Literature DB >> 17725802

Rituximab responsive immune thrombocytopenic purpura in an adult with underlying autoimmune lymphoproliferative syndrome due to a splice-site mutation (IVS7+2 T>C) affecting the Fas gene.

Andrew Wei1, Tiffany Cowie.   

Abstract

A 36 yr-old man of Israeli descent with a history of childhood splenectomy for severe thrombocytopenia and a family history of autoimmune lymphoproliferative syndrome (ALPS), presented with severe immune thrombocytopenic purpura refractory to standard therapy. He was found to possess a heterozygous mutation in the Fas gene (also termed TNFRSF6, CD95, Apo-1) affecting the donor splice site of intron 7 (IVS7+2 T>C). This frameshift mutation truncates the cytoplasmic domain of the Fas death receptor, resulting in circulating CD4/8 double negative T lymphocytes, lymphadenopathy and autoimmune complications typical of ALPS. Administration of Rituximab in this patient was associated with a durable hematologic response (currently more than 12 months). This report highlights the need to consider rare inherited causes of thrombocytopenia in adults with a family history of immune cytopenia(s) and the effective use of anti-CD20 monoclonal antibody in patients unresponsive to immunosuppression and splenectomy.

Entities:  

Mesh:

Substances:

Year:  2007        PMID: 17725802      PMCID: PMC2040244          DOI: 10.1111/j.1600-0609.2007.00924.x

Source DB:  PubMed          Journal:  Eur J Haematol        ISSN: 0902-4441            Impact factor:   2.997


Case report

Immune thrombocytopenic purpura (ITP) in adults often has an infectious, autoimmune, malignant or idiopathic etiology. Steroid refractoriness occurs in approximately 9% of patients with ITP (1). A rare inherited cause of ITP secondary to a mutation encoding the Fas gene is presented, with ongoing complete hematologic response 12 months after anti-CD20 monoclonal antibody therapy. A 36 yr-old man of Israeli descent presented with recent-onset blood blisters in the mouth and a florid petechial leg rash. Automated analysis of the peripheral blood showed severe isolated thrombocytopenia (8 × 109/L), with plentiful megakaryocytes present on bone marrow examination, consistent with a peripheral cause for thrombocytopenia. The patient was not on any medications and tests for immune and infective causes of thrombocytopenia were negative (HIV, Hepatitis B and C, EBV, CMV, ANA, ENA, ANCA, rheumatoid factor, anti-cardiolipin antibody, lupus anticoagulant, disseminated intravascular coagulation screen). The patient had a history of severe thrombocytopenia in childhood necessitating splenectomy which resulted in a sustained clinical remission until the current presentation. Importantly, there was a family history of autoimmune lymphoproliferative syndrome (ALPS) affecting the patient's niece. The patient did not respond promptly to high-dose prednisolone (100 mg daily), intravenous immunoglobulin and azathioprine (Fig. 1C), and then developed severe anemia (Hb 64 g/L) 18 d after initial presentation. Immune hemolytic anemia was confirmed by the presence of spherocytosis on the peripheral blood film, positive direct Coombs' test (IgG), reduced haptoglobin (0.1 g/L; range 0.3–2), raised lactate dehydrogenase (LDH) (351 U/L; range 140–270) and reticulocytosis (200 × 109/L; range 50–100). CT imaging of the thorax and abdomen identified enlargement of a pelvic lymph node (Fig. 1A), which was weakly fluorodeoxyglucose (FDG)-avid on positron emission tomography (PET) scanning. Due to the presence of refractory thrombocytopenia, a diagnostic biopsy was not undertaken. In the peripheral blood, polyclonal hypergammagloblinemia (IgG 24 g/L; range 9–16) was present, and in addition, a small population of CD4/8 double negative T cells (Fig. 2A). Four doses of Rituximab (375 mg/m2) given at weekly intervals resulted in brisk normalization of the platelet count (Fig. 1C), a normal reticulocyte count (85 × 109/L) 1 month later and complete resolution of the previous radiological abnormalities on a follow-up CT scan (Fig. 1B). On review 12 months after initial presentation, the patient remains in hematological remission. The patient's niece, who had a long history of refractory ITP, was known to have a heterozygous Fas mutation (also termed TNFRSF6, CD95, Apo-1) affecting the donor splice site of intron 7 (IVS7+2 T>C; personal communication Frédéric Rieux-Laucat). This previously published frameshift mutation leads to the addition of four intron bases to the RNA sequence, resulting in a premature stop codon and truncation of the cytoplasmic death domain of Fas (2). The mutant Fas protein has dramatically reduced death receptor function. DNA from the peripheral blood of the patient confirmed the presence of a heterozygous IVS7+2 T>C lesion (Fig. 2B).
Figure 1

CT scan of the pelvis at diagnosis showing an enlarged lymph node (A; white arrow) which is no longer present (B) one month after completing Rituximab. (C) Line graph showing the platelet count (▪), hemoglobin (□) and lymphocyte count (×) over time. Interventions with prednisolone, azathioprine, packed red cell transfusion (4RBC), intravenous immunoglobulin (IVIG) and rituximab are shown.

Figure 2

(A) Flow cytometric analysis (BD Facscalibur®, BD Biosciences, Franklin Lakes, NJ, USA) showing 8.4% of T lymphocytes were CD4/CD8 double negative. (B) Exon 7 of the Fas gene and the flanking intronic sequence was amplified by PCR from genomic DNA (Primers 5′tggccacttttaagtttcactg and 5′aaaaggaagtaacaaaaagccaaa). The 292 bp product was directly sequenced with an ABI3130xl genetic analyzer using the PCR primers as per the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) protocol. The presence of the heterozygous splice donor site mutation IVS7+2 T>C (arrow) was confirmed by repeat analysis.

CT scan of the pelvis at diagnosis showing an enlarged lymph node (A; white arrow) which is no longer present (B) one month after completing Rituximab. (C) Line graph showing the platelet count (▪), hemoglobin (□) and lymphocyte count (×) over time. Interventions with prednisolone, azathioprine, packed red cell transfusion (4RBC), intravenous immunoglobulin (IVIG) and rituximab are shown. (A) Flow cytometric analysis (BD Facscalibur®, BD Biosciences, Franklin Lakes, NJ, USA) showing 8.4% of T lymphocytes were CD4/CD8 double negative. (B) Exon 7 of the Fas gene and the flanking intronic sequence was amplified by PCR from genomic DNA (Primers 5′tggccacttttaagtttcactg and 5′aaaaggaagtaacaaaaagccaaa). The 292 bp product was directly sequenced with an ABI3130xl genetic analyzer using the PCR primers as per the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) protocol. The presence of the heterozygous splice donor site mutation IVS7+2 T>C (arrow) was confirmed by repeat analysis. Programmed cell death, or apoptosis, by activation of death receptors is a key mechanism for eliminating autoreactive lymphocytes. Functional failure of the Fas (located on chromosome 10q24.1) is associated with ALPS Ia, an autosomal dominant inherited disorder usually manifesting in infancy with lymphadenopathy, splenomegaly, autoimmune cytopenias and persistence of CD4/8- ‘double negative’ T cells (3). At least 69 unrelated families with Fas mutations have been recorded on the National Human Genome Research Institute database, with most mutations occurring in exon 9, the intracellular death domain of Fas (4). Rarely, the ALPS phenotype occurs with defects of Fas ligand (ALPS type Ib), caspase-8 or caspase-10 (ALPS Type II) (5). The reduced capacity to eliminate lymphocytes in ALPS is associated with an increased risk of Hodgkin (relative risk 51) and non-Hodgkin lymphoma (relative risk 14) (6). In ALPS patients with widespread lymphadenopathy and suspected lymphoma, PET scanning has been useful to guide diagnostic biopsies (7). The most effective treatment in symptomatic ITP is splenectomy, which results in long-term remission in 66% of patients (8). In ALPS patients failing splenectomy, limited published experience suggests a role for Rituximab (9) and mycophenolate mofetil (10) in such cases. Although the Fas IVS 7+2 (T→C) mutation has been previously described by Kasahara et al. (2), limited clinical information on these rare disorders is available in the published literature. In the current case, the rapid increase in platelets was preceded by marked lymphocyte depletion induced by Rituximab (Fig. 1C), strikingly similar to a previous case report (9). However, in contrast to the previously reported case, our patient has not relapsed 12 months after Rituximab treatment and has not required additional therapy to maintain a platelet response (Fig. 1C). Although the rapid platelet response following Rituximab appears premature, this is well described in ITP (11). Intravenous immunoglobulin therapy counters immune thrombocytopenia by blocking macrophage Fc receptor clearance of opsonised platelets. In addition, Rituximab also eliminates B cells, making it an ideal drug for B-cell driven autoimmune diseases. This latter mechanism was likely to be dominant in our patient as he had previously failed intravenous immunoglobulin therapy. Although ALPS is typically associated with expansion of double negative T cells, Fas defects also prevent elimination of autoreactive germinal center B cells (12), predisposing the patient to autoimmune disease and rarely, B-cell non-Hodgkin lymphoma (6). Although it is possible the weakly FDG avid pelvic node could harbor lymphoma, a percutaneous or laparoscopic biopsy was considered too hazardous in a patient with refractory thrombocytopenia. Of benefit to this patient, Rituximab is highly effective against low grade B-cell non-Hodgkin lymphoma (13), enhancing its utility in this patient. In conclusion, this report highlights a rare inherited cause of immune thrombocytopenia in an adult with a family history of autoimmune cytopenia(s). Gene scanning confirmed a Fas mutation in the patient and his affected niece. Finally, the effective use of anti-CD20 monoclonal antibody therapy to treat the autoimmune complications of this disorder was remarkable and prevented a protracted course of immunosuppressive therapy in a patient lacking a spleen.
  12 in total

1.  Morbidity and mortality in adults with idiopathic thrombocytopenic purpura.

Authors:  J E Portielje; R G Westendorp; H C Kluin-Nelemans; A Brand
Journal:  Blood       Date:  2001-05-01       Impact factor: 22.113

Review 2.  Splenectomy for adult patients with idiopathic thrombocytopenic purpura: a systematic review to assess long-term platelet count responses, prediction of response, and surgical complications.

Authors:  Kiarash Kojouri; Sara K Vesely; Deirdra R Terrell; James N George
Journal:  Blood       Date:  2004-06-24       Impact factor: 22.113

3.  Fluorodeoxyglucose positron emission tomography (FDG-PET) for monitoring lymphadenopathy in the autoimmune lymphoproliferative syndrome (ALPS).

Authors:  V Koneti Rao; Jorge A Carrasquillo; Janet K Dale; Stephen L Bacharach; Millie Whatley; Faith Dugan; Jean Tretler; Thomas Fleisher; Jennifer M Puck; Wyndham Wilson; Elaine S Jaffe; Nilo Avila; Clara C Chen; Stephen E Straus
Journal:  Am J Hematol       Date:  2006-02       Impact factor: 10.047

4.  The development of lymphomas in families with autoimmune lymphoproliferative syndrome with germline Fas mutations and defective lymphocyte apoptosis.

Authors:  S E Straus; E S Jaffe; J M Puck; J K Dale; K B Elkon; A Rösen-Wolff; A M Peters; M C Sneller; C W Hallahan; J Wang; R E Fischer; C E Jackson; A Y Lin; C Bäumler; E Siegert; A Marx; A K Vaishnaw; T Grodzicky; T A Fleisher; M J Lenardo
Journal:  Blood       Date:  2001-07-01       Impact factor: 22.113

5.  Inherited human Caspase 10 mutations underlie defective lymphocyte and dendritic cell apoptosis in autoimmune lymphoproliferative syndrome type II.

Authors:  J Wang; L Zheng; A Lobito; F K Chan; J Dale; M Sneller; X Yao; J M Puck; S E Straus; M J Lenardo
Journal:  Cell       Date:  1999-07-09       Impact factor: 41.582

6.  Novel Fas (CD95/APO-1) mutations in infants with a lymphoproliferative disorder.

Authors:  Y Kasahara; T Wada; Y Niida; A Yachie; H Seki; Y Ishida; T Sakai; F Koizumi; S Koizumi; T Miyawaki; N Taniguchi
Journal:  Int Immunol       Date:  1998-02       Impact factor: 4.823

7.  Use of mycophenolate mofetil for chronic, refractory immune cytopenias in children with autoimmune lymphoproliferative syndrome.

Authors:  V Koneti Rao; Faith Dugan; Janet K Dale; Joie Davis; Jean Tretler; John K Hurley; Thomas Fleisher; Jennifer Puck; Stephen E Straus
Journal:  Br J Haematol       Date:  2005-05       Impact factor: 6.998

8.  Dominant interfering Fas gene mutations impair apoptosis in a human autoimmune lymphoproliferative syndrome.

Authors:  G H Fisher; F J Rosenberg; S E Straus; J K Dale; L A Middleton; A Y Lin; W Strober; M J Lenardo; J M Puck
Journal:  Cell       Date:  1995-06-16       Impact factor: 41.582

9.  Effect of anti-CD20 (rituximab) on resistant thrombocytopenia in autoimmune lymphoproliferative syndrome.

Authors:  Bridget T Heelan; Vincent Tormey; Peter Amlot; Elspeth Payne; Atul Mehta; A David B Webster
Journal:  Br J Haematol       Date:  2002-09       Impact factor: 6.998

10.  Somatic mutation of the CD95 gene in human B cells as a side-effect of the germinal center reaction.

Authors:  M Müschen; D Re; B Jungnickel; V Diehl; K Rajewsky; R Küppers
Journal:  J Exp Med       Date:  2000-12-18       Impact factor: 14.307

View more
  5 in total

Review 1.  New advances in the diagnosis and treatment of autoimmune lymphoproliferative syndrome.

Authors:  David T Teachey
Journal:  Curr Opin Pediatr       Date:  2012-02       Impact factor: 2.856

2.  A New Kid on the Block: IL-10+ Regulatory B Cells and a Possible Role In Psoriasis.

Authors:  Kamruz Darabi; Rohit Jaiswal; Sarah G Hostetler; Mark A Bechtel; Matthew J Zirwas; Patricia Witman
Journal:  J Pediatr Pharmacol Ther       Date:  2009-07

3.  Use of rituximab for refractory cytopenias associated with autoimmune lymphoproliferative syndrome (ALPS).

Authors:  V Koneti Rao; Susan Price; Katie Perkins; Patricia Aldridge; Jean Tretler; Joie Davis; Janet K Dale; Fred Gill; Kip R Hartman; Linda C Stork; David J Gnarra; Lakshmanan Krishnamurti; Peter E Newburger; Jennifer Puck; Thomas Fleisher
Journal:  Pediatr Blood Cancer       Date:  2009-07       Impact factor: 3.167

Review 4.  Advances in the management and understanding of autoimmune lymphoproliferative syndrome (ALPS).

Authors:  David T Teachey; Alix E Seif; Stephan A Grupp
Journal:  Br J Haematol       Date:  2009-11-23       Impact factor: 6.998

Review 5.  Autoimmune lymphoproliferative syndrome: an update and review of the literature.

Authors:  Shaili Shah; Eveline Wu; V Koneti Rao; Teresa K Tarrant
Journal:  Curr Allergy Asthma Rep       Date:  2014-09       Impact factor: 4.806

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.