Literature DB >> 17479370

Lithium chloride inhibits the coronavirus infectious bronchitis virus in cell culture.

Sally M Harrison1, Ian Tarpey, Lisa Rothwell, Pete Kaiser, Julian A Hiscox.   

Abstract

The avian coronavirus infectious bronchitis virus (IBV) is a major economic pathogen of domestic poultry that, despite vaccination, causes mortality and significant losses in production. During replication of the RNA genome there is a high frequency of mutation and recombination, which has given rise to many strains of IBV and results in the potential for new and emerging strains. Currently the live-attenuated vaccine gives poor cross-strain immunity. Effective antiviral agents may therefore be advantageous in the treatment of IBV. Lithium chloride (LiCl) is a potent inhibitor of the DNA virus herpes simplex virus but not RNA viruses. The effect of LiCl on the replication of IBV was examined in cell culture using two model cell types; Vero cells, an African Green monkey kidney-derived epithelial cell line; and DF-1 cells, an immortalized chicken embryo fibroblast cell line. When treated with a range of LiCl concentrations, IBV RNA and protein levels and viral progeny production were reduced in a dose-dependent manner in both cell types, and the data indicated that inhibition was a cellular rather than a virucidal effect. Host cell protein synthesis still took place in LiCl-treated cells and the level of a standard cellular housekeeping protein remained unchanged, indicating that the effect of LiCl was specifically against IBV.

Entities:  

Mesh:

Substances:

Year:  2007        PMID: 17479370      PMCID: PMC7154305          DOI: 10.1080/03079450601156083

Source DB:  PubMed          Journal:  Avian Pathol        ISSN: 0307-9457            Impact factor:   3.378


Introduction

Coronaviruses are a family of positive-sense, single-stranded RNA viruses that replicate in the cytoplasm of infected cells. Infectious bronchitis virus (IBV) is a highly pathogenic respiratory pathogen of chickens that can also affect the kidneys and reproductive systems (Raj & Jones, 1996; Cavanagh, 2005), therefore resulting in both bird mortality and decreased reproductivity (Ignjatovic & Sapats, 2000). As with all coronaviruses, the IBV input genomic RNA is translated by host cell ribosomes to generate an RNA-dependent RNA polymerase (Rep1a, Rep1ab) (Lai & Cavanagh, 1997). This complex is responsible for the transcription of viral subgenomic mRNAs via a discontinuous mechanism (Pasternak et al., 2006) and the generation of new genomic RNA. Both the genomic and subgenomic mRNA are 3′ co-terminal and share a common 3′ untranslated region (UTR), whereas the 5′ end of the genomic mRNA has a unique 5′ UTR. While live attenuated vaccines are used to prevent infection with IBV, these give little cross-strain immunity (Cavanagh, 2005; Gelb et al., 2005; Liu et al., 2006). The problem of vaccination efficiency against IBV is compounded due to the extensive antigenic variation between different strains (Jackwood et al., 2005; Bochkov et al., 2006), caused by the high frequency of mutations due to error-prone replication and also recombination (Wang et al., 1993; Kottier et al., 1995; Lee & Jackwood, 2000). Other important steps that are taken to control IBV infection are serological monitoring to determine virus exposure, reverse transcriptase-polymerase chain reaction (RT-PCR) to detect viral RNA, and enzyme-linked immunosorbent assay and haemagglutination inhibition to detect IBV antibodies (Adzhar et al., 1996; Chen et al., 2003). Due to the high probability of new and emerging strains of IBV and other coronaviruses in general, such as severe acute respiratory syndrome coronavirus (Peiris et al., 2004), the need to develop alternative strategies to vaccination is paramount (Cavanagh, 2003, 2005; Weiss & Navas-Martin, 2005). Our understanding of the action of lithium chloride (LiCl) on the replication of a range of DNA and RNA viruses is limited. LiCl inhibits the replication of the DNA virus herpes simplex (Skinner et al., 1980), whereas with the RNA viruses, encephalomyocarditis virus and influenza virus, there was no apparent effect on virus biology (Skinner et al., 1980). Previous studies have also determined that inhibition of virus is specific to the presence of lithium ions, as no reduction in virus replication was seen in cells treated with potassium or sodium chloride (Skinner et al., 1980). Following the potential application of LiCl to treat DNA virus infection, we investigated the antiviral effects of LiCl on IBV in two cell systems; Vero cells, an African Green monkey kidney-derived epithelial cell line; and DF-1 cells, an immortalized chicken embryo fibroblast cell line. Although Vero cells have been used extensively as a permissible cell line to study virus replication (Casais et al., 2003; Britton et al., 2005), cell biology (Dove et al., 2006a) and protein targeting (Dove et al., 2006b; Reed et al., 2006), recent data suggest potential discrepancies in virus biology, in terms of protein trafficking, between avian and mammalian cell lines (Pendleton & Machamer, 2006); therefore, both Vero and chicken cells were used in this study.

Materials and Methods

Cell culture and virus production.

Vero cells (an African green monkey kidney-derived epithelial cell line) and DF-1 cells (Doug Foster, a chicken embryo fibroblast-derived epithelial cell line) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% foetal bovine serum at 37°C in the presence of 5% CO2, as described previously (Dove et al., 2006a). IBV Beaudette US, a strain adapted for growth in Vero cells (Alonso-Caplen et al., 1984), was propagated in Vero and DF-1 cells and the virus harvested at 24 h post infection (p.i.). The virus titre was calculated by plaque assay titration in either Vero or DF-1 cells (Dove et al., 2006a). All cell culture experiments were conducted in the absence of antibiotic or anti-fungal agents.

Treatment of cells with LiCl.

Vero and DF-1 cells were seeded at 2 × 105 in 7 cm2 tissue culture dishes and grown to 70% confluency prior to mock or infection with IBV at 2 × 106 plaque-forming units/ml. At 8 h p.i. the cells were treated with 0, 5, 10, 25 or 50 mM LiCl, and at 24 h p.i. mock and infected cells were lysed or prepared for subsequent plaque assays.

Preparation of total cellular protein.

Mock and IBV-infected Vero and DF-1 cells were harvested 24 h p.i. and lysed using RIPA buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulphate, Complete Protease Inhibitor at a dilution of 1/25; Roche). Total protein was quantified by the BCA assay (Promega) and western blot analysis was performed.

Western blot analysis.

Ten micrograms of total protein were denatured in Invitrogen NuPage LDS sample reducing buffer containing NuPage reducing agent, and were separated on a NuPage Bis-Tris 10% pre-cast gel in 1 × MOPS running buffer. Proteins were then electro-transferred onto a polyvinylidene fluoride membrane with transfer buffer that contained 25 mM Bicine, 25 mM Bis—Tris and 10% (v/v) methanol. Western blotting was performed using luminol 3-aminophthalydrazide (Sigma). IBV proteins were detected using a chicken anti-IBV polyclonal antibody (diluted 1:20 000) (Charles Rivers). Mouse anti-GAPDH (6C5) antibody (diluted 1:40 000) (AbCam) was used to detect GAPDH. Horseradish peroxidase-conjugated rabbit anti-chicken and goat anti-mouse secondary antibodies (1:1000 dilution) (Sigma) used as appropriate.

Plaque assay analysis of virus.

Tissue culture dishes (7 cm2) were seeded at 2 × 105 with either Vero or DF-1 cells and grown until confluent. A serial dilution of progeny virus was performed in Dulbecco's modified Eagle's medium with 10% foetal bovine serum ranging from 10–1 to 10–3 for IBV grown in Vero cells, and from 10–1 to 10–6 for IBV grown in DF-1 cells. Individual wells were then infected in duplicate with the range of virus dilutions and incubated at 37°C in the presence of 5% CO2 for 1 h before being over-laid with 1% low melting point agarose in Dulbecco's modified Eagle's medium with 10% foetal bovine serum. The cells were then incubated at 37°C for 72 h before being stained with gentian violet (1% crystal violet, 10% formaldehyde (40%) and 5% EtOH in phosphate-buffered saline). The virus titre was determined by counting the number of plaques formed at a specific dilution (Dove et al., 2006a).

Preparation of total cellular RNA.

Total cellular RNA was extracted at 0 and 24 h p.i. by the RNeasy method (Qiagen) according to the manufacturer's instructions.

Taqman analysis of IBV genomic and subgenomic mRNA.

IBV genomic and subgenomic RNA levels in mock and virus-infected Vero and DF-1 cells treated with 0, 5, 10, 25, 50 mM LiCl were quantified by TaqMan real-time RT-PCR (for other examples, see Kaiser et al., 2003; Bicknell et al., 2005). Primers and probes for the IBV 5′ UTR to detect genomic RNA and the cellular 28S rRNA were designed using the Primer Express software program (Applied Biosystems). A primer and probe set to detect the IBV 3′ UTR was designed manually as the software did not detect any optimum sequences. The primer and probe sets used in this study are detailed in Table 1 and are based upon the Beaudette US strain (accession number AAA46214).
Table 1.

Primer and probe sets used for the Taqman RT-PCR in this study

TargetForward primerReverse primerProbea
Vero 28SGGCGAAAGACTA ATCGAACCATCGAGAGCGCCAG CTATCCTTAGTAGCTGGTT CCCTCCGAAGTT TCCCT
Chicken 28SGGCGAAGCC AGAGGAAACTGACGACCGATTT GCACGTCAGGACCGCTACG GACCT CCACCA
IBV 5′ UTRCGTACCGGTTCT GTTGTGTGAGCCCAACGCTAG GCTCAATCACCTCCCCCC ACATACC TCTAA GGG
IBV 3′ UTRACGAACGGTAGA CCCTTAGA TTTT AATTTGGGCGTCCTAG TGCTGTACTAATACTCAGCGTGG CCCCGGCA

At the 5′ end of each probe was the fluorescent reporter dye 5-carboxyfluorescein, and at the 3′ end was the quencher N,N,N, N′-tetramethyl-6-carboxyrhodamine.

At the 5′ end of each probe was the fluorescent reporter dye 5-carboxyfluorescein, and at the 3′ end was the quencher N,N,N, N′-tetramethyl-6-carboxyrhodamine. The TaqMan FAST universal PCR Master Mix (Multiscribe) and RNase inhibitor mix (Applied Biosystems) were used to perform real-time quantitative RT-PCR. Detection and amplification of RNA levels using the 28S, 5′ UTR and 3′ UTR probes were carried out using the 7500FAST TaqMan machine (Applied Biosystems). The following cycle profile was used: one cycle of 48°C for 30 min (RT step) and 95°C for 20 sec (Taq activation), then 40 cycles of 95°C for 3 sec (melting step) and 60°C for 30 sec (anneal and extension step). Quantification was based on increased fluorescence detected due to the 5′ exonuclease activity of the Taq DNA polymerase during PCR amplification hydrolysing the target specific probes. The reporter signal was normalized by the reference dye 6-carboxy-c-rhodamine, which was not actually involved in amplification. Results are expressed in terms of threshold cycle (Ct) values; the cycle at which the change in reporter dye passes a significance threshold (ΔRn). Variation in sampling and RNA preparation was accounted for by standardizing the Ct values for the IBV 5′ UTR-specific and 3′ UTR-specific products for each sample to the Ct value of the 28S rRNA product for the same sample. RNA levels between samples in the same experiment were normalized by pooling values from all samples in that experiment and calculating the mean Ct value for the 28S rRNA-specific gene product. Variations in each individual 28S rRNA sample compared with the mean were then calculated. Differences in the input of total RNA were calculated by determining the slope of the 28S rRNA log10 dilution series regression line. Using the slopes of the respective IBV 5′ UTR, IBV 3′ UTR or 28S rRNA log10 dilution series regression lines, the difference in input total RNA, as represented by the 28S rRNA, was then used to adjust the IBV 5′ UTR-specific or IBV 3′ UTR-specific Ct values. This was done as follows: where Ct is the mean sample Ct, Nt is the experimental 28S mean, Ct′ is the mean 28S of sample, S is the IBV 5′ UTR/IBV 3′ UTR slope, and S′ is the 28S slope. Results were then expressed as 40 – Ct values.

Results and Discussion

Previously it has been shown that LiCl has an antiviral effect on herpes simplex virus (Cernescu et al., 1988; Ziaie & Kefalides, 1989; Ziaie et al., 1994) when used at concentrations ranging from 1 to 10 mM. The same trend in reduced viral yield is seen in the DNA viruses pseudorabies and vaccinia. However, inhibition was not observed in the RNA viruses influenza and encephalomyocarditis (Skinner et al., 1980). This study investigated the effects of LiCl on IBV replication in cell culture.

LiCl treatment reduces progeny virus production in both IBV-infected Vero and DF-1 cells.

To determine whether LiCl had an inhibitory effect on IBV growth in vitro, Vero and DF-1 cells were infected with IBV and then left untreated or treated with increased concentrations of LiCl ranging from 5 to 50 mM. Virus progeny production was quantified by plaque assay at 24 h p.i. The data indicated that with the lowest concentration of LiCl tested (5 mM) there was an approximately 50% reduction in virus titre compared with untreated IBV-infected cells, and at the highest concentration (50 mM) virus progeny production was abrogated, as determined by plaque assay (Figures 1 and 2). Although the data indicated that IBV grew better in DF-1 cells compared with Vero cells, as evidenced by plaque formation at 10–6 dilution of progeny virus from DF-1 cells compared with 10–3 dilution in Vero cells, the equivalent reduction in virus titre with LiCl treatment was observed in both Vero and DF-1 cells. There was no apparent difference in the plaque morphology of IBV between Vero and DF-1 cells, and likewise at any concentration of treatment with LiCl.
Figure 1.

Plaque assay showing plaque formation in (1a) Vero cells and (1b) DF-1 cells infected with progeny IBV from cells treated with the concentrations of LiCl indicated to the left. Due to IBV replicating less efficiently in Vero cells compared with DF-1 cells, only three-fold to 10-fold serial dilutions of progeny IBV from Vero cells were required compared with six-fold to 10-fold serial dilutions of progeny IBV from DF-1 cells. The experiment was repeated three times and one representative set of data are presented, the average plaque-forming units/ml is indicated to the right.

Figure 2.

Histogram showing the relative virus titre of progeny virus from Vero cells (grey) and DF-1 cells (dark grey) treated with the concentrations of LiCl indicated on the x axis as compared with those cells untreated (=100%).

LiCl does not have a direct virucidal effect on IBV.

In the above experiments, LiCl may have exerted its inhibitory effect either via interfering with viral or cellular processes or through a direct virucidal effect on progeny virus that is present in the supernatant, both of which would result in a drop in progeny virus production. Therefore, to distinguish between these possibilities (i.e. to determine whether LiCl has a direct virucidal effect on IBV), a 0.5 ml preparation of IBV (∼2 × 106 plaque-forming units/ml) was treated with 5 to 50 mM LiCl. As controls, this concentration of virus was also incubated for 1 h and 16 h at either 4°C or 37°C to assess the effects of temperature in the presence of the different concentrations of LiCl. After these treatments the amount of virus was determined by plaque assay. The data indicated that there was no significant variation in virus titre of IBV treated with the range of LiCl concentrations, and therefore LiCl did not have a direct virucidal effect on IBV (Figure 3). However, temperature was shown to influence the IBV titre; when the virus was incubated at 4°C for 1 h, the titre was approximately 10-fold higher than when the virus was incubated at 4°C for 16 h. When the virus was incubated at 37°C for 16 h, the virus was rendered non-infectious (data not shown).
Figure 3.

Histogram showing the relative average virus titre of IBV treated directly with the concentrations of LiCl shown at 4°C (light grey) or 37°C (dark grey) for 1 h or at 4°C for 16 h (white), as assayed in DF-1 cells.

LiCl treatment causes a dose-dependent decrease in the synthesis of IBV protein in infected Vero and DF-1 cells.

To determine the effect of LiCl on virus protein production, the amount of IBV nucleocapsid (N) protein was assayed by western blot. N protein binds viral RNA with high affinity (Chen et al., 2005; Spencer & Hiscox, 2006) and is one of the most abundantly expressed viral proteins in an infected cell (Laude & Masters, 1995), and can thus be used as a sensitive marker for viral protein production. The potential effect of LiCl on cellular protein expression was determined by examining the amount of GAPDH, a cellular housekeeping protein, compared with total protein present. Cell lysates were prepared from either mock-infected or IBV-infected Vero and DF-1 cells either untreated or treated with 5 to 50 mM LiCl. The yield of total protein was determined using the BCA assay and equivalent amounts of protein extract from each experimental treatment used for western blot analysis. The data indicated that the amount of N protein decreased in proportion to the amount of LiCl treatment with apparent abrogation in the amount of N protein when either Vero or DF-1 cells are treated with 50 mM LiCl. Western blot analysis indicated that the amount of GAPDH did not vary between LiCl-treated or untreated Vero or DF-1 cells. Thus the effect of LiCl on the amount of protein was specific to IBV (Figure 4).
Figure 4.

Western blot analysis of the amount of IBV N protein in mock and IBV-infected (4a) Vero cells and (4b) DF-1 cells treated with the concentrations of LiCl indicated above each blot. GAPDH was used as a marker for cellular protein levels. The migration of molecular weight markers is indicated to the left.

The reduction in progeny virus production could therefore be due to the decreased amount of virus proteins observed in infected cells treated with LiCl. This may be a result of either a reduction in the translation of viral subgenomic mRNAs or a decrease in the amount of subgenomic mRNAs themselves. With regard to the former possibility, as the translation of both viral and cellular mRNAs is cap dependent, if LiCl affected this then we would predict cellular translation would also be decreased. However, analysis of the amount of GAPDH suggested that this protein was unaffected by LiCl. Therefore, LiCl may act as an inhibitor at the level of genomic RNA and subgenomic mRNA synthesis (with a corresponding effect on translation). Previous studies on herpes simplex virus have shown that LiCl inhibits DNA synthesis (Skinner et al., 1980), and therefore it is possible to tentatively hypothesize that LiCl may inhibit RNA-dependent RNA polymerases, which are characteristic of positive and negative stranded RNA viruses. One possibility is that the activity of components of the IBV-encoded RNA-dependent RNA polymerases may be affected by LiCl. As the activity of the severe acute respiratory syndrome coronavirus helicase is magnesium dependent (Tan et al., 2004), and metal ions can also inhibit the activity of the severe acute respiratory syndrome coronavirus 3CL protease (Hsu et al., 2004), the same may also be true for IBV. Another precedence for this is the inhibition by LiCl of the activity of certain cellular proteins. For example, LiCl can inhibit glycogen synthase kinase 3 beta by several different mechanisms (Doble & Woodgett, 2003; Jope, 2003), including competition for magnesium ions (Ryves et al., 2002). These hypotheses were tested by comparing the levels of viral RNA between infected cells treated and untreated with LiCl.

LiCl treatment causes a reduction in IBV genomic and subgenomic RNA levels in infected Vero and DF-1 cells.

To determine the effect of LiCl on virus genomic and subgenomic RNA levels, TaqMan RT-PCR analysis was performed on RNA extracted from mock and infected LiCl-treated cells at 16 h p.i., using primer and probe sets designed against the IBV 5′ UTR and 3′ UTR, respectively. These would detect the genomic RNA (5′ UTR sets) and both the genomic RNA and subgenomic mRNAs (3′ UTR sets). The data indicated that in both Vero and DF-1 cells treated with LiCl, there was an overall reduction in viral RNA levels as the concentration of LiCl was increased (Figure 5a, b, respectively). For example, there was an approximately 20-fold decrease in subgenomic mRNA levels between untreated cells and those treated with 5 mM LiCl in Vero and DF-1 cells (each 40 – Ct value represents a two-fold difference). The RNA levels indicated that the amount of genomic RNA decreased and was not significantly different between 5 and 50 mM LiCl treatment. However, the total positive-sense RNA (subgenomic and genomic) in DF-1 cells generally decreased in a dose-dependent manner (except not between 5 and 10 mM LiCl) as the concentration of LiCl was increased. This may account for the general reduction in the amount of N protein observed in infected cells treated with increasing concentrations of LiCl.
Figure 5.

Real-time RT-PCR analysis of the levels of IBV genomic RNA as well as genomic and subgenomic mRNAs, as determined by analysis of the IBV 5′ UTR (light grey) and 3′ UTR (dark grey), respectively, in infected (5a) Vero cells and (5b) DF-1 cells.

These data suggest the potential use of LiCl as an antiviral agent against IBV and, by inference, in terms of having common genome and replication strategies, other coronaviruses. Whether or not LiCl could be used in the field against IBV remains to be determined, but certainly it would have application in the laboratory for studying the molecular biology of IBV.
  35 in total

1.  Supplementing the feeds of layer pullets, at different ages with two different fiber sources improves immune function.

Authors:  Sherzad M Hussein; Johnny S Yokhana; Theresa L Frankel
Journal:  Poult Sci       Date:  2017-08-01       Impact factor: 3.352

2.  Association between serum lithium level and incidence of COVID-19 infection.

Authors:  Livia J De Picker; Marion Leboyer; John R Geddes; Manuel Morrens; Paul J Harrison; Maxime Taquet
Journal:  Br J Psychiatry       Date:  2022-07       Impact factor: 10.671

3.  Generation and characterization of chicken bone marrow-derived dendritic cells.

Authors:  Zhiguang Wu; Lisa Rothwell; John R Young; Jim Kaufman; Colin Butter; Pete Kaiser
Journal:  Immunology       Date:  2009-05-15       Impact factor: 7.397

4.  Effect of insoluble fiber supplementation applied at different ages on digestive organ weight and digestive enzymes of layer-strain poultry.

Authors:  J S Yokhana; G Parkinson; T L Frankel
Journal:  Poult Sci       Date:  2015-11-14       Impact factor: 3.352

5.  Action mechanisms of lithium chloride on cell infection by transmissible gastroenteritis coronavirus.

Authors:  Xiaofeng Ren; Fandan Meng; Jiechao Yin; Guangxing Li; Xunliang Li; Chao Wang; Georg Herrler
Journal:  PLoS One       Date:  2011-05-06       Impact factor: 3.240

6.  Toll-like receptor responses to Peste des petits ruminants virus in goats and water buffalo.

Authors:  Sakthivel Dhanasekaran; Moanaro Biswas; Ambothi R Vignesh; R Ramya; Gopal Dhinakar Raj; Krishnaswamy G Tirumurugaan; Angamuthu Raja; Ranjit S Kataria; Satya Parida; Subbiah Elankumaran; Elankumaran Subbiah
Journal:  PLoS One       Date:  2014-11-04       Impact factor: 3.240

7.  The cellular interactome of the coronavirus infectious bronchitis virus nucleocapsid protein and functional implications for virus biology.

Authors:  Edward Emmott; Diane Munday; Erica Bickerton; Paul Britton; Mark A Rodgers; Adrian Whitehouse; En-Min Zhou; Julian A Hiscox
Journal:  J Virol       Date:  2013-05-01       Impact factor: 5.103

8.  The effect of Allium sativum (Garlic) extract on infectious bronchitis virus in specific pathogen free embryonic egg.

Authors:  Tabassom Mohajer Shojai; Arash Ghalyanchi Langeroudi; Vahid Karimi; Abbas Barin; Naser Sadri
Journal:  Avicenna J Phytomed       Date:  2016 Jul-Aug

9.  Lithium chloride combination with rapamycin for the treatment of COVID-19 pneumonia.

Authors:  Rami Bou Khalil
Journal:  Med Hypotheses       Date:  2020-05-01       Impact factor: 1.538

Review 10.  Lithium and coronaviral infections. A scoping review.

Authors:  Jan K Nowak; Jarosław Walkowiak
Journal:  F1000Res       Date:  2020-02-07
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.