analysis did indicate that cdk-like B2, B3 and B7 were being transcribed from the 5B region. To overcome these problems, specific primers were designed from the sequence of the cdk-like genes on chromosomes 5B (cdk-like B4, B6 and B7), 5A (cdk-like A2 and A4) and 5D (cdk-like D1 and D2). The expected PCR products were between 250 and 500 bp (Fig. 8). The specific primers were first tested on genomic DNA extracted from the nullisomic/tetrasomic lines N5AT5B, N5BT5D and N5DT5A. All primers were found to be specific at the chromosome level. Primers were then used to study the expression of these genes using RT–PCR on spike tissues from both the CS and Ph1 mutant plants. The PCR products were cloned and 24 clones were sequenced to confirm that the products were in fact derived from the cdk-like gene for which the specific primers were designed. The cdk-like A5 was found to be expressed in both CS and the Ph1 mutant, whereas cdk-like D2 was only expressed in the Ph1 mutant (Fig. 8). Interestingly, cdk-like B6 and cdk-like B7 (the CACTA insertion and pseudo-gene, respectively) (Fig. 6) were expressed in CS (Fig. 8). Thus, five cdk-like genes were expressed from the 5B locus, namely cdk-like B2, B3, B4, B6 and B7, and one gene from the 5A locus, namely A5, while cdk-like D2 and cdk-like A variants were mainly expressed in the absence of the 5B region. Thus, as in the case of the storage protein-like gene (spG1) and mic1 (Fig. 2), the transcription from the homoeologues on the other genomes is being suppressed by the presence of the 5B copies. When the 5B copy is deleted, the transcription is activated on the other genomes to compensate.
F
Expression pattern of cdk-like genes from spikes of wild-type wheat (Chinese Spring; CS) and the Ph1 mutant. Total RNA was extracted from spikes of CS and the Ph1 mutant and used in a semi-quantitative RT–PCR amplification. All PCR components in the master-mix remained constant except for the primers. The primers were designed specifically for each cdk-like gene in the three homoeologous regions from B, A and D genomes. The glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene was used as a semi-quantitative positive control. A DNA marker from Invitrogen was used to size the PCR product.
Expression pattern of cdk-like genes from spikes of wild-type wheat (Chinese Spring; CS) and the Ph1 mutant. Total RNA was extracted from spikes of CS and the Ph1 mutant and used in a semi-quantitative RT–PCR amplification. All PCR components in the master-mix remained constant except for the primers. The primers were designed specifically for each cdk-like gene in the three homoeologous regions from B, A and D genomes. The glyceraldehyde-3-phosphate dehydrogenase (gapdh) gene was used as a semi-quantitative positive control. A DNA marker from Invitrogen was used to size the PCR product.
DISCUSSION
Previously, the Ph1 locus had been defined to a 2·5 Mb region containing a cdk-like gene cluster within which a segment of sub-telomeric heterochromatin had inserted following wheat's polyploidization (Griffiths ). Here the identification of mutants carrying further deletions encompassing the 2·5 Mb Ph1 region has been described. In particular, it has been shown that it is possible to generate deletions of 500 kb upwards in hexaploid wheat with reasonable frequency after γ-irradiation. The ability to generate deletions with such a high frequency enables a complex locus such as Ph1 to be defined. This approach could make it easier to fine map physically those genes controlling agronomic traits lying in regions of reduced recombination. The characterization of the new deletions covering the 2·5 Mb region presented here is consistent with the original proposal that defined the Ph1 locus to a region containing a cdk-like gene cluster. The original analysis indicated that this region of 5B contained a segment of sub-telomeric heterochromatin inserted within this cdk-like cluster, making it distinct from the corresponding cdk-like gene clusters on 5A and 5D. The more detailed BAC library analysis in the present study, covering the cdk loci on 5B, 5A and 5D, reveals not only that the region is distinct in possessing a segment of heterochromatin, but also that the cdk-like cluster on 5B is itself unique compared with the equivalent clusters on 5A and 5D. There are in fact seven cdk-like genes on 5B compared with at least five on 5A and two on 5D. The sequence analysis data suggest that these structures arose through tandem duplication events. The Ph1 phenotype is specific to chromosome 5B. The expression profiling reveals that the region defined as containing the Ph1 locus also contains the only cluster of genes expressed specifically from 5B in the whole region analysed. The genes in the flanking regions are mostly transcribed from genes located on 5A. Five of the cdk-like genes are transcribed, including unusually the two pseudogenes cdk-like B6 and cdk-like B7. None of the other pseudogenes identified are expressed. It is possible that the transcription of these two pseudogenes may therefore be connected to the presence of the sub-telomeric heterochromatin segment which inserted between them. The transcripts generated from these two pseudogenes could be non-coding and may be involved with the functional cdk-like transcripts in a small RNA-based interference mechanism. Hexaploid wheat may possess a mechanism for regulating and sensing the total level of transcripts in the cell which can be derived from the homoeologues. In cases where most of the transcription is derived from the genes located on 5B (cdk-like genes, storage protein-like gene clusters and mic1), the deletion of these genes does not necessarily affect the total level of transcription as the genes located on 5A or 5D can compensate for the loss of transcription from the 5B copies. However, the expression studies do indicate that the cdk locus on 5B is dominant in terms of transcription control over corresponding cdk loci on 5A and 5D. The increase in expression from the 5A or 5D cdk-like loci may explain the Ph1 effects observed on chromosome synapsis (Holm, 1986, 1988). During early meiosis, chromosomes can engage in multiple associations during synapsis. Later in meiosis, these associations are resolved in the presence of Ph1, while many associations are still maintained in the absence of Ph1. Disruption of chromosome pairing usually causes a lengthening in the time taken to complete meiotic prophase I. Yet despite the disruption to chromosome pairing, meiotic prophase I is not longer in the absence of Ph1 than in its presence (Bennett ). This implies that in the absence of Ph1, something is induced which over-rides the checkpoint mechanism and speeds up the completion of meiotic prophase I. The induction of expression of the 5A cdk-like genes may be responsible for this phenotype and the consequential inability to resolve incorrect associations within the timeframe available. Equally, it has been observed that increasing the dosage of the 5B Ph1 locus results in disruption of chromosome pairing (Feldman, 1966). Increasing the dosage of the 5B cdk-like locus may result in oversuppression of the cdk-like loci on 5A and 5D, resulting in aberrant chromosome pairing.Finally, detailed bioinformatics has revealed that the kinase Cdk2 from humans shows the closest homology to the genes within the wheat cdk locus. Interestingly, this kinase is required for meiosis and has a number of phosphorylation targets (Marston and Amon, 2004; Cohen ). It co-localizes with mismatch repair proteins to recombination nodules and to the telomere regions during early meiosis (Ashley et al., 2000). Disruption of Cdk2 expression in mouse has also been shown to result in increased ‘non-homologous’ synapsis of chromosomes at meiosis (Cohen ). An increased presence of multiple associations of chromosomes is also observed at synapsis in the Ph1 mutant (Holm, 1988). Cdk2 has been proposed to be involved in licensing origins of replication through histone phosphorylation and chromatin remodelling (Alexandrow and Hamlin, 2005). The control of such biological processes during pre-meiotic replication and at the start of meiosis would also be entirely consistent with some of the cell biology and cytogenetic observations associated with Ph1, namely the initiation and co-ordination of chromatin remodelling during the onset of meiosis (Aragon ; Maestra ; Prieto , 2005). In hexaploid wheat, prior to meiosis, the centromeres pair and then form seven clusters corresponding to the seven sets of related chromosomes. At the onset of meiosis, the telomeres cluster to form a telomere bouquet (Martinez-Perez ). Within this telomere bouquet, the telomere regions recognize each other and initiate intimate alignment (Prieto ). This alignment then propagates along the homologous chromosomes from the telomere regions. At the onset of meiosis, the chromatin of chromosomes is remodelled to enable the homologues to pair (Prieto ). Ph1 is involved in the initiation of this remodelling, and in co-ordinating the remodelling of chromatin on both homologues so that they are in the same conformation at the onset of pairing. In the absence of Ph1, the chromatin remodelling can be initiated asynchronously and prematurely so that homologues are in different conformational states (Prieto ). Thus, a homologue would be just as likely to align intimately with a related chromosome as with its true homologue. The Ph1 locus in wheat is also able to block recombination from occurring between similar but distinct chromosome segments located within otherwise identical chromosomes (Dubcovsky ; Luo ). If chromatin remodelling is required for chromosome pairing and recombination, then the lack of recombination between these regions in the presence of Ph1 may simply reflect a failure to remodel the regions at the onset of meiosis. Thus, a cdk-like gene complex related to Cdk2 which partially suppresses the activity of corresponding loci on 5A and 5D could explain the multitude of different effects attributed to Ph1.
Authors: Simon Griffiths; Rebecca Sharp; Tracie N Foote; Isabelle Bertin; Michael Wanous; Steve Reader; Isabelle Colas; Graham Moore Journal: Nature Date: 2006-02-09 Impact factor: 49.962
Authors: F M Bassi; A Kumar; Q Zhang; E Paux; E Huttner; A Kilian; R Dizon; C Feuillet; S S Xu; S F Kianian Journal: Theor Appl Genet Date: 2013-05-29 Impact factor: 5.699
Authors: Isabelle Colas; Peter Shaw; Pilar Prieto; Michael Wanous; Wolfgang Spielmeyer; Rohit Mago; Graham Moore Journal: Proc Natl Acad Sci U S A Date: 2008-04-15 Impact factor: 11.205