Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primers.

BACKGROUND: The highly heterogenic characteristic of viruses is the major obstacle to efficient DNA amplification. Taking advantage of the large number of virus DNA sequences in public databases to select conserved sites for primer design is an optimal way to tackle the difficulties in virus genome amplification.
RESULTS: Here we use hepatitis B virus as an example to introduce a simple and efficient way for virus primer design. Based on the alignment of HBV sequences in public databases and a program BxB in Perl script, our method selected several optimal sites for HBV primer design. Polymerase chain reaction showed that compared with the success rate of the most popular primers for whole genome amplification of HBV, one set of primers for full length genome amplification and four sets of walking primers showed significant improvement. These newly designed primers are suitable for most subtypes of HBV.
CONCLUSION: Researchers can extend the method described here to design universal or subtype specific primers for various types of viruses. The BxB program based on multiple sequence alignment not only can be used as a separate tool but also can be integrated in any open source primer design software to select conserved regions for primer design.

Background

Chronic hepatitis B virus (HBV) infection is a major health problem worldwide, affecting approximately 350 million people, and 500,000 to 1.2 million deaths worldwide per year are attributed to HBV infection. Currently there are eight accepted genotypes (A to H) for HBV, based on one of the following criteria: an inter-group divergence of 8% or greater in the complete genome nucleotide sequence or a 4 ± 1% divergence of the surface antigen gene [1,2]. It has been widely reported that it is possible to have two HBV genotypes or recombinant types in one infected individual [3-5].

The HBV reverse transcriptase (RT) is an error-prone enzyme as a result of lacking 3'-5'-exonuclease proofreading capacity. HBV, like other viruses such as HIV, HCV and poliovirus, has a high mutation rate of 2 × 10-5/site/year [6,7]and quasispecies distribution in infected individuals [8]. This means that HBV circulates as a complex mixture of genetically distinct but closely related variants that are in equilibrium at a certain time point of infection in a given circumstance. A mixture of HBV quasispecies is in fact a mixture of HBV haplotypes, which is a more important concept to researchers, such as in drug resistant mutant studies-different haplotypes of HBV may represent different types of drug resistance [9-12].

Because of the existence of quasispecies, the only way to obtain HBV haplotype sequences is through full length genome amplification and clone-sequencing instead of assembling the PCR sequences of several amplified fragments of the genome. However, the partially double stranded characteristic of HBV DNA structure causes the instability of exposed HBV DNA and the low efficiency of whole genome amplification. Günther et al. developed a set of primers for full length HBV genome amplification, with a restriction enzyme site for further cloning and function study [13,14]. The success rate reported in this paper is one out of eight genomes (12%) amplified with Taq polymerase, and seven out of seventeen genomes amplified with Taq-Pwo polymerases (41%). Further studies showed similar success rate (40%). In our laboratory, 141 of 420 genomes amplified with Takara-LA polymerases (34%) using this method. Tellier et al. developed two pairs of primers for nested PCR. Those primers can amplify nearly full length of HBV (3.12 kb), yet the whole process is complicated, time consuming and may introduce risk of cross contamination [15,16]. So it is not widely used and no success rate has been reported.

The considerable number of HBV isolates with rather divergent nucleotide sequences and the partially double-stranded characteristic of HBV impose the need for extreme care in the choice of primers for both full length and fragment amplification.

In order to identify optimal sites for primer design, we utilized 1020 whole genome sequences in public databases (NCBI, EMBL and DDBJ) and 103 sequences in our laboratory, and developed a program BxB to select conserved regions as candidates for primer design. We testified those primer designs in silico by e-PCR and real polymerase chain reactions. One set of primers for nearly full length HBV genome amplification (3181 bp, 40 bp shorter than full length) and four sets of walking primers for fragment amplification were finally obtained. These primer sequences are within areas that are highly conserved across all genome sequences available in public databases, therefore the use of such primers makes it unlikely that HBV strains are missed due to sequence variations and allows further search for quasispecies as well as unknown HBV genotypes and other subtypes.

Results

Identification of candidate regions for primer design by BxB

We analyzed 1123 sequences, 1020 from public databases (Additional file 1) and103 sequences identified in our laboratory, with the BxB program. 10 regions were selected according to BxB analysis (Table 1). Candidate regions were defined as sites within the desired locations that had 17+ bases from the 3' end and with a frequency of 0.90+ in the BxB. The output of BxB analysis was designated as a FASTA format, which could be illuminated in sequence analysis software interface such as ClustalX software to facilitate primer selection (Figure 1).

Table 1

Candidate regions selected by BxB for primer design

Candidate Regions*	Sequence	ORF located in
8~26	ACCTCTGCCTAATCATCTC	X/preC
40~68	ACTGTTCAAGCCTCCAAGCTGTGCCTTGG	preC
591~616	GCCGCGTCGCAGAAGATCTCAATCTC	Terminal Protein
993~1018	GGGTCACCATATTCTTGGGAACAAGA	Terminal Protein
1450~1469	CCTGCTGGTGGCTCCAGTTC	pre-S2
1571~1592	TCCTAGGACCCCTGCTCGTGTT	S
1657~1679	ACTTCTCTCAATTTTCTAGGGGG	S
2131~2159	TATATGGATGATGTGGTATTGGGGGCCAA	S
2491~2516	TTCTCGCCAACTTACAAGGCCTTTCT	RT
3199~3221	CACCAGCACCATGCAACTTTTT	X/preC

*Here we select "CTTTTTC" of X ORF as the start point

Figure 1

Output of BxB illiminated in ClustalX software. When the ratio of the most frequently presented nucleotide is larger than current cutoff value, the program outputs this nucleotide, otherwise outputs a '-'. The cutoff was set to (0.05, 1), and the step length is 0.05. The frequency is listed in the left box and the nucleotides are in the right box.

Primer selection

One set of full length genome primers, four sets of walking primers were designed with the aid of Primer 3 (Figure 2, Table 2). Degenerate sites were also considered when there were sites yielding low BxB frequency in selected primers. All these primers gave negative result when they were tested in UCSC in silico PCR to see whether primers would amplify human DNA.

Figure 2

Diagram of HBV ORFs and designed primers. WA-L and WA-R in blue arrows represents the primers for full length genomic DNA amplification. FA1-L/FA1-L' and FA1-R (amplicon size: 1014 bp), FA2-L and FA2-R(amplicon size: 1074 bp), FA3-L and FA3-R (amplicon size: 1059 bp), FA4-L/FA4-L' and FA4-R (amplicon size: 1072 bp) in red arrows represent the four sets of walking primers for fragment amplification. FA2-L and FA2-R Here we select "CTTTTTC" of X ORF as the start point. FA1-L' and FA4-L' are degenerate primers.

Table 2

Primers for full length genome amplification and fragment amplification

Primers	Sequence	Location*	Length	GC %	Tm(°C)	Amplicon Size (bp)
WA-L	ACTGTTCAAGCCTCCAAGCTGTGC	40	24	54.2	60.6	3181
WA-R	AGCAAAAAGTTGCATGGTGCTGGT	3221	24	45.8	60.7
FA1-L	TTTCACCTCTGCCTAATCATCTC	4	23	43.5	52.0	1014
FA1-L'	TTT ACCTCTGCCTAATCATCTC	4	22	40.9	47.5
FA1-R	TCTTGTTCCCAAGAATATGGTG	1018	22	40.9	51.0
FA2-L	GCGTCGCAGAAGATCTCAAT	593	20	50.0	51.9	1074
FA2-R	TTGAGAGAAGTCCACCACGAG	1667	21	52.4	51.7
FA3-L	CTGCTGGTGGCTCCAGTT	1451	18	61.1	50.6	1059
FA3-R	GCCTTGTAAGTTGGCGAGAA	2510	20	50.0	52.2
FA4-L	GTATTGGGGGCCAAGTCTGT	2416	20	55.0	52.8	1072
FA4-L'	GTATTGGGGGCCAAATCTGT	2416	20	50.0	52.8
FA4-R	AAAAAGTTGCATGGTGCTG	3218	19	42.1	48.5

*Here we select "CTTTTTC" of X ORF as the start point. FA1-L' and FA4-L' are degenerate primers

Experiment verification

All primers, including one set of primers for full length (3181 bp) amplification and four sets of primers for fragment amplification, demonstrated a good efficiency in real polymerase chain reactions (Figure 3).

Figure 3

Agarose gel analysis of HBV genomes amplified by the newly designed primers. Sample 1 and sample 2 are for fragment amplification primers testing. 1, 2, 3, 4 in the figure represent: FA3-L and FA3-R (amplicon size: 1059 bp), FA1-L/FA1-L' and FA1-R (amplicon size: 1014 bp), FA4-L/FA4-L' and FA4-R (amplicon size: 1072 bp), FA2-L and FA2-R (amplicon size: 1074 bp) primer pairs respectively. Sample 3~7 are for full length genome amplification primers (WA-L and WA-R) testing (amplicon size: 3181 bp).

Discussion

Using an alignment of 1123 complete genomes from public databases and our laboratory, we selected primers from several highly conserved regions of HBV genomes. These primers are situated in the sequences encoding X, preC, terminal protein, pre-S2, S and reverse transcriptase regions. Sequences of the primers are sufficiently conserved in all HBV genotypes and are believed to be conserved in quasispecies. All these primers were shown to be very efficient in real polymerase reaction. The advantage of such approach is that it utilized all HBV sequences available and a simple Perl program to precisely select optimal regions in HBV genome for amplification. Such approach is unlikely to produce significant bias towards any one genotype when there is no bias in the multiple sequences alignment which the approach was based on. These primer designs make it possible to efficiently amplify quasispecies and allow further search for unknown HBV genotypes/subtypes.

We used two methods to estimate HBV genotype distribution in the public databases were: counting the genotyped sequences with a simple Perl program and calculating the percentages; or using BLAST[17] to align eight HBV genotype reference sequences from NCBI with those from public databases to get all sequences of different HBV genotypes and then to calculate the percentage. Both methods yielded similar results: Genotype C counts most (about 1/3 in the databases); Genotype B, A, D in descending order. These four genotypes represent about 80~90% in the databases and the rest are E, F, G and H. Besides, there are also a few CD and GC recombinants.

The primer design described in this study is based on sequences from the public databases and our laboratory which are genotype B and C. Therefore, it would only give bias when the genotype distribution in the databases does not reflect the actual HBV genotype distribution in reality. Since this method is based on multiple sequences, it can be much more reliable when target amplifications are within one genotype or within a certain group. In such occasions, sequences of one genotype or a given group should be used and analyzed with the BxB program to obtain genotype-specific or group-specific candidate regions and primer sequences. Recently, based on full length sequences in our laboratory most of which are from Beijing, we successfully selected optimal primers for HBV in Beijing regions using this approach. Further research of this approach should be done on other genotypes like A, D, E, F etc. to testify its specificity, either through sequences of one genotype or sequences of mixtures.

The amplified full length genome with our method is 3181 bp which is only 40 bp shorter than the full length of HBV genome. It is not applicable in functional study but much valuable in genomic study. The set of primers were proved to have a good PCR efficiency. The four sets of fragment primers are also based on the most conserved regions from public sequences. These primers are walking primers covering the whole HBV genome. They should be very useful in amplifying certain regions of the genome. In future research on this method, both full length amplification primers and fragment amplification ones should be testified in samples with different viral titers to check its sensitivity.

The BxB program we utilized in this study was a simple Perl script, which can be easily integrated in any primer design software and online tools. What BxB demands is just a multiple sequences alignment of the target sequences FASTA format, and outputs a description of conserved sites for primer design in FASTA format. It not only can be used as a separate tool but also can be integrated in any open source primer design software[18] to select conserved sites based on the alignments.

The highly heterogenic characteristic of viruses is the major obstacle to efficient DNA amplification. Taking advantage of the large number of virus DNA sequences in public databases to select conserved sites for primer designing should be an optimal way to tackle the difficulties in virus genome amplification. DNA sequences in public databases are on the increase. Take HIV and Hepatitis viruses for example, up to March 2007, the number of full length genome DNA sequences in public databases (Additional file 1) are ranges from about 40 to more than 2000: HIV is 2005; HCV is 183; HBV is 1020; HEV is 78; HAV is 35 and HDV is 83. This amount of data makes it possible to easily select conserved sites for primer design in different scale, genome regions, subtypes and groups.

Conclusion

Utilizing the HBV sequence in public databases and our laboratory, and a Perl program, we selected optimal regions for primer design. Those primers designed were verified in silico by e-PCR and polymerase chain reactions. One set of primers for full length HBV genome amplification and four sets of walking primers for fragment amplification were proved to be efficient. The use of such primers makes it unlikely that HBV strains are missed due to sequence variations and allows furthermore search for quiasispecies as well as genotype-unknown HBV strains. Our approach of primer design is simple, efficient and is totally applicable to other viruses, such as HIV, HCV etc. when multiple sequences alignments are available and efficient amplification in a heterogeneous mixture is needed.

Methods

HBV sequence data

Initially in the study all complete genome sequences of HBV available in March 2007 from GenBank, EMBL, and DDBJ were downloaded. 1020 public sequences together with 103 sequences from our laboratory were aligned in ClustalW. The alignment was manually corrected by shifting sequences in places, for some sequences possessed large spans of unique deletions or insertions which threw off the alignment algorithm. Finally, as the start point of the sequences in databases were different, most of which were the EcoR I restriction enzyme cutting site, a unanimous start point was selected and the alignment was corrected to begin at the same location. Here we select "CTTTTTC" of X ORF as the start point.

Selection of highly conserved genome regions for primer design

The term "conserved genome regions" used here is defined as genome regions that have most frequently presented nucleotide sequences. To identify the highly conserved regions for primer design in HBV genome, Perl script[19] was used to write a program BxB (Base by Base) to scan through the alignment of the 1123 sequences base by base. BxB demands a multiple sequences alignment of the target sequences in FASTA[20] format. It is to detect the most frequently presented base in the same coordinate for all sequences of the alignment. Different cutoff values were tested to identify a best one for the alignment scan. If the ratio of the most frequently presented nucleotide is larger than current cutoff value, the program outputs this nucleotide, otherwise outputs a '-'. Finally, the cutoff was set to (0.05, 1), and the step length is 0.05. The output is a FASTA file which could be easily illuminated in sequence analysis software such as ClustalX[21], with which conserved region selection and primer design could be much facilitated in a user friendly interface.

Primer design

With the aid of the BxB, candidate regions were selected for primer design. Candidate regions were defined as sites within the desired locations that had 17+ bases from the 3' end and with a frequency of 0.90+ in the BxB. Using Primer 3 [22], primers were selected within the candidate regions, taking target regions, primer length and sequence, GC content and Tm etc. into consideration.

In silico primer testing

All primers were tested in University of California Santa Cruz (UCSC) in silico PCR to see whether primers would amplify human DNA.

Clinical material

Serum samples were collected from seven patients with hepatitis B surface antigen (HBsAg)-positive chronic hepatitis (serum HBsAg positive for at least 6 months). Five of them were genotype C and two were genotype B. All patients were seronegative for hepatitis C virus. The serum samples were stored at -20°C until analysis.

Extraction of serum HBV DNA

Serum viral DNA was extracted by using commercially available kits (QIAamp DNA Blood Mini Kit, QIAGEN, Inc., Valencia, CA).

Polymerase chain reaction

Full length amplification

The PCR was performed in a 96-well cycler (GeneAmp PCR System 9700; Applied Biosystems) and in a 10 μl reaction volume containing 0.5 U LA Taq (TaKaRa). The primers were WA-R and WA-L (Table 2). The cycling conditions were initial denaturation at 95°C for 2 min 30 s, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 58°C for 1 min 30 s and extension at 72°C for 3 min, finally extension at 72°C for 10 min. Amplicons (1 μl) were analyzed by electrophoresis on 1.5% agarose gel, stained with ethidium bromide and observed under UV light.

Fragment amplification

For fragment amplification, the primers were FA1-R, FA1-L/FA1-L', FA2-R, FA2-L, FA3-R, FA3-L, FA4-R, FA4-L/FA4-L' (Table 2). The cycling conditions were initial denaturation at 95°C for 2 min 30 s, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min and extension at 72°C for 2 min, finally extension at 72°C for 10 min. Amplicons (1 μl) were analyzed by electrophoresis on 1.5% agarose gel, stained with ethidium bromide and observed under UV light.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

QRZ conceived of the study, designed the experiment, performed the multiple sequence alignment and selected the primers. GHW did the experiments and wrote the manuscript. ER corrected the multiple sequence alignment, wrote the Perl scripts and performed in silico testing SGJ did some of the experiments. CZ supervised the whole research.

Additional file 1

Sequence IDs of HBV full length genome entries in GenBank, EMBL and DDBJ (March 2007). The data provided represent all available HBV genome sequences when the study was conducted.

Click here for file