Literature DB >> 17592645

Mutations in the 3'-untranslated region of GATA4 as molecular hotspots for congenital heart disease (CHD).

Stella Marie Reamon-Buettner1, Si-Hyen Cho, Juergen Borlak.   

Abstract

BACKGROUND: The 3'-untranslated region (3'-UTR) of mRNA contains regulatory elements that are essential for the appropriate expression of many genes. These regulatory elements are involved in the control of nuclear transport, polyadenylation status, subcellular targetting as well as rates of translation and degradation of mRNA. Indeed, 3'-UTR mutations have been associated with disease, but frequently this region is not analyzed. To gain insights into congenital heart disease (CHD), we have been analyzing cardiac-specific transcription factor genes, including GATA4, which encodes a zinc finger transcription factor. Germline mutations in the coding region of GATA4 have been associated with septation defects of the human heart, but mutations are rather rare. Previously, we identified 19 somatically-derived zinc finger mutations in diseased tissues of malformed hearts. We now continued our search in the 609 bp 3'-UTR region of GATA4 to explore further molecular avenues leading to CHD.
METHODS: By direct sequencing, we analyzed the 3'-UTR of GATA4 in DNA isolated from 68 formalin-fixed explanted hearts with complex cardiac malformations encompassing ventricular, atrial, and atrioventricular septal defects. We also analyzed blood samples of 12 patients with CHD and 100 unrelated healthy individuals.
RESULTS: We identified germline and somatic mutations in the 3'-UTR of GATA4. In the malformed hearts, we found nine frequently occurring sequence alterations and six dbSNPs in the 3'-UTR region of GATA4. Seven of these mutations are predicted to affect RNA folding. We also found further five nonsynonymous mutations in exons 6 and 7 of GATA4. Except for the dbSNPs, analysis of tissue distal to the septation defect failed to detect sequence variations in the same donor, thus suggesting somatic origin and mosaicism of mutations. In a family, we observed c.+119A > T in the 3'-UTR associated with ASD type II.
CONCLUSION: Our results suggest that somatic GATA4 mutations in the 3'-UTR may provide an additional molecular rationale for CHD.

Entities:  

Mesh:

Substances:

Year:  2007        PMID: 17592645      PMCID: PMC1933416          DOI: 10.1186/1471-2350-8-38

Source DB:  PubMed          Journal:  BMC Med Genet        ISSN: 1471-2350            Impact factor:   2.103


Background

GATA4 (MIM# 600576) is a transcription factor which is characterized by a highly conserved binding domain of two zinc fingers. It is expressed in the heart and is essential for mammalian cardiac development (see reviews [1-3]). In mice, germline ablation of the gene encoding Gata4 results in abnormal ventral folding of the embryo, failure to form a single ventral tube, and lethality [4,5]. Besides heart development, Gata4 is involved in the formation of multiple organs, such as intestine, liver, pancreas and swim bladder in zebrafish [6] as well as gastric epithelial development in mouse through interaction with Fog co-factors [7]. In humans, four GATA4 gene mutations have been identified in families with congenital heart defects (CHD) notably, atrial septal defects [8-11]. One mutation (p.Gly296Ser) affects a highly conserved amino acid after the C-terminal zinc finger, and disrupts physical interaction with TBX5 [8], a transcription factor described to be defective in Holt-Oram syndrome [12]. But GATA4 germline mutations are rather rare. Two studies analyzed 16 families each, but only 2/16 families with multiple affected members carried GATA4 mutations [10,11]. In 42 patients with non-syndromic atrioventricular septal defects (familial as well as sporadic), no GATA4 mutations have been detected [13]. It is of considerable importance that genetic analysis of blood samples may not reveal somatically-occurring sequence alterations in the diseased cardiac tissues, but these mutations may provide a molecular rationale for pathogenesis [14,15]. We recently reported evidence for somatically-derived NKX2-5 and TBX5 mutations as a novel mechanism for septation defects of the human heart [16-18], and used the same heart collection of malformed hearts to investigate GATA4 gene mutations, notably those affecting the coding of amino acids for zinc finger functions of the protein [19]. To identify further genetic alterations associated with CHD, we continued our search in the 609 bp of 3'-untranslated region (3'-UTR) of GATA4. The 3'-UTR of GATA4 is relatively long and likely contains regulatory elements essential for the regulation and transport of the mRNA transcript [20]. Indeed, evidence is accumulating that the 3'-UTR of mRNA is involved in the control of nuclear transport, polyadenylation status, subcellular targetting as well as rates of translation and degradation of mRNA; thus sequence alterations in this region may lead to disease (see review [21,22]). Recently, a single nucleotide deletion in the 3'-UTR of high mobility group A1 gene (HMGA1) was identified in two type 2 diabetes patients exhibiting deficiency of the protein [23]. The mutation decreased HMGA1 mRNA half life in the lymphoblast cells of the patients, and further deletion of the 3'-UTR of HMGA1 resulted in the decrease of reporter assay expression. To the best of our knowledge, the 3'-UTR of GATA4 has not been investigated particularly as regards its role in post-transcriptional gene expression. In this paper, we report the detection of frequent GATA4 sequence alterations in the 3'-UTR in the diseased tissues of malformed hearts, some of which are predicted to alter RNA secondary structure. As a result of aberrant RNA folding, these mutations may lead to CHD by affecting mRNA localization and translation of protein. We found further five nonsynonymous mutations in exons 6 and 7 of GATA4.

Results

GATA4 is located on chromosome 8p23.1-p22, consists of seven exons and codes for a 442- amino-acid protein (see Fig. 1A). We investigated the genomic DNA for sequence variations in the entire coding region and untranslated regions (UTR) of this gene. In the case of formalin-fixed material, exons 3, 4, 6 and 7 of malformed hearts of patients with complex CHD could be amplified. We reported earlier the detection of 23 nonsynonymous mutations in exons 3 and 4, notably mutations affecting the zinc fingers of GATA4 [19]. Here we report further five nonsynonymous mutations in exons 6 and 7, which affect highly conserved amino acids 361, 377, 430, 432 and 442 in the C-terminal region of GATA4 (Table 2). Whether these sequence alterations result in aberrant protein expression requires additional studies. Previously, it has been shown that a frameshift mutation past amino acid 359 severely altered the encoded GATA4 protein and was associated with ASD [8]. Nonetheless, mutations p.Leu432Ser and p.Ala442Thr identified by us would affect polarity of the protein, due to replacement of non-polar, hydrophophic amino acids with polar, hydrophilic ones. In addition, p.Met361Val likely results in aberrant RNA folding, as determined by a method described below.
Figure 1

Genetic analysis of GATA4. (A) Schematic representation of GATA4 (genomic, mRNA and protein level). Reference sequence for GATA4 was based on NM_002052 and the intron-exon boundaries on [42]. (B) Examples of 3'-UTR mutations and genotypes obtained after direct sequencing of fragments amplified from diseased cardiac tissues of patients affected by CHD. Additional sequence alterations in the 3'- UTR of GATA4 were detected, e.g. F24ASD (c.+281G>A).

Table 2

Summary of GATA4 sequence variations in diseased cardiac tissues of patients with CHD

Nucleotide change NM_002052Coding regionAmino acid changeLocationPositive hearts (n = 29 VSD)Positive hearts (n = 16 ASD)Positive hearts (n= 23 AVSD)TotalPCR-RFLP assay
NONSYNONYMOUS**
1599c.1081A>Gp.Met361Valexon 611
1648c.1130G>Ap.Ser377Asnexon 611
1806c.1288C>Gp.Leu430Valexon 7112
1813c.1295T>Cp.Leu432Serexon 711
1842c.1324G>Ap.Ala442Threxon 711
3'UNTRANSLATED REGION
1857c.+10T>Cexon 71247EarlI
1891c.+44T>Aexon 7134
1924c.+77C>Texon 72*3*5Styl
2065c.+218C>Texon 7134EarlI
2106c.+259A>Gexon 7112*4
2127c.+280T>Cexon 713*15
2289c.+442A>Gexon 71113
2309c.+462T>Cexon 71416
2326c.+479A>Gexon 71*113NarI
2201c.+354A>Cexon 7, dbSNPrs86785827AA:2AC12AA:4AC19AA:3AC:1CC58AA:9AC:1CCMspA1I
2273c.+426C>Texon 7, dbSNPrs10622191CC:8CT:20TT2CT: 13TT1CC: 4CT:18TT2CC:14CT:51TT
2364c.+517T>Cexon 7, dbSNPrs8846629TT:16CT:4CC4TT:11CT4TT:15CT:4CC17TT:42CT:8CC
2379c.+532T>Cexon 7, dbSNPrs9040181TT:9CT:19CC9CT:6CC1TT:3CT:19CC2TT:21CT:44CC
2410c.+563C>Gexon 7, dbSNPrs1282515CC:8CG:6GG2CC:12CG15CC:6CG:2GG32CC:26CG:8GG
2434c.+587A>Gexon 7, dbSNPrs8042911AG:28GG13GG23GG1AG:64GG

* homozygous genotypes observed

** nonsynonymous mutations in exons 3 and 4 reported earlier (Reamon-Buettner and Borlak, J Med Genet 42:e32)

Genetic analysis of GATA4. (A) Schematic representation of GATA4 (genomic, mRNA and protein level). Reference sequence for GATA4 was based on NM_002052 and the intron-exon boundaries on [42]. (B) Examples of 3'-UTR mutations and genotypes obtained after direct sequencing of fragments amplified from diseased cardiac tissues of patients affected by CHD. Additional sequence alterations in the 3'- UTR of GATA4 were detected, e.g. F24ASD (c.+281G>A). Summary of GATA4 sequence variations in diseased cardiac tissues of patients with CHD * homozygous genotypes observed ** nonsynonymous mutations in exons 3 and 4 reported earlier (Reamon-Buettner and Borlak, J Med Genet 42:e32) Notably, exon 7 of GATA4 consists of 1,708 bp, the majority (1,525 bp) being untranslated. From our collection of formalin-fixed hearts, we could amplify the first four fragments of exon 7 (see Fig. 1A and Table 1 for the primer sequences designated GTx7-1 to GTx7-4). These primer sequences cover a part of the coding region c.1221 to c.1329 (nt 1739–1847, NM_002052) and 3'-UTR from c.+1 to c.+609 (nt 1848–2456, NM_002052). We found 9 sequence alterations, occurring in 3 to 7 patients, and 6 dbSNPs in the analyzed 3'-UTR region of GATA4 (Table 2, Table 3). On the basis of sequence electropherograms and/or PCR-RFLP assays, both heterozygous and homozygous genotypes were observed (Fig. 1B). Using the program GeneQuest (Lasergene 6.0), we determined the effect of the nine sequence alterations on RNA folding. GeneQuest uses the Vienna RNA folding procedure, taken from Zuker's optimal RNA folding algorithm, to fold the sense strand of selected DNA regions as RNA. We investigated the first 500 bp of the 3'-UTR, simply because the sequence alterations identified by us are located within this segment. Furthermore, there is suggestion that the whole 3-'UTR is not necessary for localization, but that localization signals lie within the regions of < 100–200 nt [25]. Compared to the reference sequence, 7/9 of these would result in faulty RNA folding (Fig. 2). While c.+77C > T and c.+479A > G would likely not lead to faulty RNA folding, the same pattern was observed for c.+10T > C and c.+44T > A. In addition, we searched the 3'-UTR of GATA4 for highly conserved motifs that may be involved in post-transcriptional regulation, (see [26]). None of the conserved motifs reported so far have been detected, but the highly conserved motif (AATAAA) associated with polyadenylation signals were located at positions c.+678–683 and c.+1502–1507.
Table 1

Primer sequences and PCR conditions used for analysis of GATA4 mutations

GATA4 exonsExon size (bp)PrimerPrimer lengthPrimer sequence (5'-3')Melting temperaturePCR product length (bp)
exon 161GT4x1F20cttgcacgtgactcccacag65°C250
GT4x1R20aagcaaaggcggagaagctc
exon 21073GT4x2-1F21tctctttctgtcgttcctctt65°C600
GT4x2-1R20gcacgtagactggcgaggac
GT4x2-2F21ggaccatgtatcagagcttgg65°C641
GT4x2-2R20gccctcgcgctcctactcac
exon 3167GT4x3F24agtcagagtgaggaagagcaagag65°C541
GT4x3R21cagtttctgtgtgccgaagag
exon 4126GT4x4F20ccagccctgcctcccgttag65°C294
GT4x4R23gaggactgagagatgggcatcag
exon 588GT4x5F22agtagccatcacatcacacagg65°C504
GT4x5R19aaagctcccaacacgttcc
exon 6149GT4x6F20gtttgtccctgccgctgatt65°C247
GT4x6R20gcagtcggcctccccacaaa
exon 71708GTx7-1F19acaaggctatgcgtctccc60°C289
GTx7-1R20ctgagaaaatccaacacccg
GT4x7-2F20gcgtaatcttccctcttccc65°C291
GT4x7-2R19gggacaaggacatcttggg
GTx7-3F20gtcgacaatctggttagggg60°C281
GTx7-3R20gtacatggcaaacagatgcc
GTx7-4F20gaggatctgagaacaagcgg60°C270
GTx7-4R20cagctgcattttgatgaggc
GTx7-5F22aaattgtggggtgtgacataca60 °C577
GTx7-5R22gttgcagaatctctggcttttt
GTx7-6F22ctgtctgtctgctcctcctagc65°C586
GTx7-6R22acctcccagtgaagaccactaa
Table 3

Spectrum of GATA4 mutations (nonsynonymous and 3'-UTR) in diseased tissues of malformed hearts

PatientAgeTotal defects*Detected mutations

Coding (ns)***3'-UTRTotal
VSDs
C06VSD**1h3F211L, Y244C, R260Q, C292R4
C10VSDstillborn6C292R1
C19VSD3 mo4C292R1
C58VSD18 d5C292Rc.+77C>T2
D01VSDaborted3C292R1
D03VSD2 mo4C292R1
E03VSD**6 mo2c.+77C>T1
E04VSD**5 wk2C292R1
E08VSD53 yr1C292R1
E10VSD6 mo4G214S1
E11VSDnewborn1c.+10T>C1
E13VSD16 yr1N239S, C292R2
E15VSD8 mo2N239D1
E16VSD3 mo3M361V1
E20VSD2 d30
E22VSD4 mo3F208L, C292R2
E23VSD**22 d3L261P, C292R2
E26VSD6 mo3C292R, S377Nc.+479A>G3
E27VSD5 mo2M223T, R229S, C292Rc.+462T>C4
E28VSD5 mo2c.+44T>A1
E29VSD8 wk3C292R1
E31VSD5 mo20
E33VSD14 yr1A442T1
E34VSD3 mo20
E35VSD4.5 mo2C292R1
E39VSD9 mo3C292Rc.+218C>T, c.+259A>G3
E40VSD15 mo1C292R1
E41VSD23 yr2C292Rc.+280T>C2
E49VSDnewborn3C292Rc.+442A>G2
ASDs
C09ASD26 yr20
C39ASD25 yr4C292R1
C45ASD6 d7C292R, L432Sc.+280T>C, c.+462T>C4
C46ASD34 yr3C292Rc.+10T>C, c.+259A>G, c.+462T>C4
C64ASD11 mo4C292R1
C75ASD2 mo6C292R1
D30ASD11 yr3L430V1
D33ASD8 yr2N248S, L261Pc.+462T>C, c.+479A>G4
F17ASD4 1/2 h1c.+280T>C1
F19ASD8 yr4c.+462T>C1
F20ASD10 yr10
F24ASD6 yr3c.+280T>C1
27ASD7 yr2C292Rc.+442A>G2
F29ASD14 yr8I255T, A294Vc.+10T>C3
F30ASD1 d20
F32ASD38 yr1R229S1
AVSDs
C43AVSD10 mo7H302Rc.+10T>C2
C70/2AVSD**8 mo6G234S, R252P, C292R3
C71AVSD**4 d5c.+10T>C, c.+442A>G2
E05AVSD16 wk6c.+10T>C1
E36AVSD**3.5 mo40
E43AVSD4.5 mo4R283H1
F00AVSD**6 wk5c.+44T>A, c.+218C>T2
F02AVSD10 mo7N248Sc.+77C>T2
F03AVSD**1 mo4c.+44T>A1
F04AVSD**11 wk5C292Rc.+218C>T, c.+259A>G3
F05AVSD**10 wk4F211L, R229S, Y244C, N285K4
F08AVSD**5 mo5P226fs1
F11AVSD**7 mo6C292Rc.+77C>T2
F12AVSD6 mo5R266X1
F13AVSD**25 mo5C292R1
F14AVSD**1 mo5T277I, C292R2
F14aAVSD**5 wk5c.+462T>C1
F15AVSD5 d7c.+218C>T, c.+259A>G2
F18AVSD**7 mo50
F28AVSD8 yr3N273S, L430V2
F31AVSD**8 d6c.+479A>G1
F38AVSD3 mo4C292Rc.+10T>C, c.+77C>T, c.+280T>C4
F40AVSD10 mo3c.+44T>A1

* Heart malformations described earlier in Reamon-Buettner et al. 2004 Am J Pathol 2004, 164:2117–2125.

** Down syndrome

*** nonsynonymous GATA4 mutations in exons 3 and 4 reported earlier in Reamon-Buettner and Borlak 2005, J Med Genet 42:e32; new mutations detected in exons 6 and 7 are in bold

Figure 2

Effect of mutations in the 3'-UTR of GATA4 on mRNA folding. Using the program GeneQuest (Lasergene 6.0), the effect of sequence alterations on RNA folding was predicted using the first c.+500 nt in the 3'-UTR of GATA4. GeneQuest uses the Vienna RNA folding procedure, taken from Zuker's optimal RNA folding algorithm [43], to fold the sense strand of selected DNA regions as RNA. Compared to the reference sequence, 7/9 mutations would result in faulty RNA folding, on which five patterns here are shown. Same pattern was observed for c.+10 T > C and c.+44T > A.

Primer sequences and PCR conditions used for analysis of GATA4 mutations Spectrum of GATA4 mutations (nonsynonymous and 3'-UTR) in diseased tissues of malformed hearts * Heart malformations described earlier in Reamon-Buettner et al. 2004 Am J Pathol 2004, 164:2117–2125. ** Down syndrome *** nonsynonymous GATA4 mutations in exons 3 and 4 reported earlier in Reamon-Buettner and Borlak 2005, J Med Genet 42:e32; new mutations detected in exons 6 and 7 are in bold Effect of mutations in the 3'-UTR of GATA4 on mRNA folding. Using the program GeneQuest (Lasergene 6.0), the effect of sequence alterations on RNA folding was predicted using the first c.+500 nt in the 3'-UTR of GATA4. GeneQuest uses the Vienna RNA folding procedure, taken from Zuker's optimal RNA folding algorithm [43], to fold the sense strand of selected DNA regions as RNA. Compared to the reference sequence, 7/9 mutations would result in faulty RNA folding, on which five patterns here are shown. Same pattern was observed for c.+10 T > C and c.+44T > A. To compare healthy vs. diseased tissues from each patient, we selected specifically those who were positive for mutations in the diseased tissue. For instance, in the diseased tissues, we found 17/68 patients without nucleotide changes in analyzed region of the 3'-UTR except for the dbSNPs. Thus for this comparison, we analyzed 21 patients for GTx7-1 (21 × 2 × 289 bp = 12,138 nucleotides); 25 patients for GTx7-3 (25 × 2 × 281 bp = 14,050 nucleotides) and 24 patients for GTx7-4 (24 × 2 × 270 bp = 12,960 nucleotides). Except for the dbSNPs rs867858, rs1062219, rs884662, rs904018, rs12825 (see Table 2), none of the mutations were detected in the unaffected tissues. This result suggests somatic origin and mosaicism of mutations. In the formalin-fixed malformed hearts, we observed six dbSNPs which were all located within 234 nucleotides in exon 7 (Table 2). We could calculate the allele frequencies for five loci (Table 2) and found the dbSNPs to be in Hardy-Weinberg equilibrium. We cloned three fragments from hearts heterozygous for rs1062219 (c.+426C > T), rs884662 (c.+517T > C) and rs904018 (c.+532T > C). Surprisingly, we found three haplotypes after sequencing of at least four clones in each heart. In all three hearts, we found one type containing all reference alleles [c.+426C; c.+517T; c.+532T] and another type with all variant alleles [c.+426T; c.+517C; c.+532C]. Additional types found were [c.+426T; c.+517T; c.+532T] with one variant allele, and [c.+426C; c.+517C; c.+532C] with two variant alleles. We further analyzed the entire gene in blood samples of 12 patients with CHD (see Fig. 1A). Mostly dbSNPs were detected (Table 4); nonetheless we observed two sequence variations in the 3'-UTR (c.+119A > T and c.+1260G > A) and two intronic (c.-518-25C > T and c.-458+5A > G) which have not yet been reported as dbSNPs. The 3'-UTR alterations and c.-518-25C>T were detected in a family of four, in which the two children were affected by ASD, but the parents had no history of CHD. For c.+119A>T, the mother was homozygous for the reference allele AA, while the father and the children had the heterozygous genotype AT (Fig. 3A&B). This sequence variation would affect RNA folding (Fig. 3C). As control, we analyzed blood samples from 100 unrelated Caucasian healthy individuals. No sequence variations were found, except for a synonymous change in exon 3 (c.699G>A, p.233Thr), an intronic (c.783+16G>A) and dbSNPs (Table 4).
Table 4

Summary of GATA4 sequence variations in blood samples

Nucleotide change NM_002052Coding regionAmino acid changeLocationNCBI dbSNP numberBlood samples CHDBlood samples normal
NONSYNONYMOUS
1647c.1129A>Gp.Ser377Glyexon 6rs372985610AA:2AG
SYNONYMOUS
1217c.699G>Ap.Thr233exon 31 (GA)
3'-UTR
1967c.+119A>Texon 72 (AT)
3107c.+1260G>Aexon 71 (GA)
2201c.+354A>Cexon 7rs8678583AA:9AC53AA:36AC:11CC
2273c.+426C>Texon 7rs10622191CC:8CT:3TT39CC:38CT:23TT
2364c.+517T>Cexon 7rs8846624TT:5CT:3CC43TT:30CT:27CC
2379c.+532T>Cexon 7rs9040181TT:5CT: 6CC30TT: 30CT:40CC
2410c.+563C>Gexon 7rs128258CC:3CG:1GG69CC:11CG:20GG
2434c.+587A>Gexon 7rs80429112GG100 GG
3005c.+1158C>Texon 7rs117854817CC:5CT
3103c.+1256A>Texon 7rs124583AA:9AT
3202c.+1355G>Aexon 7rs106227011GG:1AG
3368c.+1521G>Cexon 7rs32933585CC:6CG:1GG
INTRONIC
c.-518-25C>Tintron2 (1CT:1TT)
c.-458+5A>Gintron1 (AG)
c.783+16G>Aintron1 (GA)
c.614-61G>Cintronrs105034258GG:3CG:1CC27AA:12AC:3CC
c.997+56A>Cintronrs8042803AA:7AC:2CC
Figure 3

Detection of 3'-UTR mutations in blood samples of patients with CHD. (A) sequence electropherograms for c.+119A>T, showing heterozygous (AT) and homozygous (AA) genotypes; (B) in a family of four in which the two children had ASD; the father and the children had the heterozygous genotype AT (+), the mother was homozygous for the reference allele AA; (C) Compared to the reference sequence and on the basis of Vienna RNA folding procedure, c.+119A>T is predicted to affect RNA folding.

Summary of GATA4 sequence variations in blood samples Detection of 3'-UTR mutations in blood samples of patients with CHD. (A) sequence electropherograms for c.+119A>T, showing heterozygous (AT) and homozygous (AA) genotypes; (B) in a family of four in which the two children had ASD; the father and the children had the heterozygous genotype AT (+), the mother was homozygous for the reference allele AA; (C) Compared to the reference sequence and on the basis of Vienna RNA folding procedure, c.+119A>T is predicted to affect RNA folding.

Discussion

Recent studies characterize further the importance of Gata4 in cardiac development. Indeed, small changes in the level of Gata4 protein expression can dramatically influence cardiac morphogenesis and embryonic survival [27]. Moreover, myocardial expression of Gata4 is required for proliferation of cardiomyocytes, formation of the endocardial cushions, development of the right ventricle, and septation of the outflow tract [28]. To gain further insights into the role of GATA4 mutations in CHD in humans, we have analyzed the Leipzig collection of malformed hearts for sequence alterations of this gene. We reported previously the identification of 23 nonsynonymous mutations, 19 of which are located within the highly conserved zinc fingers and basic regions of GATA4 [19]. Notably, we identified a frequent mutation (p.Cys292Arg) in VSDs, which affects one of the four zinc coordinating cysteines in the C-finger and is predicted to disrupt the secondary structure of the protein. Functional characterization of site-directed mutated residues in the C-finger, showed that disruption of the zinc coordinating cysteines, would abolish DNA binding, Gata4-Nkx2-5 interactions and synergy [29,30]. To identify genetic alterations associated with CHD, we continued our search for mutations in the 3'-UTR region of GATA4. In the diseased tissues of malformed hearts, we found frequent alterations in the 3'-UTR of GATA4, in which 7/9 would affect RNA folding. Additional sequence alterations in the 3'- UTR of GATA4 were detected, but these were mostly isolated cases and therefore not reported here. Further, we identified a germline mutation (c.+119A>T) in which two affected family members were positive. Similarly, it would alter RNA folding. Since the unaffected father carried c.+119A>T, we cannot discount the possibilities of a low penetrance mutation or no causal association at all. Whether the 3'-UTR mutations reported here contributed to cardiac malformations by affecting the secondary structure of mRNA or through other post-transcriptional regulation associated with 3'-UTR, requires further functional analysis. Nonetheless, it has been shown that two mutations in the 3'-UTR of rat Mti (metallothionein-1) that are predicted to alter the secondary structure of this region also impaired localization of the mRNA [25]. There is, however, accumulating evidence on the important role of 3'-UTR in post-transcriptional regulation. For instance, efficient termination and stability of mRNA are dependent on a properly configured 3'-UTR [31]. Localization of mRNAs is also due to specific sites or signals within the 3'-UTR [25,32]. Recently, a systematic search discovered 106 highly conserved motifs in human 3'-UTRs that may be involved in post-transcriptional regulation, including mRNA stability and degradation [26]. Many of these are associated with microRNAs, which are non-coding RNAs of 21–22 nucleotides and are complementary to the 3'-UTR motifs that mediate post-transcriptional regulation [33]. Similary, 53 sequence motifs have been catalogued in 3'-UTR of yeast mRNAs, including motifs corresponding to known RNA-binding protein sites and motifs associated with subcellular localization [34]. Furthermore, 83 disease-associated variants in the 3'-UTR of human protein-coding genes have been systematically analyzed, and that functionality of these variants correlated highly to predicted secondary structural changes [35]. Many studies are suggestive for Gata4 to network with other transcription factors to regulate cardiac gene expression (see reviews [1-3]). These protein-protein interactions are mediated through the proteins' binding domains and for Gata4, the zinc fingers are involved. For instance, N-terminal zinc finger interacts with Fog2, while the C-terminal zinc finger contacts Nkx2-5, Nf-At3, Mef2c and Hand2. Notably, the C-finger of Gata4 interacts with the third alpha helix (homeodomain) of Nkx2-5, to enable transcriptional synergy of regulated genes. Site-directed mutagenesis of zinc coordinating cysteines in the C-finger leads to abrogation of Gata4-Nkx2-5 interaction and loss of synergy [29,30]. We reported previously the identification of somatically-derived GATA4 zinc finger mutations in the same malformed hearts, including a frequent mutation (p.Cys292Arg) in VSDs, which affects one of the four zinc coordinating cysteines and is predicted to disrupt the secondary structure of the protein [19]. However, aside from p.Cys292Arg and unlike NKX2-5 [16,17] common nonsynonymous mutations are rare in the coding regions of GATA4. Thus, the further detection of mutations in the 3'-UTR of GATA4 in the same malformed hearts with zinc finger mutations suggests a possible further mechanisms of disease, in which the zinc fingers are not involved. Indeed, as shown in Table 3, in which GATA4 nonsynonymous and 3'-UTR mutations identified in hearts with septation defects are summarized, there were 14 with 3'-UTR mutations only. These consist of 3 in VSDs, 3 in ASDs, and 8 in AVSDs. From these 14 hearts, 12 carried 3'-UTR mutations that are predicted to result in aberrant RNA folding. As can be surmised from Table 3, it appears that 3'-UTR mutations are more frequent in ASDs and AVSDs than in VSDs. In VSDs, 23 out of 29 had mutations in the coding region, most of which were p.Cys292Arg and only 9 out of 29, carried 3'-UTR mutations. It is also of considerable interest that sporadic cases of CHD from Lebanese population were analyzed for mutations affecting the zinc fingers and basic region of GATA4 [36]. A mutation (p.Glu216Asp) in the N-terminal zinc finger was detected in 2/26 patients with Tetralogy of Fallot (TOF), and this mutation resulted in reduced transcriptional activity without affecting GATA4's ability to bind DNA, nor its interaction with ZFPM2 (FOG2). However, none of the other 94 patients with various CHD phenotypes carried any mutations. To help elucidate genetic alterations in affected tissues of malformed hearts, we have investigated in the past a panel of cardiac transcription factor genes from the same 68 malformed hearts [16-19,37]. Direct sequencing revealed mutations in diseased tissues, which were basically absent in matched normal heart samples. Common occurring mutations were identified, especially in the binding domains of transcription factors, which could affect DNA-protein or protein-protein interactions leading to CHD. While certain transcription factor genes (NKX2-5, GATA4) exhibited a high rate of mutations, others were not or rarely affected (HEY2, MEF2C). Results of these studies enabled us to put forward a hypothesis of somatic mutations as a novel molecular cause of CHD. Furthermore, we found malformed hearts containing combination of mutations in the binding domains of several transcription factors, As example, we identified in two patients with AVSD combined mutations in the binding domains of HEY2, NKX2-5, TBX5 and GATA4 [37]. We also identified 21 patients with combined mutations in the GATA4 zinc fingers and the homeodomain of NKX2-5 (unpublished results). Our malformed hearts were stored in formalin more than 40 years ago and there is speculation about artifacts arising from this procedure [38-40]. To ensure reliability of our findings, we investigated sequence variations in 10 formalin-fixed, but healthy hearts which were collected at the same time as the malformed hearts. Essentially, these hearts were free of GATA4 mutations, therefore providing convincing evidence for reliability of the assay. In addition, our identification of six dbSNPs within the 3'-UTR demonstrates faithful preservation of DNA and reliability in using valuable retrospective material with the obvious advantage of studying clearly defined pathology, as opposed to using surrogate tissue material distal to organ defect. Five dbSNPs were highly polymorphic (see Table 2) and were found to be in Hardy-Weinberg equilibrium. This was confirmed with our control population of healthy individuals. But cloning of fragments amplified from diseased heart tissues of patients who were 'heterozygous' for three dbSNPs detected three haplotypes instead of the expected two, which may be due to duplication of GATA4 in analyzed tissues. This result is similar to our previous observations on different cardiac transcription factors conducted on the same set of malformed hearts [16-19,37]. After cloning amplified fragments with several closely-spaced 'heterozygous' mutations as marker loci within a single gene, we observed several haplotypes in individual hearts, instead of two haplotypes as expected of a diploid genome. (Note, we used the term haplotype to define the set of alleles within an investigated gene locus). The cause of the observed multiple haplotypes is unknown, but may be explained by a mixed population of cardiomyocytes carrying different mutations or de novo chromosomal rearrangements and gene duplications in the heart tissues of patients affected by CHD. Our results for NKX2-5 by using a yeast-based assay to determine function suggest that different haplotypes can lead to different cardiac disease phenotypes [41]. Furthermore, the presence of combined mutant alleles may alter/modify pattern of mRNA folding. We found, for instance, patients who were either positive for c.+218C>T or c.+259 A>G or both. Two patients were heterozygous for both mutations, while one patient was homozygous for both variant alleles. Singly c.+218C>T or c.+259 A>G would lead to misfolding (see Fig. 2), but if combined only the pattern observed for c.+259 A>G would result. Moreover, different haplotypes due to combinations of closely-spaced polymorphisms in the 3'-UTR of genes can result in different mRNA stabilities in transient expression assays [35]. Nonetheless, as the malformed hearts were conserved in formalin, possibilities exist that the observed multiple haplotypes could be PCR errors resulting from fragmented DNA. We believe the contrary, however, as specific haplotypes were detected in several malformed hearts after cloning, but were absent in matched unaffected heart tissue (unpublished results). To further support DNA assay reliability on the formalin-fixed material, we examined in the course of our work with the Leipzig heart collection, additional genes which have been associated with cardiac malformations. We searched for sequence variations affecting the binding domains of MEF2C and HEY2. In the case of MEF2C gene, no nonsynonymous mutations have been detected in a total of 68 patients with complex CHD (unpublished results). A similar finding was observed with the HEY2 gene, where only three nonsynonymous mutations were found in 2 of 52 patients [37]. Our work on TBX5 in the same heart collection likewise supports reliability of using the material [18]. Mutations in this T-box transcription factor has been associated with Holt-Oram syndrome (HOS), a disorder characterized by heart and upper limb deformities [12]. We amplified 200, 307, 276, 203 and 515 bp containing exons 3, 4, 5, 7 and 8, respectively in the same heart collection. The sequences encoding the T-box are located in exons 3, 4 and 5. We found a total of nine nonsynonymous mutations distributed in few patients with ASDs and AVSDs. None of the 29 VSDs carried any nonsynonymous mutations, only two synonymous mutations were found in two patients. To assess further method reliability, we investigated in the same patient cohort amplified fragments from other genes, with or without prior implication to heart development (e.g. CFC1, HMGN4 and BRCC2), in the same heart collection, as well as in formalin-fixed normal mouse heart s (e.g. Hand1, Nkx2-5 and Gata4) but did not find sequence alterations [37].

Conclusion

We identified hotspots associated with cardiac defects in the 3'-UTR region. Our results suggest that somatic GATA4 mutations in the 3'-UTR may provide an additional molecular rationale for CHD

Methods

Materials, genomic DNA isolation, and mutation detection have been described previously [16]. Briefly, we analyzed 68 formalin-fixed hearts of Caucasians with complex cardiac malformations, notably n = 29 with ventricular (VSD), n = 16 with atrial (ASD), and n= 23 with atrioventricular (AVSD) septal defects. The explanted hearts, which were collected between 1954–1982, were obtained from the Institute of Anatomy, University of Leipzig, Germany. We also analyzed blood samples of 12 Caucasian patients with CHD, and blood samples of 100 unrelated healthy Caucasian individuals. In blood samples, defects of patients with CHD included VSD, ASD, hypoplastic left heart syndrome (HLHS), transposition of the great arteries (TGA), sub-pulmonary stenosis (SPS) and heterotaxy. Except for two patients who came from the same family, 10/12 patients were unrelated individuals. In the formalin-fixed malformed hearts, diseased tissues in the vicinity of the septal defects were analyzed. Matched healthy heart tissues were likewise investigated for sequence alterations. Materials used in this study were obtained in accordance to an approved protocol. JB has obtained approval to conduct genetic studies involving human materials from the Medical School Hannover. The formalin-fixed hearts were collected more than 40 years ago and cadavers were donated voluntarily by patients' relatives. The primers and PCR conditions used in investigating sequence variations of GATA4 are given in Table 1. PCR-amplified fragments were sequenced directly using BigDyeTerminator v3.1 Kit (Applied Biosystems, Darmstadt, Germany) and Applied Biosystems 3100 Genetic Analyzer. Sequences were analyzed using SeqScape 2.0 (Applied Biosystems) or DNASTAR Lasergene 6.0 (Madison, Wisconsin USA). The numbering of mutations within the coding region of GATA4 starts with nucleotide A of the first codon ATG, while that in the untranslated region was based on NM_002052. Nucleotide changes in the untranslated and intronic regions were numbered according to suggested nomenclature [24]. Sequence variations were verified by independent PCR, double-strand sequencing, PCR-RFLP, or cloning of heterozygous genotypes followed by subsequent sequencing of clones, allowing the identification of variant alleles. Unless reported as NCBI dbSNPs, we refer to nucleotide changes as sequence variations or mutations interchangeably, which simply means deviations from the reference GATA4 sequence (NM_002052), and disease-causing or not.

Abbreviations

CHD Congenital heart disease ASD Atrial septal defect VSD Ventricular septal defect AVSD Atrioventricular septal defect UTR Untranslated region

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

SMRB participated in the conceptual design of the study, was responsible for the lab work, carried out analysis and interpretation of the data, and drafted the manuscript. SHC participated in the screening, confirmation, and analysis of mutations as part of her M.D. project. JB was in-charge of the conceptual design of the study, participated in the analysis and interpretation of the data, and in the final writing of the manuscript. All authors have read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here:
  41 in total

Review 1.  The zinc finger-containing transcription factors GATA-4, -5, and -6. Ubiquitously expressed regulators of tissue-specific gene expression.

Authors:  J D Molkentin
Journal:  J Biol Chem       Date:  2000-12-15       Impact factor: 5.157

2.  A novel GATA4 mutation completely segregated with atrial septal defect in a large Japanese family.

Authors:  A Okubo; O Miyoshi; K Baba; M Takagi; K Tsukamoto; A Kinoshita; K Yoshiura; T Kishino; T Ohta; N Niikawa; N Matsumoto
Journal:  J Med Genet       Date:  2004-07       Impact factor: 6.318

3.  HEY2 mutations in malformed hearts.

Authors:  Stella Marie Reamon-Buettner; Juergen Borlak
Journal:  Hum Mutat       Date:  2006-01       Impact factor: 4.878

Review 4.  Somatic gene mutation and human disease other than cancer.

Authors:  Robert P Erickson
Journal:  Mutat Res       Date:  2003-03       Impact factor: 2.433

5.  GATA4 mutations cause human congenital heart defects and reveal an interaction with TBX5.

Authors:  Vidu Garg; Irfan S Kathiriya; Robert Barnes; Marie K Schluterman; Isabelle N King; Cheryl A Butler; Caryn R Rothrock; Reenu S Eapen; Kayoko Hirayama-Yamada; Kunitaka Joo; Rumiko Matsuoka; Jonathan C Cohen; Deepak Srivastava
Journal:  Nature       Date:  2003-07-06       Impact factor: 49.962

Review 6.  GATA transcription factors in the developing and adult heart.

Authors:  Sampsa Pikkarainen; Heikki Tokola; Risto Kerkelä; Heikki Ruskoaho
Journal:  Cardiovasc Res       Date:  2004-08-01       Impact factor: 10.787

7.  Somatic NKX2-5 mutations as a novel mechanism of disease in complex congenital heart disease.

Authors:  S M Reamon-Buettner; J Borlak
Journal:  J Med Genet       Date:  2004-09       Impact factor: 6.318

8.  TBX5 mutations in non-Holt-Oram syndrome (HOS) malformed hearts.

Authors:  Stella Marie Reamon-Buettner; Juergen Borlak
Journal:  Hum Mutat       Date:  2004-07       Impact factor: 4.878

9.  MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.

Authors:  Akane Shibayama; Edwin H Cook; Jinong Feng; Cecile Glanzmann; Jin Yan; Nick Craddock; Ian R Jones; David Goldman; Leonard L Heston; Steve S Sommer
Journal:  Am J Med Genet B Neuropsychiatr Genet       Date:  2004-07-01       Impact factor: 3.568

10.  Novel NKX2-5 mutations in diseased heart tissues of patients with cardiac malformations.

Authors:  Stella Marie Reamon-Buettner; Hartmut Hecker; Katharina Spanel-Borowski; Steffen Craatz; Eberhard Kuenzel; Juergen Borlak
Journal:  Am J Pathol       Date:  2004-06       Impact factor: 4.307

View more
  36 in total

1.  Investigating ANKH and ENPP1 in Slovakian families with chondrocalcinosis.

Authors:  Ana Rita Couto; Yun Zhang; Andrew Timms; Jacome Bruges-Armas; Jorge Sequeiros; Matthew A Brown
Journal:  Rheumatol Int       Date:  2011-08-03       Impact factor: 2.631

Review 2.  Transcription factor pathways and congenital heart disease.

Authors:  David J McCulley; Brian L Black
Journal:  Curr Top Dev Biol       Date:  2012       Impact factor: 4.897

3.  GATA4 expression is primarily regulated via a miR-26b-dependent post-transcriptional mechanism during cardiac hypertrophy.

Authors:  Mingyue Han; Zhi Yang; Danish Sayed; Minzhen He; Shumin Gao; Lin Lin; Seonghun Yoon; Maha Abdellatif
Journal:  Cardiovasc Res       Date:  2012-01-04       Impact factor: 10.787

Review 4.  Characterization of DNA methylation-based markers for human body fluid identification in forensics: a critical review.

Authors:  Farzeen Kader; Meenu Ghai; Ademola O Olaniran
Journal:  Int J Legal Med       Date:  2019-11-12       Impact factor: 2.686

5.  Melanocortin-4 receptor (MC4R) polymorphisms are associated with growth and meat quality traits in sheep.

Authors:  Beiyao Zuo; Guiqiong Liu; Yuqin Peng; Hongguang Qian; Jiasen Liu; Xunping Jiang; Adama Mara
Journal:  Mol Biol Rep       Date:  2014-07-22       Impact factor: 2.316

6.  Expression and functional analysis of NUCLEAR FACTOR-Y, subunit B genes in barley.

Authors:  Mingxiang Liang; David Hole; Jixiang Wu; Tom Blake; Yajun Wu
Journal:  Planta       Date:  2011-11-01       Impact factor: 4.116

7.  Mutations of the GATA4 and NKX2.5 genes in Chinese pediatric patients with non-familial congenital heart disease.

Authors:  Ting Peng; Li Wang; Shu-Feng Zhou; Xiaotian Li
Journal:  Genetica       Date:  2010-11-26       Impact factor: 1.082

8.  Chromosome 8p23.1 deletions as a cause of complex congenital heart defects and diaphragmatic hernia.

Authors:  Margaret J Wat; Oleg A Shchelochkov; Ashley M Holder; Amy M Breman; Aditi Dagli; Carlos Bacino; Fernando Scaglia; Roberto T Zori; Sau Wai Cheung; Daryl A Scott; Sung-Hae Lee Kang
Journal:  Am J Med Genet A       Date:  2009-08       Impact factor: 2.802

9.  Functional characterization of CDK5 and CDK5R1 mutations identified in patients with non-syndromic intellectual disability.

Authors:  Silvia Moncini; Paola Castronovo; Alessandra Murgia; Silvia Russo; Maria Francesca Bedeschi; Marta Lunghi; Angelo Selicorni; Maria Teresa Bonati; Paola Riva; Marco Venturin
Journal:  J Hum Genet       Date:  2015-12-10       Impact factor: 3.172

10.  A Rapid, High-Quality, Cost-Effective, Comprehensive and Expandable Targeted Next-Generation Sequencing Assay for Inherited Heart Diseases.

Authors:  Kitchener D Wilson; Peidong Shen; Eula Fung; Ioannis Karakikes; Angela Zhang; Kolsoum InanlooRahatloo; Justin Odegaard; Karim Sallam; Ronald W Davis; George K Lui; Euan A Ashley; Curt Scharfe; Joseph C Wu
Journal:  Circ Res       Date:  2015-08-11       Impact factor: 17.367

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.