Literature DB >> 17267408

Allelic imbalance in gene expression as a guide to cis-acting regulatory single nucleotide polymorphisms in cancer cells.

Lili Milani1, Manu Gupta, Malin Andersen, Sumeer Dhar, Mårten Fryknäs, Anders Isaksson, Rolf Larsson, Ann-Christine Syvänen.   

Abstract

Using the relative expression levels of two SNP alleles of a gene in the same sample is an effective approach for identifying cis-acting regulatory SNPs (rSNPs). In the current study, we established a process for systematic screening for cis-acting rSNPs using experimental detection of AI as an initial approach. We selected 160 expressed candidate genes that are involved in cancer and anticancer drug resistance for analysis of AI in a panel of cell lines that represent different types of cancers and have been well characterized for their response patterns against anticancer drugs. Of these genes, 60 contained heterozygous SNPs in their coding regions, and 41 of the genes displayed imbalanced expression of the two cSNP alleles. Genes that displayed AI were subjected to bioinformatics-assisted identification of rSNPs that alter the strength of transcription factor binding. rSNPs in 15 genes were subjected to electrophoretic mobility shift assay, and in eight of these genes (APC, BCL2, CCND2, MLH1, PARP1, SLIT2, YES1, XRCC1) we identified differential protein binding from a nuclear extract between the SNP alleles. The screening process allowed us to zoom in from 160 candidate genes to eight genes that may contain functional rSNPs in their promoter regions.

Entities:  

Mesh:

Substances:

Year:  2007        PMID: 17267408      PMCID: PMC1865061          DOI: 10.1093/nar/gkl1152

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN: 0305-1048            Impact factor:   16.971


INTRODUCTION

Single nucleotide polymorphisms (SNPs) in genomic regions that regulate gene expression are major causes of human diversity and may also be important susceptibility factors for complex diseases and traits. Several studies have used linkage or association analysis with microarray-based expression data from lymphoblastoid cell-lines from healthy individuals as the quantitative trait, and have identified putative cis- and trans-acting genetic variants that regulate the gene expression levels (1–4). So far only a few studies have addressed the relationship between SNPs in regulatory regions of multiple genes and gene expression levels in human diseases in a systematic way. A recent exception is a study, in which the association between SNPs in 200 candidate genes was analyzed against gene expression levels determined using cDNA arrays in breast cancer tumor samples (5). Using novel statistical tools, this study of 50 tumor samples identified both cis- and trans-acting putative regulatory SNPs (rSNPs). To use the relative expression levels of two SNP alleles (allelic imbalance (AI)) of a gene in the same sample, instead of the total expression level as the quantitative phenotype is an alternative approach for identifying cis-acting rSNPs or haplotypes (6–10). A major advantage of this approach is that the two SNP alleles are measured in the same environment, and serve as internal standards for each other to control other than cis-acting genetic factors and environmental factors that may cause differences in the expression levels between samples. AI in expression has proven to be a common phenomenon for human genes. One study detected AI in the expression of 326 out of 602 human genes (54%) by using Affymetrix HuSNP oligonucleotide arrays to study kidney and liver tissues from seven fetuses (11). By analyzing leukocytes from 12 individuals using allele-specific oligonucleotide hybridization arrays (Perlegen Sciences) another study found AI in 731 out of 1389 informative genes (53%) (12). In addition to allele-specific hybridization on microarrays, a variety of other genotyping methods have been applied to detect AI (6–8,13–15). Due to variation in the sensitivity and specificity of the methods, and the limited number of samples or SNPs included in these studies, the frequency estimates for AI vary largely between studies, from 18 to 60% of the analyzed genes. Imbalanced expression of alleles has also been detected using bioinformatics tools, comparing the allele frequencies of SNPs in expressed sequence tags (ESTs) databases to the allele frequencies in Centre d’Etude du Polymorphisme Humain (CEPH) samples from the Haplotype Mapping project (16). This study estimated that AI occurred for 36% of over 2500 analyzed genes, and AI was experimentally verified for 40 of the genes by sequencing. In the current study, we established a process for systematic screening for cis-acting rSNPs using experimental detection of AI as an initial approach. An approach with similar steps as in our study, but performed in a different order than in our process, was recently described for identifying rSNPs that are associated with osteoarthritis (7). Inspired by a number of studies that have identified putative rSNPs in genes related to cancer (14,17,18) and the response to treatment with anticancer drugs (19–22), we used a panel of cell lines that represent different types of cancers and have been well characterized for their response patterns against anticancer drugs (23) as target cells in our study. For detecting AI in the expression of candidate genes for cancer and anticancer drug response we used our ‘in house’ developed tag-microarray minisequencing system, which we have previously shown to be accurate and sensitive for quantitative detection of AI (15). Genes that displayed AI were then subjected to bioinformatics-assisted identification of rSNPs that alter the strength of transcription factor binding in their upstream regulatory regions. The putative rSNPs were tested for their protein-binding capacity using electrophoretic mobility shift assays (EMSAs). This process allowed us to zoom in from the 160 originally selected candidate genes to eight genes that might contain rSNPs that affect the transcription levels of the genes.

MATERIALS AND METHODS

Cell lines

A panel of 13 human tumor cell-lines consisting of drug-sensitive parental cell-lines and resistant subtypes was analyzed. Table 1 presents a summary of the cell lines, including their origin, parental cell-lines and the resistant subtypes and the selecting agents used to create resistant subtypes. The cell-line cultures have regularly been monitored and found negative for mycoplasma contamination. The cell lines have been described in detail by Dhar et al. (23).
Table 1.

Summary of cell lines analyzed

Parental CLResistant CLOriginSelecting agent
8226/S8226/DoxMyelomaDoxorubicin
8226/LR5MyelomaMelphalan
CCRF-CEMCEM/VM-1T-cell leukemiaTeniposide
NCI-H69H69ARSmall cell lung cancerDoxorubicin
U937-GTBU937/VCRHistiocytic lymphomaVincristine
GTB/CHSHistiocytic lymphomaCynoguanidine
HELACervical cancer
HTERTNormal epithelial retina
ACHNRenal adenocarcinoma
Summary of cell lines analyzed

Extraction of DNA, RNA and cDNA synthesis

Genomic DNA was extracted from the 13 cell-lines using the Genelute™ Mammalian Genomic DNA kit (Sigma, St. Louis, MO, USA), and the DNA was stored at –20°C until use. Total RNA was extracted by a standard guanidine isothiocyanate method (TRIZOL® Reagent; Gibco BRL/Invitrogen). The quality of the RNA was verified by running the samples on a 1% agarose gel, and the RNA was quantified by measuring the ultraviolet absorbance at 260 and 280 nm (NanoDrop Technologies). Twenty micrograms of RNA was treated with DNase I to remove genomic DNA using the RNeasy Mini Kit (Qiagen, 74104). Adequate removal of the genomic DNA after DNase I treatment was verified by absence of PCR products from RNA samples using primers for genomic DNA. Five micrograms of purified RNA was reverse transcribed to cDNA using the High-Capacity cDNA archive kit (Applied Biosystems, 4322171).

Gene expression profiling

The expression levels of 7400 genes in 13 of the parental and drug-resistant cell-lines had been previously determined using mRNA expression microarrays with cDNA probes (24). Twelve of the cell lines were selected to represent all cancer types in expression profiling on Sentrix® Genome-Wide Expression BeadChips (Illumina Inc., San Diego, CA, USA). Biotinylated cRNA was prepared from 500 ng of RNA, using the TotalPrep™ RNA Labeling Kit (Ambion). The in vitro transcription product was purified and labeled with Cy3-labeled streptavidin, followed by overnight hybridization of 1.5 µg of the labeled product to the BeadChips. The following day, the slides were washed and scanned using a Bead Station GX 500 Array Reader (Illumina Inc., San Diego, CA, USA). The image data files were analyzed using the BeadStudio software (Illumina Inc., San Diego, CA, USA), where the ‘rank invariant’ normalization model was applied, as recommended by the manufacturer. The limit of detection was set at 98% confidence.

PCR

Primers for PCR and minisequencing primers with 20-nucleotide tag sequences were designed using the Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.cgi) and Autoprimer (http://www.autoprimer.com) (Beckman Coulter) softwares. The primers were obtained from Integrated DNA Technologies (IDT Inc., Coralville, IA, USA). The fragments comprising the SNPs were amplified by PCR from genomic DNA in multiplex reactions with 6–12 amplicons per reaction, using 10 ng of DNA, 0.1 mM dNTPs, 1 U Smart-Taq hot DNA polymerase (Naxo Ltd., Tartu, Estonia), 4 mM MgCl2 and 0.2 μM of primers in a final volume of 30 μl. PCR from cDNA was performed in individual reactions using 1/20 of the cDNA products, 0.1 mM dNTPs, 0.5 U Smart-Taq hot DNA polymerase, 1.5 mM MgCl2 and 0.2 μM of primers in a final volume of 30 μl. The PCR conditions were initial activation of the enzyme at 95°C for 10 min followed by 40 cycles of 95°C for 1 min, 55°C for 30 s and 72°C for 1 min in a Thermal Cycler PTC225 (MJ Research, Watertown, MA, USA). The amplified cDNA fragments were pooled and concentrated to 40 μl using Microcon® YM-30 Centrifugal Filter Devices (Millipore Corporation, Bedford, MA, USA).

Preparation of microarrays

Oligonucleotides that were complementary to the tag sequences on the minisequencing primers were immobilized covalently on CodeLink™ Activated Slides (GE Healthcare, Uppsala, Sweden) by the mediation of a NH2-group at their 3′-end as described earlier (25). Each oligonucleotide was applied as duplicate spots to the slides at a concentration of 25 μM in 150 mM sodium phosphate pH 8.5 using a ProSys 5510A instrument (Cartesian Technologies Inc., Irvine. CA, USA) equipped with four Stealth Micro Spotting pins (SMP3B, TeleChem International Inc., Sunnyvale, CA, USA). The oligonucleotides were spotted in an ‘array-of-arrays’ configuration, which facilitates analysis of 80 individual samples in parallel on each microscope slide. In each ‘subarray,’ a fluorophore-labeled oligonucleotide was included as a control for the immobilization process. After printing, the slides were incubated in a humid chamber for at least 24 h, followed by treatment with ethanolamine. The slides were stored desiccated in the dark until use.

Tag-microarray minisequencing

Excess of PCR primers and dNTPs was removed by treatment of the PCR mixtures with 5 U of Exonuclease I and 1 U of shrimp alkaline phosphatase (USB Corporation, Cleveland, OH, USA). Multiplex cyclic minisequencing primer extension reactions were performed in the presence of 80 tagged primers in both DNA polarities at 10 nM concentration, 0.1 μM Texas Red-ddATP, Tamra-ddCTP, R110-ddGTP and 0.15 μM Cy5-ddUTP (Perkin Elmer Life Sciences, Boston, MA, USA) and 0.065 U of KlenThermase™ DNA polymerase (GeneCraft, Germany), as described earlier (26). Alternatively, reagents from the SNPstream® genotyping system (Beckman Coulter, Fullerton, California, USA) were used for the cyclic minisequencing reaction. A reference oligonucleotide that is complementary to a synthetic template to mimic a four-allelic SNP was added to the minisequencing reaction to monitor the difference in incorporation efficiency of the four nucleotides by the DNA polymerase. The reaction conditions were initial activation of the enzyme at 96°C for 5 min followed by 33 cycles of 95 and 55°C for 20 s each. The extension products were allowed to anneal to the immobilized complementary tag oligonucleotides at 42°C for 1–2 h followed by washing of the slide with 2 × SSC and 0.1% SDS twice for 5 min at 42°C and twice with 0.2 × SSC for 1 min at room temperature. Five replicates of DNA and cDNA from the same cell-line were analyzed in parallel.

Signal detection and data analysis

Fluorescence was measured from the microarrays using a ScanArray® Express instrument (Perkin Elmer Life Sciences, Boston, MA, USA) with the excitation lasers Blue Argon 488 nm (R110 and fluorescin), Green HeNe 543.8 nm (Tamra), Yellow HeNe 594 nm (Texas Red) and Red HeNe 632.8 nm (Cy5) with the laser power set to 88% and the photomultiplier tube gain adjusted to obtain equal signal intensities from the reaction control for all fluorophores. The fluorescence signals were quantified using the QuantArray® analysis 3.1 software (Perkin Elmer Life Sciences, Boston, MA, USA). The SNP genotypes were assigned using the SNPsnapper software v3.0.0.191 (http://www.bioinfo.helsinki.fi/SNPSnapper/) based on scatter plots with the logarithm of the sum of both fluorescence signals (SAllele1 + SAllele2) on the vertical axis and the fluorescence signal fractions [SAllele2/(SAllele1 + SAllele2)] on the horizontal axis. The genotypes together with the signal intensities of the incorporated nucleotides were exported to Microsoft® Excel. The data was handled and interpreted using the Microsoft® Excel and Access programs. AI was determined by calculating the fluorescence signal ratio between the two alleles (SAllele1/SAllele2) in cDNA and DNA for each heterozygous SNP. The signal ratio from cDNA was divided by the corresponding ratio in DNA to obtain a measure for AI. In this calculation, the mean signal intensity of duplicate spots in one sub-array was considered as one replicate assay, and five replicate assays were performed for each SNP. A two-tailed student's t-test was used to calculate the significance of the difference in the allelic ratios for the SNPs in genomic DNA and cDNA (Figure 1).
Figure 1.

Volcano plot of the AI data from 105 heterozygous cSNPs in 13 cell lines. AI for each SNP was determined by calculating the fluorescence signal ratio between the two alleles (SAllele1/SAllele2) in RNA (cDNA) and genomic DNA for each heterozygous SNP. The level of AI obtained by dividing the signal ratio in RNA by the corresponding ratio in DNA is plotted on the horizontal axis. The P-value for the difference between allelic ratios in RNA and DNA based on five replicate assays is plotted on the vertical axis. Spots above the horizontal dashed line represent the SNPs showing AI at a P-value < 0.0001 that were selected for further analysis.

Volcano plot of the AI data from 105 heterozygous cSNPs in 13 cell lines. AI for each SNP was determined by calculating the fluorescence signal ratio between the two alleles (SAllele1/SAllele2) in RNA (cDNA) and genomic DNA for each heterozygous SNP. The level of AI obtained by dividing the signal ratio in RNA by the corresponding ratio in DNA is plotted on the horizontal axis. The P-value for the difference between allelic ratios in RNA and DNA based on five replicate assays is plotted on the vertical axis. Spots above the horizontal dashed line represent the SNPs showing AI at a P-value < 0.0001 that were selected for further analysis.

Analysis of regulatory regions affected by SNPs

The bioinformatics tool Regulatory Analysis of Variation in Enhancers (RAVEN) (M. Andersen, B. Lenhard et al., in preparation) was used for the identification of potential rSNPs in the promoter regions of the genes with imbalanced expression. RAVEN (http://mordor.cgb.ki.se/CONSNP/) combines position weight matrices for transcription factor binding sites (TFBSs) from the manually curated Jaspar database (27,28) with phylogenetic footprinting to increase the likelihood of identifying functional variants. The RAVEN interface enables automatic analysis of SNPs from dbSNP as well as uploading of additional SNPs. Based on the application of position-specific weight matrices, RAVEN gives a score that ranges from 1 to 15 for binding sites of 6–14 nucleotides in length that contain the two SNP alleles. Putative rSNPs with MAF >0.05 were selected for further genotyping by applying a minimum SNP-caused score difference over 2 between the high- and low-scoring SNP alleles in the TFBS profile and a conservation cut-off above 70% between human and mouse, based on the phylogenetic footprinting.

Electrophoretic mobility shift assays (EMSA)

Complementary double-stranded 5′ biotinylated as well as unmodified 30 bp oligonucleotides, containing the predicted TFBS, were designed for each allele of putative rSNPs (Table 2). The oligonucleotides were obtained from Integrated DNA Technologies (IDT Inc., Coralville, IA, USA). The complementary oligonucleotides were allowed to anneal in 10 mM Tris–HCl, pH 7.5, 50 mM NaCl, 1 mM EDTA to generate double-stranded probes for the EMSA reaction. Twenty femtomoles of the labeled double-stranded probes were incubated with 5 µg of HELA or Jurkat nuclear extracts (Active Motif, Carlsbad, CA, USA) in a freshly made binding buffer containing 12 mM HEPES pH 7.4, 5 mM MgCl2, 60 mM KCl, 1% glycerol, 0.05% NP-40, 50 µg/µl BSA, 1 mM DTT, 0.5 mM EDTA with 50 ng/µl of poly(dI-dC) · poly(dI-dC) (Amersham Biosciences, Piscataway, NJ, USA) and Halt™ Protease Inhibitor Cocktail (Pierce Biotechnology, Rockford, IL, USA) in a final volume of 20 µl. Three reactions were prepared for each double-stranded oligonucleotide (see Figure 2). The mixtures were incubated at room temperature for 20 min, and analyzed using electrophoresis on 6% polyacrylamide gels (Bio-Rad Laboratories, Hercules, CA, USA). The gels were run for 1.5 h at 100 V, followed by transfer to Hybond-N+ nylon membranes (Buckinghamshire, England) in 0.5 × TBE for 1 h at 550 mA, using a Criterion Blotter (Bio-Rad Laboratories, Hercules, CA, USA). The LightShift Chemiluminescent EMSA kit (Pierce Biotechnology, Rockford, IL, USA) was used to visualize the biotinylated oligonucleotide signals on the membranes and a ChemiDoc XRS system (Bio-Rad Laboratories, Hercules, CA, USA). The EMSA experiments were performed twice with reproducible results.
Table 2.

Result from validation of the transcription factor binding sites predicted by RAVEN by electrophoretic mobility shift assays

GeneaSNP bEMSA probes (one strand)cTranscription factorsdConfirmed by EMSAe
APCrs2439591GAAATCCATTACACAGAATAAGGCAGACAAGL3, E4BP4, HLF, SOX17,+
GAAATCCATTACACAAAATAAGGCAGACASQUA
BCL2rs1944423TTCATAAACTTGGAGAATATTTATATTGAAthb-1, HFH-1, HFH-2, HFH-3,
TTCATAAACTTGGAGAACATTTATATTGAHNF-3beta, MEF2, SOX17
CCND2rs3812821ACCAGAACAACGTCCCTTGTGCCCCCCCCSOX17
ACCAGAACAACGTCCCTTCTGCCCCCCCC
MLH1rs3172297ATTTAAGACTATATGAATCAGAATTTTAACF2-II+
ATTTAAGACTACATGAATCAGAATTTTAA
PARP1rs1317170CTCGATGGGGTGCATGACATACACAGGATACREB, bZIP910+
CTCGATGGGGTGCATAACATACACAGGATA
SLIT2rs564041ACCTAAAATCTCTGCAATATTCTCATTAASOX17+
ACCTAAAATCTCTGCAATATCCTCATTAA
XRCC1rs12608635CGGCGGCGGGGAGCAGGTGCCACGGCCAAAChop-cEBP, bZIP911+
CGGCGGCGGGGAGCAGGTGCCATGGCCAAA
YES1rs7233932GGAGCGCTCCGATTGTGCCCCTCTGCCTTSOX17, Sox-5+
GGAGCGCTCCGATTCTGCCCCTCTGCCTT

aGene symbol according to the HUGO gene nomenclature committee http://www.gene.ucl.ac.uk/nomenclature/

bThe SNPs rs8073706, rs907187, rs8176077, rs5016499, rs7655084, rs2717701 and rs3810378 in the respective ABCC3, PARP1, BRCA1, DCTD, SLIT2, TNFRSF12A and XRCC1 genes were not confirmed by EMSA.

cEMSA probe containing the SNP, the top probe contains the SNP allele that is predicted to give stronger transcription factor binding.

dTranscription factors predicted by RAVEN to bind to the probes.

eThe probes for the SNP alleles giving a stronger signal in EMSA that matched the predictions by RAVEN.

Figure 2.

Electrophoretic mobility shift assay images for the SNP alleles of the APC, BCL2, SLIT2, CCND2, XRCC1, PARP1, MLH1 and YES1 genes. Three lanes are shown for each SNP allele. From left to right these are: a control reaction with labeled probe only, a reaction containing both labeled probe and nuclear extract and a reaction where an unlabeled probe is added in excess as a competitor, in addition to the labeled probe and nuclear extract. For the MLH1 and YES1 genes, the two lanes are shown: a reaction with labeled probe and nuclear extract and a reaction where the unlabeled competitor probe is added. The sequences of the allele-specific EMSA probes are given in Table 2.

Result from validation of the transcription factor binding sites predicted by RAVEN by electrophoretic mobility shift assays aGene symbol according to the HUGO gene nomenclature committee http://www.gene.ucl.ac.uk/nomenclature/ bThe SNPs rs8073706, rs907187, rs8176077, rs5016499, rs7655084, rs2717701 and rs3810378 in the respective ABCC3, PARP1, BRCA1, DCTD, SLIT2, TNFRSF12A and XRCC1 genes were not confirmed by EMSA. cEMSA probe containing the SNP, the top probe contains the SNP allele that is predicted to give stronger transcription factor binding. dTranscription factors predicted by RAVEN to bind to the probes. eThe probes for the SNP alleles giving a stronger signal in EMSA that matched the predictions by RAVEN. Electrophoretic mobility shift assay images for the SNP alleles of the APC, BCL2, SLIT2, CCND2, XRCC1, PARP1, MLH1 and YES1 genes. Three lanes are shown for each SNP allele. From left to right these are: a control reaction with labeled probe only, a reaction containing both labeled probe and nuclear extract and a reaction where an unlabeled probe is added in excess as a competitor, in addition to the labeled probe and nuclear extract. For the MLH1 and YES1 genes, the two lanes are shown: a reaction with labeled probe and nuclear extract and a reaction where the unlabeled competitor probe is added. The sequences of the allele-specific EMSA probes are given in Table 2.

RESULTS AND DISCUSSION

Selection of candidate genes and coding SNPs

A panel of 13 human tumor cell-lines that includes drug-sensitive parental cell-lines and their corresponding resistant subtypes was analyzed to detect AI in the expression of candidate genes involved in cancer progression and response to anticancer drugs (Table 1). These cell lines have previously been well characterized for their response patterns against 66 different anticancer drugs (23,24). Initially, we selected a panel of 210 candidate genes for our study. The panel included oncogenes and tumor suppressor genes selected from the literature and genes relevant for the pathways of nine anticancer drugs (irinotecan, 5-fluorouracil, platinum, taxanes, methotrexate, topotecan, gemcitabine, cyclophosphamide and doxorubicin) according to the Pharmacogenetics and Pharmacogenomics knowledge base website (http://pharmacogenetics.wustl.edu/). Based on expression data for 7400 human genes using cDNA microarrays (24) and expression profiling using bead arrays with probes for 46,000 transcripts (Illumina Inc.) (Milani et al., unpublished results), 160 of the 210 genes appeared to be expressed in at least one of the cell lines (see Supplementary Table 1). By searching the dbSNP and Ensembl databases, we identified 237 SNPs with minor allele frequencies above 10% in the coding region of the expressed candidate genes.

Detection of allelic imbalance

Next, we genotyped the cSNPs by multiplex tag-microarray minisequencing in genomic DNA from the cell lines and found that 79 of the candidate genes contained coding SNPs (cSNPs) that were heterozygous in at least one of the cell lines. These heterozygous cSNPs were then genotyped in five replicate reactions in both genomic DNA and RNA (cDNA) from the relevant cell lines. Genotyping of the RNA samples was successful for 105 cSNPs in 60 genes. For 19 genes, genotyping assays that were successful for genomic DNA failed in cDNA, presumably due to the low expression level of these genes. AI between the expressed alleles was initially observed by aberrant clustering of the genotype data from RNA compared to data from DNA in scatter plots. To obtain a quantitative measure for the observed AI, the fluorescence signal (S) ratio between the two alleles (SAllele1/SAllele2) in RNA was divided by the corresponding signal ratio in DNA for each SNP. A student's t-test was then used to assess the significance of the difference between allelic ratios in DNA and RNA based on five replicate measurements. The ‘volcano plot’ in Figure 1 displays the AI data from all 105 cSNPs and 13 cell lines with the magnitude of AI plotted on the horizontal axis and the P-values for the differences in signal ratios for the detected AI on the vertical axis. The complete data underlying Figure 1 is provided in Supplementary Table 2. Using a conservative P-value of 0.0001 as significance threshold we detected AI in the expression of 41 of the genes (Table 3). Figure 3 summarizes the recovery of genes at the different stages of our screening process.
Table 3.

Allelic imbalance levels in 13 cell lines

GeneaSNPAllelesb8226/S8226/Dox8226/LR5CCRF-CEMCEM/VM-1NCI-H69H69ARU937-GTBU937/VCRGTB/CHSHELAHTERTACHN
ABCB1rs3842A/G−1,4−3,1−4,6−5,7
ABCC3rs4148416G/A2,8
APCrs2229992T/Cndndndndnd1.7ndndndndnd
ATF5rs283525G/A−1,7nd−7,5ndndndnd
ATF5rs8647G/Andnd−2,9−2,7nd
ATF5rs8667T/Cnd8,5ndndnd
BAK1rs210135A/Tndndnd−2,1ndndndndnd
BCL2rs1801018A/G−5,8−3,4
BCL2rs4987843A/G−3,8−2,1ndnd−2,2
BDH1rs1050119T/C−3,4−4,8nd−2,8−2,2
BLMrs1063147G/Andnd2,4
CBR1rs20572G/A−6,8
CBR1rs9024C/T−46,6
CCND2rs1049606T/C6,110,8nd3,59,7ndnd
CCND2rs3217926G/And6,4ndnd−11,6
CDH6rs2302904T/Cnd−2,6
ERBB2rs1058808C/G−40,8−40,2nd
ERBB2rs1801200A/G5,37,6nd−3,3
ERBB2rs2230698A/Gndnd−1,9
ERBB2IPrs36303G/Andnd−1,8nd
ERBB2IPrs706679T/Cndndndndnd−5,5ndnd
ERCC2rs13181A/C−3,0
FANCArs2239359T/Cndnd−133,7ndnd
FDXRrs690514G/A11,3
HMGA2rs8756T/G51,9
HMGB1rs590050G/A−2,5−2,2−6,6−4,3−7,9−14,0−9,0−12,0−6,6
MAP4K2rs2071313T/Cnd2,21,5ndnd2,2
MAPTrs1052594C/Gnd−3,1ndndndnd
MAPTrs9468C/Tndndnd−3,3ndnd
MCM7rs2070215T/Cnd−1,9ndndnd
MGMTrs12917G/A2,3ndnd
MGMTrs1803965G/A1,7ndnd
MLH1rs1799977G/A−40,0−40,4−2,3ndnd
MSH6rs1800935T/C3,3nd
NF2rs1008515T/C2,3nd−5,8ndnd3,3nd
NME4rs14293G/A1,4−4,1−19,7ndnd−1,6−1,4
PARP1rs1136410G/A2,6
PARP1rs1805404G/A2,9
PARP1rs3219061T/C2,3
PCNArs3626C/G−64,1
PMS2rs1059060G/A−2,8ndndndndndndndndndndnd
RETrs1800858G/A−3,5nd5,11,7
SLIT2rs7655084T/G10.6nd
TERTrs2736098G/Andnd−12,4nd−270,5
TK1rs1065769C/Tndnd−3,5ndndnd
TK1rs1071664T/Cndnd−4,3ndnd
TK1rs1143696G/A1,9ndnd
TNFRSF12Ars13209T/Cnd4,8ndndnd−1,7ndnd
TSHZ1rs3744908T/C1,71,3ndndnd6,8nd1,9nd
TSHZ1rs3809997T/Cndndndndnd5,6ndndnd
UMPSrs1139538A/G5,2ndndndnd
VAV2rs509590T/Cndndndnd2,6ndndnd
VAV2rs602990G/Andnd−12,1ndnd
WT1rs16754T/C−74,6−54,5−101,1
XPCrs2470352T/A−3,0−3,6nd−6,0−3,9
XRCC1rs25487A/Gnd1,8ndndndndndnd
YES1rs1060922T/Cndnd−18,9nd

aGene symbol according to the HUGO gene nomenclature committee http://www.gene.ucl.ac.uk/nomenclature/

bSNP alleles, the first nucleotide is referred to as Allele 1 and the second as Allele 2. nd, heterozygous sample where no AI was detected; - (hyphen), homozygous (or failed) samples.

Overexpression of Allele 1 gives positive values, overexpression of Allele 2 gives negative values.

Figure 3.

Recovery of genes and SNPs at the different stages of our process for screening for allelic imbalance.

Allelic imbalance levels in 13 cell lines aGene symbol according to the HUGO gene nomenclature committee http://www.gene.ucl.ac.uk/nomenclature/ bSNP alleles, the first nucleotide is referred to as Allele 1 and the second as Allele 2. nd, heterozygous sample where no AI was detected; - (hyphen), homozygous (or failed) samples. Overexpression of Allele 1 gives positive values, overexpression of Allele 2 gives negative values. Recovery of genes and SNPs at the different stages of our process for screening for allelic imbalance. Despite the conservative approach for defining AI, the relative number of genes that displayed AI in our study (68%) was higher than that previously observed by others based on screening with allele-specific hybridization microarrays (11,12). The reason for this difference could be the high sensitivity of detecting minority alleles using minisequencing primer extension, which we have previously shown to be 1–5%, depending on the sequence context of the SNP (15,29). Alternatively it is possible that cancer-related genes in cancer cells are more frequently expressed in an allele-specific manner than randomly selected genes in lymphoblastoid cell-lines that have been analyzed for AI in other studies. As can be seen in Supplementary Table 2 the level of AI that we measured in our study varied largely, from 1.3-fold (44% of the minor allele expressed) to over 40-fold (2.4% of the minor allele expressed). For a subset of 15 genes we observed apparent monoallelic expression in at least one of the cell lines, based on an allelic ratio in RNA that was indistinguishable from a homozygous genotype. Extreme AI, or monoallelic expression could, in addition to a strong cis-acting regulatory effect, be due to lack of transcription of one allele because of methylation of the promoter region as a consequence of imprinting. In accordance with this notion, we have detected methylation in the CpG islands in the 5′ region of the ERBB2 gene in the CCRF-CEM and CEM-VM1 cells that showed monoallelic expression in the current study, but not in HELA cells that displayed equal expression of the ERBB2 alleles (Milani et al., unpublished results). Eleven of the genes that displayed AI in our study contained more than one heterozygous cSNP (Supplementary Table 2). For example, SNPs rs12917 and rs1803965 in exon 3 of MGMT yielded 2.3-fold and 1.7-fold AI, respectively, in the CCRF-CEM cell line, and no AI in any of the other cell lines. Three SNPs in different exons of PARP1 (rs1136410, rs1805404, rs3219061) all yielded 2.3–2.9 fold AI in the HTERT cell line. This data supports that our system yields reproducible results. On the other hand, SNP rs602990 in exon 20 of VAV2 displayed 12-fold AI, while both alleles of SNP rs509590 in the 3′ UTR of VAV2 were expressed at equal levels. These apparently discordant results could be caused by differential expression of alternatively spliced transcripts, where the exon containing one of the SNPs has been removed from one of the splice variants. Hence, measurement of AI using SNPs distributed over different exons could be used for relative quantification of alternatively spliced transcripts, as an alternative approach to assays based on detection of exon-specific nucleotides only (29,30). AI could thus be used as a guide to SNPs that regulate alternative splicing, analogously to the process for identifying rSNPs that affect the expression of the entire transcript.

Bioinformatics-assisted identification of SNPs that cause allelic imbalance

Next, we attempted to identify SNPs in the 5′-regulatory regions of the 41 genes that displayed AI. For this purpose, we used the RAVEN application. RAVEN reports evolutionary conserved regions based on the human and mouse genome sequences and scans the sequences for the presence of potential TFBSs that are affected by SNPs. We used RAVEN to scan 3–5 kb of the 5′-regulatory regions of the 41 genes that were found to display AI, and selected about 100 putative rSNPs in the genes based on this analysis. The putative rSNPs identified using RAVEN were subsequently genotyped in all the cell lines (data not shown). The 15 rSNPs that were heterozygous in the same samples as the originally genotyped cSNPs in the corresponding genes were selected for further analysis.

Functional analysis of rSNPs

Fifteen of the rSNPs predicted by RAVEN and that appeared to be in linkage disequilibrium (LD) with the initially genotyped cSNP were analyzed for their capacity to bind transcription factors or other proteins from a nuclear cell extract by EMSAs (31,32). Allelic pairs of eight of these SNPs that are located in the promoter regions of the APC, BCL2, SLIT2, CCND2, XRCC1, PARP1, MLH1 and YES1 genes displayed a reproducible signal intensity difference in a product with altered mobility in EMSA. Protein binding to only one of the SNP alleles can be seen for the APC, BCL2 and XRCC1 genes, while for the SLIT2, CCND2, PARP1, MLH1 and YES1 genes a difference in the amount of protein bound is seen (Figure 2). For as many as six of the SNPs, the allele that showed stronger protein binding had been predicted by RAVEN to have a stronger binding affinity for a transcription factor. The transcription factors predicted to bind to the binding sites containing the rSNPs are listed in Table 2. No protein binding or allele-specific differences in binding were detectable using EMSA for the remaining seven SNPs that are located in the ABCC3, PARP1, BRCA1, DCTD, SLIT2, TNFRSF12A and XRCC1 genes. RAVEN appears to be an excellent tool for enriching functional SNPs in TFBSs, although fine-tuning of the parameters of RAVEN as well as raising the cut-off for detecting AI could increase its success rate. The genes in which we identified rSNPs were mainly genes involved in cancer progression. BCL2 (the B-cell CLL/lymphoma 2 gene), has been reported to be overexpressed in different leukemias and to be involved in leukemogenesis (33) and the expression of TNFRSF12A (the tumor necrosis factor receptor superfamily, member 12A gene) is important in cells undergoing apoptosis (34). The Yamaguchi sarcoma viral oncogene homolog 1 (YES1) gene has been shown to be differentially expressed in colon cancer cells treated with histone deacetylase inhibitors (35). ABCC3, which encodes the multi-drug resistance-associated protein 3, has been reported to be involved in resistance to doxorubicin (36). The identified rSNPs in these genes should be further validated by functional assays. The genes and rSNPs identified in our study are promising candidates for genetic association studies with samples from patient cohorts with relevant types of cancer or drug response patterns.

CONCLUSION

By the screening process presented here, we detected AI in the expression levels of 41 out of 160 candidate genes that were expressed in cancer cells, and applied AI as a guide to putative rSNPs in these genes. Using bioinformatics tools that predict TFBSs, we selected SNPs in the 5′-regulatory regions of genes for which AI was detected. We identified rSNPs that had a suggestive allele-specific effect, which was shown experimentally by EMSA for eight genes. We conclude that a screening process, such as the one established in our study, that combines allele-specific gene expression analysis with powerful bioinformatics tools offers a shortcut for the detection of potential cis-acting regulators of gene expression. The process allows a substantial reduction of the number of candidate rSNPs to be subjected to labor-intensive genetic association or functional studies.
  36 in total

1.  Quantitative evaluation by minisequencing and microarrays reveals accurate multiplexed SNP genotyping of whole genome amplified DNA.

Authors:  Lovisa Lovmar; Mona Fredriksson; Ulrika Liljedahl; Snaevar Sigurdsson; Ann-Christine Syvänen
Journal:  Nucleic Acids Res       Date:  2003-11-01       Impact factor: 16.971

2.  Cis-acting variation in the expression of a high proportion of genes in human brain.

Authors:  Nicholas J Bray; Paul R Buckland; Michael J Owen; Michael C O'Donovan
Journal:  Hum Genet       Date:  2003-05-01       Impact factor: 4.132

3.  JASPAR: an open-access database for eukaryotic transcription factor binding profiles.

Authors:  Albin Sandelin; Wynand Alkema; Pär Engström; Wyeth W Wasserman; Boris Lenhard
Journal:  Nucleic Acids Res       Date:  2004-01-01       Impact factor: 16.971

4.  A survey of genetic and epigenetic variation affecting human gene expression.

Authors:  Tomi Pastinen; Robert Sladek; Scott Gurd; Alya'a Sammak; Bing Ge; Pierre Lepage; Karine Lavergne; Amelie Villeneuve; Tiffany Gaudin; Helena Brändström; Allon Beck; Andrei Verner; Jade Kingsley; Eef Harmsen; Damian Labuda; Kenneth Morgan; Marie-Claude Vohl; Anna K Naumova; Daniel Sinnett; Thomas J Hudson
Journal:  Physiol Genomics       Date:  2004-01-15       Impact factor: 3.107

5.  Thymidylate synthase gene polymorphism determines response and toxicity of 5-FU chemotherapy.

Authors:  S T Pullarkat; J Stoehlmacher; V Ghaderi; Y P Xiong; S A Ingles; A Sherrod; R Warren; D Tsao-Wei; S Groshen; H J Lenz
Journal:  Pharmacogenomics J       Date:  2001       Impact factor: 3.550

6.  Equilibria and kinetics of lac repressor-operator interactions by polyacrylamide gel electrophoresis.

Authors:  M Fried; D M Crothers
Journal:  Nucleic Acids Res       Date:  1981-12-11       Impact factor: 16.971

7.  Genetic inheritance of gene expression in human cell lines.

Authors:  S A Monks; A Leonardson; H Zhu; P Cundiff; P Pietrusiak; S Edwards; J W Phillips; A Sachs; E E Schadt
Journal:  Am J Hum Genet       Date:  2004-10-21       Impact factor: 11.025

8.  Genetic analysis of genome-wide variation in human gene expression.

Authors:  Michael Morley; Cliona M Molony; Teresa M Weber; James L Devlin; Kathryn G Ewens; Richard S Spielman; Vivian G Cheung
Journal:  Nature       Date:  2004-07-21       Impact factor: 49.962

9.  CAP and RNA polymerase interactions with the lac promoter: binding stoichiometry and long range effects.

Authors:  M G Fried; D M Crothers
Journal:  Nucleic Acids Res       Date:  1983-01-11       Impact factor: 16.971

10.  Simultaneous quantitative and allele-specific expression analysis with real competitive PCR.

Authors:  Chunming Ding; Esther Maier; Adelbert A Roscher; Andreas Braun; Charles R Cantor
Journal:  BMC Genet       Date:  2004-05-05       Impact factor: 2.797

View more
  25 in total

1.  WT1 synonymous single nucleotide polymorphism rs16754 correlates with higher mRNA expression and predicts significantly improved outcome in favorable-risk pediatric acute myeloid leukemia: a report from the children's oncology group.

Authors:  Phoenix A Ho; Julia Kuhn; Robert B Gerbing; Jessica A Pollard; Rong Zeng; Kristen L Miller; Nyla A Heerema; Susana C Raimondi; Betsy A Hirsch; Janet L Franklin; Beverly Lange; Alan S Gamis; Todd A Alonzo; Soheil Meshinchi
Journal:  J Clin Oncol       Date:  2010-12-28       Impact factor: 44.544

2.  Spatial allelic imbalance of BCL2 genes and chromosome 18 territories in nonneoplastic and neoplastic cervical squamous epithelium.

Authors:  Thorsten Wiech; Stefan Stein; Victoria Lachenmaier; Eberhard Schmitt; Jutta Schwarz-Finsterle; Elisabeth Wiech; Georg Hildenbrand; Martin Werner; Michael Hausmann
Journal:  Eur Biophys J       Date:  2009-06-03       Impact factor: 1.733

3.  Regions of acquired uniparental disomy at diagnosis of follicular lymphoma are associated with both overall survival and risk of transformation.

Authors:  Derville O'Shea; Ciarán O'Riain; Manu Gupta; Rachel Waters; Youwen Yang; David Wrench; John Gribben; Andreas Rosenwald; German Ott; Lisa M Rimsza; Harald Holte; Jean-Baptiste Cazier; Nathalie A Johnson; Elias Campo; Wing C Chan; Randy D Gascoyne; Bryan D Young; Louis M Staudt; T Andrew Lister; Jude Fitzgibbon
Journal:  Blood       Date:  2009-01-13       Impact factor: 22.113

4.  Allele-specific gene expression patterns in primary leukemic cells reveal regulation of gene expression by CpG site methylation.

Authors:  Lili Milani; Anders Lundmark; Jessica Nordlund; Anna Kiialainen; Trond Flaegstad; Gudmundur Jonmundsson; Jukka Kanerva; Kjeld Schmiegelow; Kevin L Gunderson; Gudmar Lönnerholm; Ann-Christine Syvänen
Journal:  Genome Res       Date:  2008-11-07       Impact factor: 9.043

5.  Allelic imbalance (AI) identifies novel tissue-specific cis-regulatory variation for human UGT2B15.

Authors:  Chang Sun; Catherine Southard; David B Witonsky; Olufunmilayo I Olopade; Anna Di Rienzo
Journal:  Hum Mutat       Date:  2010-01       Impact factor: 4.878

6.  Allele-specific gene expression in a wild nonhuman primate population.

Authors:  J Tung; M Y Akinyi; S Mutura; J Altmann; G A Wray; S C Alberts
Journal:  Mol Ecol       Date:  2011-01-13       Impact factor: 6.185

7.  Association of genetic variation in the MET proto-oncogene with schizophrenia and general cognitive ability.

Authors:  Katherine E Burdick; Pamela DeRosse; John M Kane; Todd Lencz; Anil K Malhotra
Journal:  Am J Psychiatry       Date:  2010-01-15       Impact factor: 18.112

8.  Allele-specific CDH1 downregulation and hereditary diffuse gastric cancer.

Authors:  Hugo Pinheiro; Renata Bordeira-Carriço; Susana Seixas; Joana Carvalho; Janine Senz; Patrícia Oliveira; Patrícia Inácio; Leonor Gusmão; Jorge Rocha; David Huntsman; Raquel Seruca; Carla Oliveira
Journal:  Hum Mol Genet       Date:  2009-12-04       Impact factor: 6.150

9.  Identification of candidate regulatory SNPs by combination of transcription-factor-binding site prediction, SNP genotyping and haploChIP.

Authors:  Adam Ameur; Alvaro Rada-Iglesias; Jan Komorowski; Claes Wadelius
Journal:  Nucleic Acids Res       Date:  2009-05-18       Impact factor: 16.971

10.  Digital RNA allelotyping reveals tissue-specific and allele-specific gene expression in human.

Authors:  Kun Zhang; Jin Billy Li; Yuan Gao; Dieter Egli; Bin Xie; Jie Deng; Zhe Li; Je-Hyuk Lee; John Aach; Emily M Leproust; Kevin Eggan; George M Church
Journal:  Nat Methods       Date:  2009-07-20       Impact factor: 28.547

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.