In the past decade, Caenorhabditis elegans has been used to dissect several genetic pathways involved in immunity; however, little is known about transcription factors that regulate the expression of immune effectors. C. elegans does not appear to have a functional homolog of the key immune transcription factor NF-kappaB. Here we show that that the intestinal GATA transcription factor ELT-2 is required for both immunity to Salmonella enterica and expression of a C-type lectin gene, clec-67, which is expressed in the intestinal cells and is a good marker of S. enterica infection. We also found that ELT-2 is required for immunity to Pseudomonas aeruginosa, Enterococcus faecalis, and Cryptococcus neoformans. Lack of immune inhibition by DAF-2, which negatively regulates the FOXO transcription factor DAF-16, rescues the hypersusceptibility to pathogens phenotype of elt-2(RNAi) animals. Our results indicate that ELT-2 is part of a multi-pathogen defense pathway that regulates innate immunity independently of the DAF-2/DAF-16 signaling pathway.
In the past decade, Caenorhabditis elegans has been used to dissect several genetic pathways involved in immunity; however, little is known about transcription factors that regulate the expression of immune effectors. C. elegans does not appear to have a functional homolog of the key immune transcription factor NF-kappaB. Here we show that that the intestinal GATA transcription factor ELT-2 is required for both immunity to Salmonella enterica and expression of a C-type lectin gene, clec-67, which is expressed in the intestinal cells and is a good marker of S. entericainfection. We also found that ELT-2 is required for immunity to Pseudomonas aeruginosa, Enterococcus faecalis, and Cryptococcus neoformans. Lack of immune inhibition by DAF-2, which negatively regulates the FOXO transcription factor DAF-16, rescues the hypersusceptibility to pathogens phenotype of elt-2(RNAi) animals. Our results indicate that ELT-2 is part of a multi-pathogen defense pathway that regulates innate immunity independently of the DAF-2/DAF-16 signaling pathway.
The study of innate immunity received renewed attention when the first parallels between mammalian and Drosophila melanogaster immunity were discovered (reviewed in [1]–[3]). Since then, various invertebrate model systems have been used to dissect highly-conserved immune responses without the complications of adaptive immunity. The genetically tractable nematode Caenorhabditis elegans, which has been used for decades to study the mechanisms of a number biological processes, has become a well-established invertebrate model for the study of microbial pathogenesis and innate immunity (reviewed in [1], [4]–[7]). C. elegans has evolved mechanisms to recognize and respond to potential pathogens using an inducible immune system that contains many highly-conserved effectors, including anti-bacterial proteins, lysozymes, lipases, and C-type lectins [8]. Additionally, conserved signaling pathways have been linked to C. elegans immunity, including the CED-3, TGF-β, PMK-1 MAP kinase, and DAF-2 pathways (reviewed in [1], [6], [9]), suggesting that despite the vast evolutionary gulf between nematodes and mammals, some of the underlying mechanisms of immunity may be similar.Despite the similarities, there are also characteristics of the immune response of C. elegans that distinguish it from mammals and other invertebrates. Although Toll receptors, first studied in Drosophila melanogaster and subsequently studied in mammals, are highly conserved across species, they do not appear to play a role in C. elegans immune responses [10]. Specifically, the single nematode Toll receptor homolog, Tol-1, is expressed in the nematode nervous system and is involved in bacterial avoidance behaviors, rather than in the activation of antimicrobial genes [10], [11]. Consistent with the lack of Toll-like receptor-mediated immunity, there is no evidence of a NF-κB homolog in C. elegans. NF-κB-like transcription factors are critical in the regulation of Toll immune responses as they control the expression of key genes involved in innate immunity in many organisms (recently reviewed in [12]). Thus, there is a distinct need to determine exactly which transcription factors are involved in modulating nematode immune responses, some of which may also play important immunity roles in mammals.Recently, Shapira et al.
[13] demonstrated that the intestinal transcription factor ELT-2 regulates intestinal immunity to the human pathogen P. aeruginosa. Here we show that disruption of ELT-2 causes nematodes to become hypersusceptible to Salmonella enterica-mediated killing and that ELT-2 upregulates the expression of clec-67 which is a marker of S. entericainfection in C. elegans. Our results also suggest that ELT-2 is part of a multi-pathogen defense pathway that regulates innate immunity not only to S. enterica and Pseudomonas aeruginosa, but also to the Gram-positive bacterium Enterococcus faecalis and to the fungal pathogen Cryptococcus neoformans. We also show that ELT-2 functions in C. elegans immunity independently of the DAF-2/DAF-16 signaling pathway. These data indicate that ELT-2 is an important regulator of a conserved C. elegans immune response to pathogens.
Results
elt-2 RNAi animals are hypersusceptible to S. enterica-mediated killing
The digestive tract of C. elegans is a primary interface between the immune system and potential bacterial pathogens. This is especially important in the case of bacteria such as the human pathogen S. enterica which is capable of establishing a persistent infection in the C. elegans intestine [14], [15]. In addition, several known effectors of the C. elegans immune system are expressed in the intestinal cells. Because of this link between the intestine and immunity, we sought to identify intestinal transcription factors which might modulate C. elegans immune responses.Over 900 functional transcription factors are predicted to be encoded in the C. elegans genome [16]. To identify genes encoding transcription factors involved in the regulation of immune effectors expressed in the C. elegans intestinal cells, candidates were selected based on the following criteria: i) genes known to be expressed in the intestine (141 candidates), ii) genes expressed during adulthood (10 of the 141 candidates), and iii) genes which only regulate intestinal functions or for which a function in adulthood has not been reported (7 of the 10 candidates). Of the seven candidates, five were chosen for further analysis based on the availability of RNAi clones [17]. Thus, to address whether the selected candidate genes play a role in C. elegans immunity, we used RNAi to inhibit their expression and tested the susceptibility of these gene ablated animals to S. enterica. The results shown in Table 1 demonstrate that only RNAi ablation of elt-2 results in consistent increased susceptibility of C. elegans to S. enterica.
Table 1
ELT-2 is required for C. elegans immunity to S. enterica.
RNAi treatment
TD50±SEM
Events/Obsa
p-value vs control
control
5.90±0.23
149/210
elt-2
1.91±0.06
114/120
<0.0001
F42G2.6
5.24±0.22
97/120
0.1483
F23F12.9
5.59±0.15
97/120
0.3375
ZK632.2
5.28±0.19
93/120
0.1900
C18G1.2
5.69±0.20
62/90
0.8779
Wild type nematodes grown on E. coli carrying a vector control or on E. coli expressing double-stranded RNA of the gene listed in the RNAi treatment column were exposed to S. enterica SL1344. TD50±SEM and p-values were calculated using PRISM as described in Experimental Procedures.
Animals that were not found or that died as a result of getting stuck to the wall of the plate were censored.
Wild type nematodes grown on E. coli carrying a vector control or on E. coli expressing double-stranded RNA of the gene listed in the RNAi treatment column were exposed to S. entericaSL1344. TD50±SEM and p-values were calculated using PRISM as described in Experimental Procedures.Animals that were not found or that died as a result of getting stuck to the wall of the plate were censored.The increased susceptibility of elt-2(RNAi) animals to S. enterica (Table 1 and Figure 1A) indicates that ELT-2 may be involved in the regulation of an immune response to this pathogen. However, it is also possible that elt-2(RNAi) animals are sickly due to a malfunctioning intestine. ELT-2 is a crucial GATA transcription factor involved in intestinal differentiation [18]–[22] and elt-2 knockouts exhibit a gut-obstructed (Gob) phenotype that results in arrest at L1 stage larvae and subsequent death, apparently by starvation [18]. Therefore, to study whether elt-2 ablation by RNAi makes the animals sickly, we first assayed the life span of elt-2RNAi nematodes. Figure 1B shows that although elt-2RNAi animals exhibit a reduced life span compared to control animals, they survive at least eight days, indicating that starvation is not a cause of death.
Figure 1
elt-2(RNAi) animals are hypersusceptible to S. enterica-mediated killing and are colonized by E. coli.
(A) Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to S. enterica SL1344 (P<0.0001).
60 nematodes were used for each condition. Results are representative of at least 3 independent experiments.
(B) Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were placed on FUdR containing plates with lawns of heat-killed E. coli OP50 (P = 0.0011).
20 nematodes were used for each condition. Results are representative of at least 3 independent experiments.
(C) and (D) Wild-type nematodes grown on E. coli carrying a vector control (C) or on E. coli expressing elt-2 double-stranded RNA (D) were exposed to E. coli expressing DSred for 24 hours, and then visualized using a Leica TCS SL spectral confocal microscope (bar = 50 µm).
(E) Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were transferred to a clean LB plate either immediately or after 24 hours exposure to E. coli OP50 (+24 hrs), where they were allowed to defecate for 2 hours.
Plates then were placed at 37°C overnight and colonies counted.
The combined data from 10 individual animals are shown, and data were normalized to the median colony count for the vector control at each timepoint.
Error bars represent SEM.
Results are representative of at least 3 independent experiments.
elt-2(RNAi) animals are hypersusceptible to S. enterica-mediated killing and are colonized by E. coli.
(A) Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to S. entericaSL1344 (P<0.0001).60 nematodes were used for each condition. Results are representative of at least 3 independent experiments.(B) Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were placed on FUdR containing plates with lawns of heat-killed E. coliOP50 (P = 0.0011).20 nematodes were used for each condition. Results are representative of at least 3 independent experiments.(C) and (D) Wild-type nematodes grown on E. coli carrying a vector control (C) or on E. coli expressing elt-2 double-stranded RNA (D) were exposed to E. coli expressing DSred for 24 hours, and then visualized using a Leica TCS SL spectral confocal microscope (bar = 50 µm).(E) Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were transferred to a clean LB plate either immediately or after 24 hours exposure to E. coliOP50 (+24 hrs), where they were allowed to defecate for 2 hours.Plates then were placed at 37°C overnight and colonies counted.The combined data from 10 individual animals are shown, and data were normalized to the median colony count for the vector control at each timepoint.Error bars represent SEM.Results are representative of at least 3 independent experiments.To test whether elt-2(RNAi) animals are more susceptible to S. enterica-mediated killing when taking into account their reduced life span on E. coli, the relative mortality of elt-2(RNAi) animals feeding on S. enterica was used to assess the susceptibility to S. enterica-mediated killing of elt-2RNAi animals. The relative mortality measure takes into account changes in life span due to a general modification in fitness rather than a specific defect in innate immunity against S. enterica. The relative mortality of elt-2(RNAi) animals was calculated as described in Materials and methods and determined to be 2.4 (Table 2). The relative mortality obtained is comparable to the relative mortality of animals lacking CED-3-mediated immunity [23] and greater than the relative mortality of animals lacking p38/PMK-1 [24], which is crucial for C. elegans immunity [25]–[28], indicating that the shortened life span of the elt-2(RNAi) animals infected by S. enterica is not simply a consequence of being sickly.
Table 2
Relative Mortality of elt-2 RNAi animals on S. enterica.
Bacteria
RNAi treatment
Experiment
TD50±SEM
Events/Obsa
S. enterica
control
1b
6.11±0.24
26/60
elt-2
2.06±0.17
40/60
control
2
8.99±0.35
9/20
elt-2
2.53±0.22
16/20
control
3
7.46±0.38
5/20
elt-2
3.98±0.36
12/20
control
4
6.67±0.25
30/60
elt-2
1.97±0.08
50/60
control
5
5.12±0.15
42/60
elt-2
2.81±0.09
46/60
control
6
7.17±0.27
20/40
elt-2
1.10±0.27
32/40
control
7
6.20±0.09
98/120
elt-2
0.82±0.12
56/60
E. coli
control
1c
13.48±0.15
16/20
elt-2
10.25±0.16
19/20
control
2
15.33±0.35
6/20
elt-2
10.96±0.16
18/20
control
3
12.15±0.13
13/20
elt-2
8.03±0.23
13/20
Bacteria
RNAi treatment
Mean±SD
S. enterica
control
6.82±1.14
S. enterica
elt-2
2.17±0.99
E. coli
control
13.65±1.30
E. coli
elt-2
9.75±1.25
Relative Mortality = 2.24
Wild type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to S. enterica SL1344 or E. coli OP50 on plates containing FUdR. TD50 and SEM were calculated as described in Experimental Procedures. Relative mortality is determined by the following equation: (TD50 of control worms on S. enterica/TD50 of elt-2 RNAi worms on S. enterica)/( TD50 of control worms on E. coli/mean TD50 of elt-2 RNAi worms on E. coli).
Animals that were not found or that died as a result of getting stuck to the wall of the plate were censored.
Indicates experiment depicted in Figure 1A.
Indicates experiment depicted in Figure 1B.
Wild type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to S. entericaSL1344 or E. coliOP50 on plates containing FUdR. TD50 and SEM were calculated as described in Experimental Procedures. Relative mortality is determined by the following equation: (TD50 of control worms on S. enterica/TD50 of elt-2RNAi worms on S. enterica)/( TD50 of control worms on E. coli/mean TD50 of elt-2RNAi worms on E. coli).Animals that were not found or that died as a result of getting stuck to the wall of the plate were censored.Indicates experiment depicted in Figure 1A.Indicates experiment depicted in Figure 1B.Interestingly, within 24 hours, elt-2(RNAi) animals show distended intestines full of E. coli that clearly contrast with the non-distended intestinal lumens of control animals (Figures 1C and 1D). This intestinal distension was not seen within 20 minutes of exposure to E. coli expressing DSred (data not shown), which indicates that intestinal distension of elt-2(RNAi) animals is caused by proliferating E. coli rather than by an abnormal intestinal structure. This is not surprising given that proliferating E. coli is a cause of death in C. elegans
[29], that E. coli grown on rich media kills C. elegans
[30], and that immunocompromised animals are killed by E. coli
[31]. Additionally, after 24 hours of exposure to E. coli expressing DSred, elt-2RNAi animals exhibited intestinal colonization by the bacteria; DSred fluorescence was present in the elt-2RNAi nematode intestine even after three one-hour-transfers onto fresh nonfluorescent E. coli plates (data not shown). This indicates that E. coli expressing DSred is able to persistently colonize elt-2RNAi animals, which is of interest as E. coli does not typically colonize the nematode intestine in a persistent fashion [14].To ensure that the intestinal distension and E. coli colonization are not caused by an unseen blockage or an inability of the intestinal muscles to move bacteria through the gut, the defecation of elt-2(RNAi) nematodes exposed to E. coli was measured. As shown in Figure 1E, defecation of elt-2(RNAi) animals is not significantly different from vector control animals. Indeed, while not significantly different, there is a consistent slight increase in the defecation of elt-2(RNAi) animals. Taken together, these results indicate that elt-2(RNAi) animals do not exhibit the Gob phenotype observed in elt-2 knockouts, that they do not die by starvation, and that they are immunocompromised animals killed by replicating bacteria capable of colonizing their intestine.
ELT-2 controls expression of clec-67 which is a marker of C. elegans immune response to S. enterica
To provide further evidence of the role of ELT-2 in innate immunity, we studied its involvement in the expression of the gene clec-67, which encodes a C-type lectin. Traditionally, C-type lectins function as soluble mediators that specifically bind carbohydrates, resulting in pathogen clearance by opsonization. A recent report shows that a C-type lectin encoding gene whose product possesses antimicrobial activity is upregulated in Paneth cells by microbial colonization, indicating that lectins are part of a primitive mechanism of innate immunity [32]. In addition, genes encoding C-type lectin domains have been found to be upregulated in C. elegans by a human opportunistic pathogen [33], a nematode specific pathogen [34], and a bacterial toxin [28], indicating that they are conserved markers of C. elegans immunity.We decided to use clec-67 as a marker of C. elegans immunity to S. enterica because it is consistently upregulated by this pathogen in several expression profiling experiments performed in our laboratory, because it is expressed in the intestine (Figure 2A), and because its promoter region contains a GATA binding site (A/T GATA A/G). As shown in Figure 2B, the clec-67 upregulation by S. enterica observed in our microarrays was confirmed by qRT-PCR. Figure 2B also shows that when elt-2 expression is ablated by RNAi, clec-67 is downregulated compared to vector control, indicating that ELT-2 regulates the expression of this effector of C. elegans immunity to S. enterica. To ensure that the differences in expression pattern of clec-67 are not due to intestinal defects in elt-2(RNAi) animals, we measured the expression of six intestinal housekeeping genes in elt-2(RNAi) and vector control nematodes exposed to S. enterica (Figure 2C). The expression of each of these genes is less than two-fold different from vector control, well within the error range of the assay, and much less than the differences seen in expression of clec-67. Therefore, the change in the expression pattern of clec-67 is due to changes in ELT-2 levels, and not to nonspecific changes in intestinal gene expression.
Figure 2
Expression of clec-67 is controlled by ELT-2.
(A) Pclec-67::gfp nematodes were grown on E. coli OP50 and were visualized using a Leica MZ FLIII fluorescence stereomicroscope.
(B) Microarray (white) and qRT-PCR (light grey) comparing expression of clec-67 in wild-type nematodes grown on S. enterica SL1344 versus wild-type nematodes grown on E. coli OP50.
qRT-PCR comparing expression of clec-67 in wild-type nematodes grown on E. coli carrying a vector control versus wild-type nematodes grown on E. coli expressing elt-2 double-stranded RNA (dark grey).
Results are the average of 3-7 independent experiments.
Error bars represent SEM.
(C) qRT-PCR comparing expression of a variety of intestinal housekeeping genes in wild-type nematodes grown on E. coli carrying a vector control versus wild-type nematodes grown on E. coli expressing elt-2 double-stranded RNA.
Results are the average of 5 independent experiments.
Error bars represent SEM.
Expression of clec-67 is controlled by ELT-2.
(A) Pclec-67::gfp nematodes were grown on E. coliOP50 and were visualized using a Leica MZ FLIII fluorescence stereomicroscope.(B) Microarray (white) and qRT-PCR (light grey) comparing expression of clec-67 in wild-type nematodes grown on S. entericaSL1344 versus wild-type nematodes grown on E. coliOP50.qRT-PCR comparing expression of clec-67 in wild-type nematodes grown on E. coli carrying a vector control versus wild-type nematodes grown on E. coli expressing elt-2 double-stranded RNA (dark grey).Results are the average of 3-7 independent experiments.Error bars represent SEM.(C) qRT-PCR comparing expression of a variety of intestinal housekeeping genes in wild-type nematodes grown on E. coli carrying a vector control versus wild-type nematodes grown on E. coli expressing elt-2 double-stranded RNA.Results are the average of 5 independent experiments.Error bars represent SEM.
ELT-2 is required for proper C. elegans immunity to a variety of microbial pathogens
To determine whether ELT-2 is part of an immune system specific to S. enterica or whether it is required for immunity to pathogens in general, elt-2(RNAi) animals were infected with the Gram-negative bacterial pathogen P. aeruginosa
[35], the Gram-positive bacterial pathogen E. faecalis
[30], and the fungal pathogen C. neoformans
[36] as described. For all of these pathogens, elt-2(RNAi) animals exhibit increased mortality compared to vector control animals (Figure 3). These data indicate that RNAi ablation of elt-2 increases C. elegans susceptibility to different types of bacterial and fungal pathogens.
Figure 3
elt-2(RNAi) animals are more susceptible than wild-type nematodes to a variety of pathogens.
(A)Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to P. aeruginosa PA14 (P = 0.0001).
(B) Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to E. faecalis OG1RF (P<0.0001).
(C) Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to C. neoformans H99 (P<0.0001).
60–120 nematodes were used for each condition.
Results are representative of at least 3 independent experiments.
elt-2(RNAi) animals are more susceptible than wild-type nematodes to a variety of pathogens.
(A)Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to P. aeruginosa PA14 (P = 0.0001).(B) Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to E. faecalis OG1RF (P<0.0001).(C) Wild-type nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to C. neoformans H99 (P<0.0001).60–120 nematodes were used for each condition.Results are representative of at least 3 independent experiments.The DAF-2/DAF-16 insulin-like pathway which regulates longevity in C. elegans has recently been linked to immunity against bacteria. DAF-16 is a FOXO transcription factor, which regulates a wide variety of genes required for longevity, stress-response, development, and immunity [37], [38], and it is negatively regulated by DAF-2 [39]. Thus, daf-2 mutants exhibit higher DAF-16 activity and are more resistant to different bacterial pathogens [31], [40], [41]. Because our data indicate that ELT-2 regulates a multi-pathogen immune response, we studied whether the transcription factor is required for the effects of DAF-2 in immunity to pathogens. First, we studied whether daf-2(e1370) mutants were more resistant to the fungal pathogen Cryptococcus neoformans and then whether RNAi ablation of elt-2 reduces the resistance phenotype of daf-2(e1370) animals. As shown in Figure 4, daf-2(e1370) mutants are more resistant not only to S. enterica and E. faecalis, as previously shown [40], but also to Cryptococcus neoformans, indicating that DAF-2 regulates immune response to pathogens in general. Furthermore, this increased resistance to C. neoformans is dependent upon DAF-16 function as daf-2(e1370);daf-16(RNAi) nematodes have increased mortality when compared to daf-2(e1370) mutants (Figure 4D).
Figure 4
The daf-2(e1370) mutation rescues the increased susceptibility to pathogens phenotype of elt-2(RNAi) animals.
(A) Wild-type and daf2(e1370) nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to S. enterica SL1344.
Significant differences were found when wild-type was compared to daf-2(e1370) (P<0.0001), when elt-2(RNAi) was compared to daf-2(e1370);elt-2(RNAi) (P<0.0001), and when daf-2(e1370) was compared to daf-2(e1370);elt-2(RNAi) (P<0.0001).
(B) Wild-type and daf2(e1370) nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to E. faecalis OG1RF.
Significant differences were found when wild-type was compared to daf-2(e1370) (P = 0.0056), when elt-2(RNAi) was compared to daf-2(e1370);elt-2(RNAi) (P<0.0001), and when daf-2(e1370) was compared to daf-2(e1370);elt-2(RNAi) (P<0.0001).
(C) Wild-type and daf2(e1370) nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to C. neoformans H99 (P<0.0001).
Significant differences were found when wild-type was compared to daf-2(e1370) (P = 0.0174) and when elt-2(RNAi) was compared to daf-2(e1370);elt-2(RNAi) (P<0.0001).
No significant difference was found when daf-2(e1370) was compared to daf-2(e1370);elt-2(RNAi) (P = 0.1666).
(D) Wild-type and daf2(e1370) nematodes grown on E. coli carrying a vector control or on E. coli expressing daf-16 double-stranded RNA were exposed to C. neoformans H99.
A significant difference was found when daf-2(e1370) was compared to daf-2(e1370);daf-16(RNAi) (P<0.0001), but no significant difference was found when wild-type was compared to daf-16(RNAi) (P = 0.9375).
60-240 nematodes were used for each condition.
Results are representative of at least 3 independent experiments.
The daf-2(e1370) mutation rescues the increased susceptibility to pathogens phenotype of elt-2(RNAi) animals.
(A) Wild-type and daf2(e1370) nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to S. entericaSL1344.Significant differences were found when wild-type was compared to daf-2(e1370) (P<0.0001), when elt-2(RNAi) was compared to daf-2(e1370);elt-2(RNAi) (P<0.0001), and when daf-2(e1370) was compared to daf-2(e1370);elt-2(RNAi) (P<0.0001).(B) Wild-type and daf2(e1370) nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to E. faecalis OG1RF.Significant differences were found when wild-type was compared to daf-2(e1370) (P = 0.0056), when elt-2(RNAi) was compared to daf-2(e1370);elt-2(RNAi) (P<0.0001), and when daf-2(e1370) was compared to daf-2(e1370);elt-2(RNAi) (P<0.0001).(C) Wild-type and daf2(e1370) nematodes grown on E. coli carrying a vector control or on E. coli expressing elt-2 double-stranded RNA were exposed to C. neoformans H99 (P<0.0001).Significant differences were found when wild-type was compared to daf-2(e1370) (P = 0.0174) and when elt-2(RNAi) was compared to daf-2(e1370);elt-2(RNAi) (P<0.0001).No significant difference was found when daf-2(e1370) was compared to daf-2(e1370);elt-2(RNAi) (P = 0.1666).(D) Wild-type and daf2(e1370) nematodes grown on E. coli carrying a vector control or on E. coli expressing daf-16 double-stranded RNA were exposed to C. neoformans H99.A significant difference was found when daf-2(e1370) was compared to daf-2(e1370);daf-16(RNAi) (P<0.0001), but no significant difference was found when wild-type was compared to daf-16(RNAi) (P = 0.9375).60-240 nematodes were used for each condition.Results are representative of at least 3 independent experiments.To address whether the DAF-2 pathway regulates the immune system of the nematode via ELT-2, RNAi was used to ablate elt-2 in daf-2(e1370) animals which were then exposed to S. enterica, E. faecalis, and C. neoformans. Visibly, the daf-2(e1370);elt-2(RNAi) nematodes appear similar to elt-2(RNAi) animals, being thinner, and more transparent than wild-type nematodes or daf-2(e1370) mutants. However, the daf-2(e1370); elt-2(RNAi) nematodes are significantly more resistant to all pathogens tested than elt-2RNAi animals (Figure 4). Interestingly, daf-2(e1370); elt-2(RNAi) animals have increased resistance to E. faecalis compared to daf-2(e1370) animals, indicating that ELT-2 may suppress immune defenses specific to E. faecalis that are typically inhibited by DAF-2. Control experiments indicate that daf-2(e1370);daf-16(RNAi) animals have increased susceptibility to all pathogens when compared to daf-2(e1370) (Figure 4D and data not shown).
Discussion
Our results suggest that the GATA transcription factor ELT-2 regulates a C. elegans innate immunity independently of DAF-2/DAF-16 and that it regulates the expression of clec-67 which is a marker of C. elegans immunity to S. entericainfection. Previously, ELT-2 had been linked to intestinal development, but its role in innate immunity was unknown. Since DAF-16 does not appear to be required for immunity to bacterial [40] and fungal pathogens (Figure 4C), the ELT-2 requirement for proper immunity to bacterial and fungal pathogens described here provides one of the first direct evidences indicating that a C. elegans transcription factor is required not only for the expression of immunity-related genes but also for survival in the presence of pathogens. Consistent with our results, a paper published while this manuscript was being prepared indicates that ELT-2 is required for immunity to Pseudomonas aeruginosa
[13].The most well-known mammalianGATA transcription factor is GATA-3, which regulates the development of CD4+ T cells to a Th2 phenotype [42]. However, since C. elegans does not have adaptive immunity, our data indicate that GATA transcription factors are also involved in innate immune responses. This is supported by other invertebrate models, where GATA binding elements have been found in the promoters of genes important in defense responses of D. melanogaster
[43]–[45], the silkwormBombyx mori
[46], and the mosquito Aedes aegypti
[47]. GATA transcription factors are evolutionarily conserved in a wide variety of eukaryotes and are most often involved in cellular development and differentiation [48]. Human GATAs 4–6, which are the most similar to C. elegansELT-2, are involved in development of gut and cardiac tissue. Additionally, humanGATA-4 has been shown to regulate cardiac stress responses [49]–[51], indicating that GATA-4 may have more than a developmental role in mammals.Since C. elegans does not appear to have functional NF-κB-like transcription factors, ELT-2 may be an ancestral transcription factor required for surviving microbial infections in a common ancestor of nematodes and vertebrates. The only other C. elegans transcription factor, DAF-16, known to regulate the expression of classical immune effectors, is not required for defense to bacterial pathogens. We show here that like DAF-16, ELT-2 appears to regulate the expression of immune effectors. In addition, it seems to be required for survival in the presence of Gram-negative bacteria, Gram-positive bacteria, and fungal pathogens. Lack of immune inhibition by DAF-2 rescues, fully or partially, the hypersusceptibility to pathogens phenotype of elt-2(RNAi) animals suggesting both that elt-2(RNAi) animals do not have developmental defects that make them more susceptible to pathogens and that ELT-2 acts upstream or independently of the DAF-2/DAF-16 pathway. The facts that RNAi ablation of ELT-2 results in an increased susceptibility to pathogens and that RNAi ablation of DAF-16 (Figure 4) or mutations in daf-16
[40] does not affect the susceptibility to pathogens argue in favor of the second possibility. Taken together, our results indicate that DAF-16 and ELT-2 are two key transcription factors that regulate two independent pathways required for C. elegans innate immunity to microbial pathogens.
Materials and Methods
Microbial and nematode strains
The following strains were used: Escherichia coli OP50 [52], Salmonella enterica serovar typhimuriumSL1344 [53], Enterococcus faecalis OG1RF [54], Cryptococcus neoformans H99 [55], and Pseudomonas aeruginosa PA14 [35]. C. elegans strains utilized were wild-type N2 and daf-2(e1370). These strains were originally obtained from the Caenorhabditis Genetics Center and maintained in our laboratory.
Transgenic Animals
To generate the Pclec-67::gfp construct, the genomic region 520 to 20 bp upstream of clec-67 was PCR amplified using the following primers generated by PCR Primer Design for C. elegans promoter::gfp fusions (http://elegans.bcgsc.bc.ca/promoter_primers/): TCGTTTCTAATGCTCTCGGAA and TGGGTCCTTTGGCCAATCCCGGGGCGTTTTATGCGGGTTTGTTTA. The gfp sequence was amplified from pPD95.79 (Addgene, Cambridge, MA) by PCR with the following primers: CCCGGGATTGGCCAAAGGACCCAAAG and CCGCTTACAGACAAGCTGTGACCG. These PCR products were mixed and an additional PCR with the outside primers was performed to fuse the promoter and gfp sequences. The linear PCR product of this reaction was injected at 10 ng/µl into N2 animals to create the transgenic line. The coinjection marker pRF4 was injected at 50 ng/µl. Transgenic animals were anesthetized with 10% sodium azide solution and visualized using a Leica MZ FLIII fluorescence stereomicroscope.
C. elegans killing assays
C. elegans wild-type N2 animals and daf-2 mutants were maintained as hermaphrodites at 15°C, grown on modified NG agar plates and fed with E. coli strain OP50 as described [52]. Cultures were grown in Luria-Bertani (LB) broth and agar plates, except C. neoformans H99 and E. faecalis OG1RF which were grown in yeastpeptone dextrose (YPD) and brain-heart infusion (BHI) medium, respectively. All pathogens were grown at 37°C except C. neoformans which was grown at 30°C. Pathogen lawns used for C. elegans killing assays were prepared by spreading 10–20 µl of an overnight culture of the bacterial strains on modified NG agar medium (0.35% peptone) in 3.5 cm diameter Petri plates. C. neoformans and E. faecalis were plated on BHI with 50 µg/ml gentamycin selection. Plates were incubated overnight before seeding them with young adult RNAi animals, created as described above. The killing assays were performed at 25°C and animals were transferred once a day to fresh plates, until no more progeny were evident. Animals were scored at the times indicated and considered dead upon failure to respond to touch.
C. elegans defecation assays
RNAi animals were transferred individually either directly from RNAi plates (time 0) or after 24 hours of exposure to E. coliOP50 on modified NGM plates with 0.35% peptone. Animals were initially individually transferred to clean LB agar plates for 10 minutes to remove excess bacteria, then transferred to a new LB agar plate and allowed to defecate for 2 hours at 25°C. Animals were then removed, and the plates incubated overnight at 37°C. Amount of defecation was determined by counting colonies of E. coli on each plate. Data were normalized to the median colony count of vector control for each experiment.
C. elegans aging assays
Modified NGM plates containing 0.35% peptone and 100 µg/ml 5-fluorodeoxyuridine FUdR [56] were plated with E. coliOP50 lawns and allowed to incubate at 37°C overnight. Young adult RNAi animals were seeded onto these plates, and scored as indicated for C. elegans killing assays. As FUdR inhibits growth of progeny, daily transfer of nematodes was unnecessary.
RNA interference
We used RNA interference to generate loss-of-function RNAi phenotypes by feeding worms with E. coli strain HT115(DE3) expressing double-stranded RNA that is homologous to a target gene [57], [58]. Briefly, E. coli harboring the appropriate vectors were grown in LB broth containing ampicillin (100 µg/ml) and tetracycline (10 µg/ml) at 37°C overnight. Bacteria were plated onto NGM plates containing 100 µg/ml ampicillin and 10 mM Isopropyl β-D-thiogalactoside (IPTG) to induce double-stranded RNA expression, and were allowed to grow overnight at 37°C.Gravid adults were allowed to lay eggs on RNAi-expressing lawns of bacteria for 6-12 hours. The eggs were allowed to develop into young adults on RNAi or vector control plates at 25°C or at 15°C in experiments involving daf-2(e1370). Unc-22RNAi was used as a positive control for the creation of loss-of-function phenotypes. Bacterial strains expressing double-stranded RNA to inactivate the C. elegans genes have been described [17]. The clone identity was confirmed by sequencing. RNAi-mediated ablation of elt-2 results in animals that despite being typically smaller and thinner than control counterparts, do survive to adulthood and do not die by starvation (Figure 1B).
Statistical analyses
Animal survival was plotted as a staircase curve using the PRISM (version 4.00) computer program. Survival curves are considered significantly different than the control when P values are <0.05. Prism uses the product limit or Kaplan-Meier method to calculate survival fractions and the logrank test, which is equivalent to the Mantel-Heanszel test, to compare survival curves. The time for 50% of the nematodes to die (time to death 50, TD50) was calculated using Prism software (version 4.01) using a non-linear regression analysis of survival proportions utilizing the equation: Y = Bottom+(Top-Bottom)/(1+10 (LogEC
50
-X)*Hill Slope)), where Top is set at 100, Bottom is set at 0, X is the time in days and Y is the percentage of nematodes alive at time X. In this instance, TD50 is equivalent to EC50. The relative mortality of elt-2RNAi animals was calculated using the equation: (TD50 of control worms on S. enterica/TD50 of elt-2RNAi worms on S. enterica)/(TD50 control worms on E. coli/TD50 of elt-2RNAi on E. coli).
Confocal microscopy
Modified NGM plates with 0.35% peptone were plated with overnight cultures of E. coliOP50 carrying the pDSred Express plasmid (Invitrogen) and allowed to incubate overnight. Vector control or elt-2RNAi young adult nematodes were seeded onto these plates and allowed to feed at 25°C. At the times indicated, the animals were removed from the plates and placed on microscope slides with 2% agarose pads in 10% sodium azide solution. A coverslip was placed on top of the agar pad, and sealed with clear nail polish. Images were captured at the indicated magnifications using a Leica TCS SL confocal microscope and Leica Confocal software (version 2.61 Build 1537) (Leica Microsystems Heidelberg GmbH). Images were resized and adjusted for brightness and contrast in Adobe Photoshop.
RNA isolation
Gravid adult N2 nematodes were lysed using a solution of sodium hydroxide and bleach, washed, and the eggs synchronized overnight in S basal liquid medium at room temperature. Synchronized L1 animals were seeded onto modified NGM plates with 0.35% peptone containing S. enterica or E. coliOP50, and incubated at 25°C until the nematodes attained young adult stage (approximately 24–30 hours). The animals were then collected by washing the plates with M9 buffer, and RNA extracted using Trizol reagent. Samples were further purified using a QIAGEN RNeasy kit and residual genomic DNA removed using DNase treatment (DNA-free kit Ambion Inc Austin TX). RNA concentration was determined by spectrophotometer and samples were diluted to 10ng/ul in RNase free water. A minimum of two individual RNA isolations was performed for each experiment.
Quantitative Real-time PCR (qRT-PCR)
qRT-PCR was conducted using the Applied Biosystems Taqman One-Step Real-time PCR protocol using SYBR Green fluorescence (Applied Biosystems) on an Applied Biosystems 7900HT real-time PCR machine in 96 well plate format. Primers were designed using Aceprimer version 1.2 (http://elegans.bcgsc.bc.ca/aceprimer/aceprimer.shtml). Each independent RNA preparation was measured at least twice by qRT-PCR. Within each experiment, a minimum of duplicate wells was run for every primer set. The data for each gene were normalized to the housekeeping gene, ama-1, the large subunit of C. elegans RNA polymerase II. Once normalized, the fold difference between SL1344 and OP50 samples was determined and plotted using PRISM.
Authors: Michael Shapira; Brigham J Hamlin; Jiming Rong; Karen Chen; Michal Ronen; Man-Wah Tan Journal: Proc Natl Acad Sci U S A Date: 2006-09-12 Impact factor: 11.205
Authors: N Pujol; E M Link; L X Liu; C L Kurz; G Alloing; M W Tan; K P Ray; R Solari; C D Johnson; J J Ewbank Journal: Curr Biol Date: 2001-06-05 Impact factor: 10.834
Authors: D A Garsin; C D Sifri; E Mylonakis; X Qin; K V Singh; B E Murray; S B Calderwood; F M Ausubel Journal: Proc Natl Acad Sci U S A Date: 2001-09-04 Impact factor: 11.205
Authors: John S Reece-Hoyes; Bart Deplancke; Jane Shingles; Christian A Grove; Ian A Hope; Albertha J M Walhout Journal: Genome Biol Date: 2005-12-30 Impact factor: 13.583
Authors: Wesley Reardon; Sohini Chakrabortee; Tiago Campos Pereira; Trevor Tyson; Matthew C Banton; Katharine M Dolan; Bridget A Culleton; Michael J Wise; Ann M Burnell; Alan Tunnacliffe Journal: BMC Mol Biol Date: 2010-01-19 Impact factor: 2.946