| Literature DB >> 17583948 |
Dzmitry Shcharbin1, Elzbieta Pedziwiatr, Louis Chonco, Jesus F Bermejo-Martín, Paula Ortega, F Javier de la Mata, Ramon Eritja, Rafael Gómez, Barbara Klajnert, Maria Bryszewska, Ma Angeles Muñoz-Fernandez.
Abstract
Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.Entities:
Mesh：
Substances：
Year: 2007 PMID： 17583948 DOI： 10.1021/bm070333p
Source DB: PubMed Journal: Biomacromolecules ISSN： 1525-7797 Impact factor: 6.988