Literature DB >> 17326951

Drug trafficking routes and hepatitis B in injection drug users, Manipur, India.

Sibnarayan Datta1, Arup Banerjee, Partha K Chandra, Pradip K Mahapatra, Shekhar Chakrabarti, Runu Chakravarty.   

Abstract

Prevalence of hepatitis B genotype C in injection drug users in the northeastern Indian state of Manipur, neighboring the "Golden Triangle," correlates well with overland drug-trafficking routes, the injection drug use epidemic, and the spread of HIV. Further spread to other regions of India through mobile populations is possible.

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 17326951      PMCID: PMC3291348          DOI: 10.3201/eid1212.060425

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Injection drug use is common in countries neighboring the "Golden Triangle" (Myanmar, Laos, and Thailand), known for heroin export to other countries. HIV and injection drug use outbreaks in countries neighboring the Golden Triangle, including the northeastern Indian state of Manipur, have been associated with drug-trafficking routes (). Manipur shares a 358-km porous border with Myanmar. According to the National AIDS Control Organization, India (http://www.nacoonline.org), HIV infection rates among injection drug users in Manipur increased from 2%–3% in 1989 to >50% in 1991 and ≈64% in 2000. In addition, exposure rates of 100% for hepatitis B virus (HBV) and 92% for hepatitis C virus (HCV) have been detected among injection drug users in Manipur, and 95% of wives of injection drug users had HBV exposure (). However, among both the users and their wives, prevalence of HBV genotypes and occult HBV infection (), a known risk factor for hepatocellular carcinoma (HCC) (), remained unknown. HBV is classified into 8 genotypes, HBV/A through HBV/H, and is further divided into subgenotypes () that have a distinct geographic distribution and are associated with different disease outcomes. The geographic distribution of HBV is known to correlate with the anthropologic history of migration () and to the origin and routes of spread of HBV infection. In addition, behavioral patterns are known to change HBV genotype distribution in a region (). Manipur is an important location, where mainland India (prevalent genotypes HBV/A, HBV/D) geographically meets China and Southeast Asia (prevalent genotypes HBV/B, HBV/C). Our study was designed to detect HBV DNA among injection drug users in Manipur and to analyze HBV genotypes for correlation with injection drug use and the HIV epidemic.

The Study

We examined HIV-positive injection drug users from Manipur who had been identified as anti-HBc–positive during previous serosurveys conducted by the National Institute of Cholera and Enteric Diseases (). Serum samples (stored at –80°C) taken from 63 men 18–25 years of age were available for the study. HBsAg detection was repeated with a monoclonal antibody–based Hepanostika hepatitis B surface antigen (HBsAg) kit (bioMérieux, Marcy l'Etoile, France). Anti-HCV antibody was detected using the Ortho HCV 3.0 test (Ortho-Clinical Diagnostics, Raritan, NJ, USA). We completed HBV DNA isolation, PCR amplification, genotype/subgenotype/subtype identification, recombination detection, and HBV DNA quantification with methods described earlier (–). We also compared nucleotide (Table A1) and deduced amino acid sequences (Table) with consensus sequence of amino acids of corresponding genotypes to detect substitutions (GenBank accession nos. DQ356432–DQ356441).
Table A1

Nucleotide variability in the partial s gene, including the region encoding the major hydrophillic loop, compared with consensus sequences*

Isolate367400414436451454457482484491493494499505511514519520529531544546555562574581586587592598616619629630633
Cn A1TATATTAATTCAACACAAGCCATAAATGTCATGCA
Cn A2GATAGC
Cn DCGCTTCAGACACCTCCG
Cn C1CCGCCCAATTAGTACTTCCTC
Cn C2CGCCCAATTAGTACTTCTG
IDU1ATATCG
IDU2GA
IDU3GCCACTCT
IDU4GCCCATCAGTACTTCCTG
IDU5CGCCCCAATAGTACTCCTC
IDU6CCGCCGCAATCAGTACTTCACTCG
IDU7CCGCCGCAATCGAGTACTTCACTCAG
IDU8CGCCCAATAGTACTTCTG
IDU9CGCCCAATTAGATACTTCTG
IDU10CGCCCAATTGTCTTCTG

*Indicated by Cn, followed by genotype/subgenotype. IDU, injection drug user.

*Indicated by Cn, followed by genotype. HBV, hepatitis B virus; IDU, injection drug user; ND, not detectable by the assay.
†Genotype-specific sites.
‡Subtype-specific sites. All those tested were HBsAg negative, and only 10 (15.9%) had detectable HBV DNA. Anti-HCV was detected in all but 1 sample (no. 4). Serum HBV DNA level was detectable in 5 of 10 samples (Table); the rest were below the detection limit of our assay. HBV/C (all subtype adr except 1 adw2) was the predominant genotype, with 4 subgenotype C1 (HBV/C1) and 3 subgenotype C2 (HBV/C2) isolates. HBV/A1 adw2 was found in 1 of the isolates. Two other isolates (nos. 1 and 3, subtype adw2) indicated a possibility of intergenotypic recombination (Figure 1), but subgenotype could not be assigned for them.
Figure 1

Phylogenetic relationships among the sequences of s gene from hepatitis B virus strains isolated in this study (shown with prefix "IDU") compared with reference sequences from GenBank (accession nos. are shown). Genotype and subgenotypes are indicated at each main branch and subbranch, respectively. Percentage of bootstrap replications supporting the clusters (>75%) are also shown at the nodes.

Phylogenetic relationships among the sequences of s gene from hepatitis B virus strains isolated in this study (shown with prefix "IDU") compared with reference sequences from GenBank (accession nos. are shown). Genotype and subgenotypes are indicated at each main branch and subbranch, respectively. Percentage of bootstrap replications supporting the clusters (>75%) are also shown at the nodes. BLASTN search (http://www.incogen.com/public_documents/vibe/details/NcbiBlastn.html) of sequence from sample no. 1 showed similarity to HBV/D as well as to HBV/A sequences from European countries. On the other hand, sequences from sample no. 3 showed similarity to HBV/C and HBV/A sequences from Southeast Asian countries and India. Simplot analysis confirmed recombination in these 2 isolates (Figure 2). Apart from the genotype-specific substitutions, deduced amino acid sequences did not have any remarkable escape mutant other than G145R in 2 isolates (Table).
Figure 2

The location of recombination events in isolates IDU1 (A) and IDU3 (B), determined by using the bootscanning program of Simplot. Possible tree topologies (a, b, and c) are shown (C). The phylogenetically informative sites and the tree topologies supported at each of those sites are indicated over each plot. In the tree topologies, Q, A, and H indicate query sequences (IDU1 or IDU3), genotype A, and genotype H (outgroup) consensus sequences, respectively. S indicates consensus sequence of genotype D and genotype C for IDU1 and IDU3, respectively. Possible crossover points are indicated by solid triangles. A sliding window size of 60 bp, step size of 10 bp, Kimura-2 parameter, 1,000 bootstrap replicates, and neighbor-joining method were used for the analysis of recombination.

The location of recombination events in isolates IDU1 (A) and IDU3 (B), determined by using the bootscanning program of Simplot. Possible tree topologies (a, b, and c) are shown (C). The phylogenetically informative sites and the tree topologies supported at each of those sites are indicated over each plot. In the tree topologies, Q, A, and H indicate query sequences (IDU1 or IDU3), genotype A, and genotype H (outgroup) consensus sequences, respectively. S indicates consensus sequence of genotype D and genotype C for IDU1 and IDU3, respectively. Possible crossover points are indicated by solid triangles. A sliding window size of 60 bp, step size of 10 bp, Kimura-2 parameter, 1,000 bootstrap replicates, and neighbor-joining method were used for the analysis of recombination.

Conclusions

The data from this study showed occult HBV infection in 15.9% of the injection drug users tested. The rate of HBV DNA detection (10%–45%) was considerably different in studies reported from different cohorts of injection drug users in different countries, a finding that has been attributed to coinfection with HCV or low HBV DNA levels (). Apart from HIV, our study group had a high frequency of HCV infection and low HBV DNA levels. Undetectable HBsAg, except in 2 cases with G145R substitution, may also be a result of the above-mentioned factors. Although the importance of occult HBV infection is not well understood, a recent study reported occult HBV to be a significant risk factor for HCC, especially among persons who were anti-HBc–positive (). Another recent study among HIV-infected patients documented death due to liver disease in 22% who were HBV coinfected, 44% who were HCV/HBV coinfected, and 15% who were HBV coinfected and had HCC (). Thus, the clinical relevance in our study group also needs to be followed. Although we detected a 100% prevalence of anti-HBc in our serosurveys (), only 1 was HBsAg-positive. Therefore, the distribution of genotypes among those who were HBsAg positive could not be determined. Findings of HBV/C1 (prevalent in China) appear to support the history of human migration from China to northeastern India. However, we did not detect HBV/B, also prevalent in China. Further, we did detect HBV/C2, which has close similarity to strains from Southeast Asian countries. The presence of HBV/C correlated well with drug-trafficking routes and the injection drug use epidemic. The geographic proximity of Manipur to the Golden Triangle, needle sharing among injection drug users, and drug traders thus contributed to the spread of HBV through drug-trafficking routes, similar to HIV (1). In Manipur, HIV subtypes C and Thai B are prevalent (); these are also prevalent in the India-Myanmar and China-Myanmar border regions. The presence of similar HIV subtypes among injection drug users in Manipur supports the presence of similar HBV strains (e.g., HBV/C1, HBV/C2) and their cotransmission through drug-trafficking routes. In addition, circulation of recombinant HBV is common among injection drug users because of repeated exposure (). The intergenotypic HBV recombinants found in this study are thus expected. HBV/C has been associated with advanced liver disease and poses a higher risk for HCC in Asians () than does HBV/B. However, the clinical relevance of HBV recombinants and their pathogenesis is not well understood and needs further investigation. Poor, unemployed youths in the northeastern states of India are being recruited for drug trafficking to other regions (http://www.ipcs.org). Furthermore, national highways are associated with the prevalence of injection drug use in rural Manipur (). As these highways connect Manipur with other parts of India, HBV/C may spread from Manipur to other parts of the country through persons who travel regularly, such as truck drivers and drug traffickers. Presence of HBV genotypes A and D among patients from northern and western India is well documented. Recent research reported HBV/C with close similarity to Southeast Asian strains only from eastern India (,) and suggested injection drug users as a possible route of introduction (). In addition, persons from northeastern India frequent Kolkata for education, employment, medical treatment, and other purposes. Studies on these mobile populations might provide further important information on the route, population at risk for infection, and changing epidemiology of these viral infections in other regions. In conclusion, HBV/C, associated with severe liver disease in Southeastern Asia, may be emerging in the Manipur state of India through the trafficking routes of injection drugs. This genotype could spread to the general population through different modes. In light of growing information on the severity of liver disease in HBV-infected HIV/HCV patients, injection drug users should be the focus of additional education and healthcare efforts. The possibility of further spread of HIV/HBV/HCV through mobile populations to other regions of India warrants attention and further investigation.
Table

Serum HBV DNA levels and amino acid variability in the partial s gene, including the region encoding the major hydrophillic loop, compared with consensus sequences*

IsolateSerum HBV DNA
(×103 copies/mL)110†113†114†122‡126†131†134†143†145159†160‡161†163
Cn AISTKTNFTGAKYW
Cn DSTYSGF
Cn CLTSITSRF
IDU1NDSGF
IDU2NDF
IDU345.0TSF
IDU414.0LSITSRF
IDU51.05LTSISF
IDU6NDLTSITSRRFR
IDU7NDLTSITSRTRFR
IDU89.0LTSITSRF
IDU9NDLTSITSRF
IDU1064.0LTSITSRF

*Indicated by Cn, followed by genotype. HBV, hepatitis B virus; IDU, injection drug user; ND, not detectable by the assay.
†Genotype-specific sites.
‡Subtype-specific sites.

  15 in total

1.  Genotypic dominance and novel recombinations in HBV genotype B and C co-infected intravenous drug users.

Authors:  Bing-Fang Chen; Jia-Horng Kao; Chun-Jen Liu; Ding-Shinn Chen; Pei-Jer Chen
Journal:  J Med Virol       Date:  2004-05       Impact factor: 2.327

2.  Genotype, phylogenetic analysis, and transmission pattern of occult hepatitis B virus (HBV) infection in families of asymptomatic HBsAg carriers.

Authors:  Sibnarayan Datta; Arup Banerjee; Partha K Chandra; Abhijit Chowdhury; Runu Chakravarty
Journal:  J Med Virol       Date:  2006-01       Impact factor: 2.327

3.  Relationship of national highway with injecting drug abuse and HIV in rural Manipur, India.

Authors:  K Sarkar; S Panda; N Das; S Sarkar
Journal:  Indian J Public Health       Date:  1997 Apr-Jun

4.  Liver disease as a major cause of death among HIV infected patients: role of hepatitis C and B viruses and alcohol.

Authors:  Dominique Salmon-Ceron; Charlotte Lewden; Philippe Morlat; Sibylle Bévilacqua; Eric Jougla; Fabrice Bonnet; Laurence Héripret; Dominique Costagliola; Thierry May; Geneviève Chêne
Journal:  J Hepatol       Date:  2005-06       Impact factor: 25.083

5.  Genetic diversity of hepatitis B virus strains derived worldwide: genotypes, subgenotypes, and HBsAg subtypes.

Authors:  Helene Norder; Anne-Marie Couroucé; Pierre Coursaget; José M Echevarria; Shou-Dong Lee; Isa K Mushahwar; Betty H Robertson; Stephen Locarnini; Lars O Magnius
Journal:  Intervirology       Date:  2004       Impact factor: 1.763

6.  Phylogenetic relatedness and genetic diversity of hepatitis B virus isolates in Eastern India.

Authors:  Arup Banerjee; Fuat Kurbanov; Sibnarayan Datta; Partha Kumar Chandra; Yasuhito Tanaka; Masashi Mizokami; Runu Chakravarty
Journal:  J Med Virol       Date:  2006-09       Impact factor: 2.327

7.  Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination.

Authors:  K S Lole; R C Bollinger; R S Paranjape; D Gadkari; S S Kulkarni; N G Novak; R Ingersoll; H W Sheppard; S C Ray
Journal:  J Virol       Date:  1999-01       Impact factor: 5.103

8.  High prevalence of occult hepatitis B in Baltimore injection drug users.

Authors:  Michael Torbenson; Rajesh Kannangai; Jacquie Astemborski; Steffanie A Strathdee; David Vlahov; David L Thomas
Journal:  Hepatology       Date:  2004-01       Impact factor: 17.425

9.  Distribution of hepatitis B virus genotypes in blood donors and chronically infected patients in a tertiary care hospital in southern India.

Authors:  Perumal Vivekanandan; Priya Abraham; Gopalan Sridharan; George Chandy; Dolly Daniel; Sukanya Raghuraman; Hubert Darius Daniel; Thenmozhi Subramaniam
Journal:  Clin Infect Dis       Date:  2004-04-09       Impact factor: 9.079

10.  Genotype C hepatitis B virus infection is associated with an increased risk of hepatocellular carcinoma.

Authors:  H L-Y Chan; A Y Hui; M L Wong; A M-L Tse; L C-T Hung; V W-S Wong; J J-Y Sung
Journal:  Gut       Date:  2004-10       Impact factor: 23.059

View more
  10 in total

Review 1.  Insights into human immunodeficiency virus-hepatitis B virus co-infection in India.

Authors:  Runu Chakravarty; Ananya Pal
Journal:  World J Virol       Date:  2015-08-12

2.  Genotyping of hepatitis B virus isolates from Lahaul and Spiti district in Himachal Pradesh, India.

Authors:  Brij Sharma; Harshita Katiyar; Deepesh Barall; Neetu Sharma; Shikha Agnihotry; Amit Goel; Rakesh Aggarwal
Journal:  Indian J Gastroenterol       Date:  2018-06-01

3.  Characterization of treatment-naive HIV/HBV co-infected patients attending ART clinic of a tertiary healthcare centre in eastern India.

Authors:  Debraj Saha; Ananya Pal; Avik Biswas; Rajesh Panigrahi; Neelakshi Sarkar; Jayeeta Sarkar; Manisha Pal; Subhasish Kamal Guha; Bibhuti Saha; Sekhar Chakrabarti; Runu Chakravarty
Journal:  PLoS One       Date:  2013-08-30       Impact factor: 3.240

4.  A rare HBV subgenotype D4 with unique genomic signatures identified in north-eastern India--an emerging clinical challenge?

Authors:  Priyanka Banerjee; Rajiv Kumar Mondal; Madhuparna Nandi; Sumantra Ghosh; Mousumi Khatun; Nabendu Chakraborty; Swatilekha Bhattacharya; Arindam RoyChoudhury; Soma Banerjee; Amal Santra; Samir Sil; Abhijit Chowdhury; Pradip Bhaumik; Simanti Datta
Journal:  PLoS One       Date:  2014-10-08       Impact factor: 3.240

Review 5.  Current Scenario of Hepatitis B and Its Treatment in India.

Authors:  Gautam Ray
Journal:  J Clin Transl Hepatol       Date:  2017-07-08

6.  Occult hepatitis B virus infection in HIV positive patients at a tertiary healthcare unit in eastern India.

Authors:  Debraj Saha; Ananya Pal; Neelakshi Sarkar; Dipanwita Das; Jason T Blackard; Subhasish Kamal Guha; Bibhuti Saha; Runu Chakravarty
Journal:  PLoS One       Date:  2017-06-07       Impact factor: 3.240

7.  Antiretroviral resistance, genotypic characterization and origin of Human Immunodeficiency Virus among the infected wives of Intravenous drug users in Manipur.

Authors:  Adhikarimayum Lakhikumar Sharma; Thiyam Ramsing Singh; Lisam Shanjukumar Singh
Journal:  Sci Rep       Date:  2018-10-12       Impact factor: 4.379

Review 8.  An overview of molecular epidemiology of hepatitis B virus (HBV) in India.

Authors:  Sibnarayan Datta
Journal:  Virol J       Date:  2008-12-19       Impact factor: 4.099

9.  Hepatitis B virus subgenotypes D1 and D3 are prevalent in Pakistan.

Authors:  Saeeda Baig; Anwar Siddiqui; Runu Chakravarty; Tariq Moatter
Journal:  BMC Res Notes       Date:  2009-01-04

10.  Detection of HBV Genotype C in Hepatocellular Carcinoma Patients from North East India: a Brief Report

Authors:  Manash P Sarma; Minakshi Bhattacharjee; Premashis Kar; Subhash Medhi
Journal:  Asian Pac J Cancer Prev       Date:  2018-07-27
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.