Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription.