Literature DB >> 17014718

Intrinsic and selected resistance to antibiotics binding the ribosome: analyses of Brucella 23S rrn, L4, L22, EF-Tu1, EF-Tu2, efflux and phylogenetic implications.

Shirley M Halling1, Allen E Jensen.   

Abstract

BACKGROUND: Brucella spp. are highly similar, having identical 16S RNA. However, they have important phenotypic differences such as differential susceptibility to antibiotics binding the ribosome. Neither the differential susceptibility nor its basis has been rigorously studied. Differences found among other conserved ribosomal loci could further define the relationships among the classical Brucella spp.
RESULTS: Minimum inhibitory concentration (MIC) values of Brucella reference strains and three marine isolates to antibiotics binding the ribosome ranged from 0.032 to >256 microg/ml for the macrolides erythromycin, clarithromycin, and azithromycin and 2 to >256 microg/ml for the lincosamide, clindamycin. Though sequence polymorphisms were identified among ribosome associated loci 23S rrn, rplV, tuf-1 and tuf-2 but not rplD, they did not correlate with antibiotic resistance phenotypes. When spontaneous erythromycin resistant (eryR) mutants were examined, mutation of the peptidyl transferase center (A2058G Ec) correlated with increased resistance to both erythromycin and clindamycin. Brucella efflux was examined as an alternative antibiotic resistance mechanism by use of the inhibitor L-phenylalanine-L-arginine beta-naphthylamide (PAbetaN). Erythromycin MIC values of reference and all eryR strains, except the B. suis eryR mutants, were lowered variably by PAbetaN. A phylogenetic tree based on concatenated ribosomal associated loci supported separate evolutionary paths for B. abortus, B. melitensis, and B. suis/B. canis, clustering marine Brucella and B. neotomae with B. melitensis. Though Brucella ovis was clustered with B. abortus, the bootstrap value was low.
CONCLUSION: Polymorphisms among ribosomal loci from the reference Brucella do not correlate with their highly differential susceptibility to erythromycin. Efflux plays an important role in Brucella sensitivity to erythromycin. Polymorphisms identified among ribosome associated loci construct a robust phylogenetic tree supporting classical Brucella spp. designations.

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 17014718      PMCID: PMC1617103          DOI: 10.1186/1471-2180-6-84

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Brucellosis is a zoonotic disease caused by the Gram-negative bacterium Brucella. It is taxonomically related to plant pathogens and other animal symbionts and is transmitted to humans from infected domestic animals and wildlife through contact during animal husbandry practices, meat production, or by ingestion of unpasteurized milk products. The genus Brucella contains six classical species reflecting host preferences [1,2], and additional species have been proposed to include marine isolates from seal, dolphin, and porpoise [3]. The classical species and their hosts are: B. abortus, bovine; B. melitensis, caprine; B. suis, porcine; B. ovis, ovine; B. canis, canine; and B. neotomae, desert wood rat. However, B. suis and B. canis have similar metabolic profiles [4] and genomic maps [5], supporting their close relationship. Similarly, the metabolic characteristics and phage susceptibility of B. suis biovar 5 are more like that of B. melitensis rather than B. suis [6,7]. The classical Brucella spp. designations are still widely used to emphasize important pathogenicity, virulence, and host preference differences among the Brucella even though similarity among the ribosomal RNA loci led to the designation of Brucella as a monospecific species [8,9], B. melitensis. Brucella speciation may have arisen as a result of their isolation due to different preferred hosts and to divergence of the host species [10] even though their 16S rrn loci are identical [11-14]. In any case, discordant genotype/phenotype may require the use of other widely conserved loci to define bacterial species [15,16]. Meyer [17] found differences in sensitivity to erythromycin among the classical species of Brucella and their biovars by measuring inhibition of growth using high and low concentration antibiotic discs. Brucella abortus biovars except biovar 2 were resistant to erythromycin, and B. ovis, B. melitensis, and B. canis were intermediate in resistance between B. abortus and B. suis. Only B. suis strains were sensitive to the high concentration antibiotic discs. Meyer argued that investigating the ribosomal structure could explain these differences in sensitivity and generate critical knowledge "to account for and recapitulate the lineage of species and biotypes of Brucella". Bacterial susceptibility to macrolide and lincosamide antibiotics results from their binding to 23S rRNA, inhibiting protein synthesis by blocking the peptide exit tunnel [18-20]. Bacteria can become resistant to macrolides and lincosamides by spontaneous mutations of ribosomal associated loci or by increased efflux. Resistance to macrolides and lincosamides is commonly due to (i) mutation of 23S rrn causing a reduction in the binding of the antibiotics to the peptidyl transferase center [21,22], typically nts A2058, A2059, A2062, and C2611, Escherichia coli (Ec) 23S rRNA numbering, (ii) mutation of ribosomal proteins L4 or L22 leading to widening the entrance to the peptide exit tunnel allowing access to the tunnel even in the presence of the antibiotics [18,20,23-25], (iii) methylation of ribosomal 23S rRNA [26], or (iv) increased efflux [27,28]. Bacterial resistance to synthetic macrolides or ketolides can be conferred by mutation of ribosome associated factor EF-Tu [29]. There are several families of efflux pumps, though few non-RND (resistance nodulation division) family efflux pumps cause intrinsic or spontaneous resistance of Gram-negative bacteria to common clinical antibiotics [27,28,30,31]. Inability to demonstrate efflux activity however does not necessarily mean a lack of efflux. Efficiency of efflux of antibiotics is variable, being dependent on the structure of the antibiotic. Antibiotic resistance can be complex as observed for Haemophilus influenzae L22 mutant HMC-C [32]. For this mutant, an increase in macrolide MIC values was only shown in the presence of efflux [33]. Here, we show that the large differences in relative intrinsic susceptibilities of reference strains of Brucella and three marine isolates to macrolide antibiotics and a lincosamide do not correlate with ribosomal associated polymorphisms. We establish that antibiotic efflux plays an important role in differential antibiotic susceptibility in Brucella. A robust phylogenetic tree constructed from concatenation of ribosome associated polymorphisms illuminates relationships among the Brucella.

Results

MIC determination by Etest

The relative MIC values of the classical Brucella spp. and three marine isolates (Table 1) to macrolides and a lincosamide were determined by use of the Etest. Log-fold differences in MIC values were found (Fig. 1). The susceptibility of Brucella was similar for the three macrolides erythromycin, azithromycin, and clarithromycin. Only B. abortus, except biovar 2, and B. melitensis had MIC values of ≥ 16 μg/ml. The pattern of sensitivity of Brucella to the lincosamide clindamycin differed from that of the macrolides. Generally, MIC values were higher for clindamycin than for the macrolides. Brucella abortus, except biovar 2, was the most resistant to clindamycin, having MIC values of ≥ 128 ug/ml. Only B. melitensis biovars 2 and 3 had lower MIC values for clindamycin than for erythromycin. For B. suis, clindamycin MIC values ranged from a low of 3 μg/ml to a high of 24 μg/ml. The other Brucella with the exception of the seal isolate, ranged from 2 to 64 μg/ml. The seal isolate was resistant to clindamycin.
Table 1

Strains of Brucella used in this study.

SpeciesBiovarStrainHostOriginReference
B. abortus1544CattleEnglandATCC* 23448
19–941CattleUSA11
286/8/59CattleEnglandATCC 23449
3TulyaCattle**UgandaATCC 23450
4292CattleEnglandATCC 23451
5B3196CattleEnglandATCC 23452
6870CattleAfricaATCC 23453
9C68CattleEnglandATCC 23455
B. canisRM6/66DogUSAATCC 23365
B. melitensis116 MGoatUSAATCC 23456
263/9GoatTurkeyATCC 23457
3EtherGoat**ItalyATCC 23458
B. neotomae5K33Wood ratUSAATCC 23459
B. ovis63/290SheepAfricaATCC 25840
B. suis11330PigUSAATCC 23444
2ThomsenHareDenmarkATCC 23445
3686Pig**USAATCC 23446
440ReindeerUSSRATCC 23447
5513MouseUSSR***
Brucella spp.2/94SealScotland6
("maris")1/94PorpoiseScotland6
14/94DolphinScotland6

*ATCC, American Type Culture Collection, Beltsville, MD; **Isolate from human; ***Reference strain 513 not deposited in ATCC.

Figure 1

Minimal inhibitory concentration (MIC) of antibiotics to . MICs of three macrolides, azithromycin, clarithromycin, erythromycin, and the lincosamide, clindamycin, were determined by Etest. Maximum MIC measurable by the Etest is 256 μg/ml for each of the antibiotics. Brucella strains as listed in Table 1. Ba = B. abortus ; Bs = B. suis; Bm = B. melitensis; Bc = B. canis; Bn = B. neotomae; Bo = B. ovis; numbers following species designate biovar.

23S rrn sequence comparisons

Sequences of two regions of the Brucella 23S rrn encoding 2498 nts (69 to 1678 and 1920 to 2807), including sites of 23S rrn mutations known to increase bacterial resistance to macrolides and clindamycin were determined and compared (Table 2). Mixtures of cells or DNA (1:3) with disparate 23S rrn sequences were amplified to demonstrate that heterogeneity among the three 23S rrn copies would be detectable (data not shown). Though the distal portion of 23S rrnC from the genomic B. suis 1330 sequence could not be amplified with either of two primer pairs that were complementary to the published B. suis 23S rrnC genomic sequence, amplification was successful using primers homologous to internal, conserved genomic rrnC sequences from all three Brucella genomes and sequences flanking rrnC from B. abortus and B. melitensis. The amplified distal portion of rrnC from B. suis 1330 was identical in sequence to that of rrnA and rrnB from B. suis. Among the 23S rrn sequences from Brucella, three polymorphic and three monomorphic sites were identified. In addition, three monomorphisms were identified in the 23S rrn intervening sequences.
Table 2

Brucella 23S rrn polymorphisms&.

#Brucella strains*Nt 1085 934 (Ec)*Nt 1564 1423 (Ec)*Nt 2632 2610 (Ec)



AGAGTC
Ba b1XXX
Ba b2XXX
Ba b3XXX
Ba b4XXX
Ba b5XXX
Ba b6XXX
Ba b9XXX
BcXXX
Bs b1XXX
Bs b2XXX
Bs b3XXX
Bs b4XXX
Bs b5XXX
BoXXX
BnXXX
Bm b1XXX
Bm b2XXX
Bm b3XXX
DolphinXXX
PorpoiseXXX
SealXXX

&GenBank accession numbers for each Brucella 23S rrn sequences are listed in Methods. #Brucella strains are as listed in Table 1. *Nt positions as per B. abortus 23S rrnA [GenBank:AE017223, BruAb1_rrna_0005, Gene ID: 3339965]. (Ec) denotes position in Escherichia coli 23S rrn [GenBank:U00096].

23S rrn polymorphisms were detected at nts 1085 (934, Ec), 1564 (1423, Ec), and 2632 (2610, Ec), clustering the Brucella into three groups: (1) B. abortus, (2) B. canis and B. suis, except biovar 5, and (3) B. melitensis, B. ovis, B. neotomae, B. suis biovar 5, and the dolphin, seal and porpoise isolates (Table 2). Note that all the 23S rrn Brucella positions are numbered based on B. abortus 23S rrnA, including the intervening sequence. The only polymorphism that occurred in the peptidyl transferase center was nt 2632 (2610, Ec). No correlation could be made between the polymorphisms and relative antibiotic susceptibility. Other sites known to affect susceptibility to macrolides and clindamycin were not polymorphic. Monomorphisms were found in both 23S rrn and in the 23S rrn intervening sequences. Monomorphisms were identified in 23S rRNAs from dolphin (A955G); B. neotomae (insertion of a C between nt 1002–1006); and B. suis biovar 5 (T2090C). Several intervening sequences of the Brucella 23S rrn loci varied from the consensus sequence reported by Bricker [34]. The C indel in the intervening sequences of B. melitensis 16 M, forming a string of six Cs instead of five beginning at nt 222, reported by Bricker was confirmed. The other two monomorphisms occurred in B. suis biovar 5 (C219T) and B. melitensis biovar 3 (C206T).

L4 analyses

Though the GenBank Brucella genomic rplD sequences encoding ribosomal protein L4, differed due to an indel in rplD found only in the B. melitensis 16 M genomic sequence, we did not observe this indel in our sequence of rplD from B. melitensis 16 M. We found the three rplD genes from the genomes were identical. Though no polymorphisms were identified among the rplD sequences, three monomorphisms were discovered among their amino termini. Two sequence transitions, B. neotomae (G108A) and B. suis biovar 2 (C213T), were found. Both of which were silent. A transversion identified in the porpoise isolate (G314T) would replace an Arg, a charged amino acid (aa), with Leu, a noncharged one.

L22 polymorphisms

Putative L22 sequences from the Brucella reference strains and three marine isolates (Fig. 2) were determined and their tertiary structures predicted and compared by using Swiss-Pdb Viewer (Fig. 3). Among the Brucella putative L22 sequences, all variations except one occurred in the β-hairpin loops or near the carboxy termini. Brucella suis biovar 5 alone had an alternate Ala codon at aa 44. The Brucella β-hairpin loops were polymorphic and variable in length due to variable copy numbers of a two aa motif, Gly-Arg. The lengths of all the β-hairpin loops of putative L22 peptides except those from B. neotomae and B. suis biovars 2 and 3 were equal, 11 aa. The β-hairpin loops of L22 from B. suis biovars 2 and 3 were shorter due to a net two aa (Gly-Arg) deletion, while the β-hairpin loop from B. neotomae was longer due to a net two aa (Gly-Arg) insertion. Within the loop of the β-hair pin at aa 101, there was either a Gly, Val, or an Asp. While the variation of sequence at aa 101 of L22 did not greatly affect the predicted tertiary structures, the indels did (Fig. 3). A polymorphism was also identified very near the 3'-end of rplV. L22 polymorphic sites grouped the Brucella differently than other loci in this study. Putative L22 sequences from B. abortus and B. melitensis were identical. Brucella suis biovars 1, 4 and 5, and the marine isolates were identical. Putative L22 sequences from B. suis biovars 2 and 3 differed from those of biovars 1, 4 and 5 in having one rather than two Gly-Arg motifs. Putative L22 sequences from both B. ovis and B. neotomae were unique. No correlation could be made between relative antibiotic susceptibilities of the Brucella strains and their L22 sequences.
Figure 2

Ribosomal protein L22 polymorphisms among . The putative peptide sequence of L22 is underlined, parentheses bracket polymorphic sites and list amino acids found among L22 peptides at that site. In regions where sequence was variable, the sequence for each putative Brucella L22 is given below. Amino acids occurring in the stalk of the β-hairpin appear in and amino acids occurring in the loop of the β-hairpin are in bold. Beneath amino acids that are double underlined is a list of Brucella strains containing those aa. The single letter code is used to denote the putative aa sequence of the peptides; b = biovar and numbers following "b" designate biovar numbers. Accession numbers of rplV sequences for each strain are deposited in GenBank and are listed in Materials.

Figure 3

Ribbon diagrams showing predicted secondary structures of ribosomal L22 proteins. The divergent, putative aa sequences from the reference Brucella strains and three marine isolates are found in Fig. 2. The ribbon structures for each group is as follows: (A) B. abortus and B. melitensis; (B) B. canis, B. suis biovars 1, 4, and 5, and the marine isolates, (C) B. ovis; (D) B. suis biovars 2 and 3; and (E) B. neotomae. Structures were predicted based on coordinates of L22 from Thermus thermophilus [52] and prepared using Swiss-Pdb viewer [50, 51]. Region containing β-hairpin loops (→).

EF-Tu sequence comparisons

Though the nt sequences of EF-Tu loci, tuf-1 and tuf-2, were polymorphic (Table 3), the putative peptide sequences of EF-Tu1 and -2 were conserved. In most Brucella strains, tuf-1 and tuf-2 sequences were identical. In the cases where they were not identical, they varied by a single nt near either the 5' or 3' termini of the genes, namely nt 12 and nt 1158. Unlike the 23S rrn sequences, the sequences of tuf-1 and tuf-2 from B. abortus were more similar to those from B. suis than from B. melitensis. The reference B. abortus biovar 1 strain, 544, differed from that of the sequenced strain, B. abortus biovar 1 strain 9–941 (Table 3). Nt 1158 of tuf-2 from B. abortus 544 differed from B. abortus biovar 1 strains 2308 and 9–941. Further, nt position 1158 of tuf-1 from B. abortus strains 9–941 and 2308 was identical to those from B. abortus biovars 2 and 4 but differed from the other B. abortus biovars. Whereas a single nt varied among copies of tuf-1 and tuf-2 from B. abortus biovar 1 strain 9–941 and B. suis 1330, eight nt varied between B. suis 1330 and B. melitensis 16 M. The other classical spp. and the marine Brucella were intermediate between B. abortus/B. suis and B. melitensis (Table 3).
Table 3

Polymorphic sites among tuf-1 and tuf-2 from Brucella.

$Nt position12361411831982193453785116099361158

#Bru↓|Nt→TCCTCTCAGAAGCTCTCAGACTCT
Bab 9–941XXXXXXXXXXX21
Bab b1XXXXXXXXXXXX
Bab b2XXXXXXXXXXX21
Bab b3XXXXXXXXXXXX
Bab b4XXXXXXXXXXX21
Bab b5XXXXXXXXXXXX
Bab b6XXXXXXXXXXXX
Bab b9XXXXXXXXXXXX

B. suis b1XXXXXXXXXXXX
B. suis b212XXXXXXXXXXX
B. suis b312XXXXXXXXXXX
B. suis b4XXXXXXXXXXXX
B. suis b512XXXXXXXXXXX

Bmel b1XXXXXXXXXXXX
Bmel b2XXXXXXXXXXXX
Bmel b3XXXXXXXXXXXX

BneoXXXXXXXXXXXX
B. ovisXXXXXXXXXXXX
B. canis12XXXXXXXXXXX

Seal12XXXXXXXXXXX
Dolphin12XXXXXXXXXXX
PorpoiseXXXXXXXXXXXX

$Nt = nucleotide; #Brucella strains, see Table 1; X = tuf-1 and tuf-2 have identical sequences; 1 = tuf-1 sequence only, 2 = tuf-2 sequence only. Polymorphic sites are in bold. tuf-1 and tuf-2 GenBank accession numbers are listed in Materials and methods.

Erythromycin mutants

EryR mutants of several reference Brucella strains having MIC values less than 2 μg/ml and the three marine Brucella were selected. Mutant strains were not recovered from B. ovis, B. abortus biovar 2, or B. suis biovar 5. Three ribosomal associated loci, 23S rrn, rplV, and rplD, were analyzed from eryR mutants of B. suis biovar 1, B. canis, B. neotomae, and the three marine Brucella (Table 4). The spontaneous eryR rate among the classical Brucella spp. varied by 100-fold. Rates of mutation to eryR and highest concentration of erythromycin allowing growth for each parental strains of the classical Brucella spp. were: B. suis 3.7 × 10-7 (5 μg/ml erythromycin); B. canis 1.5 × 10-8 (20 μg/ml erythromycin); and B. neotomae 6.6 × 10-8 (5 μg/ml erythromycin). All the marine eryR isolates were selected from plates containing 20 μg/ml erythromycin, and mutational rates were 1.9 × 10-6, 5.1 × 10-7, and 2.7 × 10-6 for porpoise, seal, and dolphin, respectively.
Table 4

Determination and characterization of erythromycin and clindamycin MICs and molecular characterization of Brucella eryR mutants.

Brucella ery R strains ERYERY + PAβNCLCL + PAβNLociMutation
B. suisWT1.50.7584NA
a661212-
b661212ND
c4688-
d661212ND
e6688ND

B. canisWT0.50.09480.5NA
a20.3281.0-
b20.0476<0.016-
c30.04780.38-
d30.04740.125-
e20.1983-

B. neotomaeWT0.750.04730.75NA
a40.12580.75-
b30.12562ND
c20.06461.5-
d60.2561.0L226 bp indel, β-loop
e20.3842-

PropoiseWT1.50.25163NA
a160.7543L4G209A; Gly70Asp
b>256>256>256>25623SA2058G (Ec)
c1921.543L4Δ18aa (54–71)
d480.3863L4G209A; Gly70Asp
e1281.543L4Δ30aa (54–81)

SealWT61.5>25648NA
a24129696-
b3224>256>256-
c>256>2561616L4C217A; Arg73Ser
d12816>256>256-
e12824>256>256ND

DolphinWT30.3820.75NA
a>2561281.01.5L4G209A; Gly70Asp
b>25661.51.0L4C217T; Arg73Cys
c>2561921.51.5L4G209A; Gly70Asp
d>25682.01.0L4C217T; Arg73Cys
e>25681.51.0ND

Mutants examined were isolates of B. suis biovar 1, B. canis, B. neotomae, and marine porpoise, seal and dolphin strains as per Table 1; WT, wild type; Ery, erythromycin; CL, clindamycin, PAβN, efflux inhibitor L-phenylalanine-L-arginine-β-naphthylamide; -, no mutation identified in any of three ribosomal loci examined; NA, not applicable; ND, sequence not determined.

Though MIC values of the eryR mutants of the classical strains B. suis, B. canis, and B. neotomae increased, they did not increase as much as those of the marine isolates (Table 4). While MIC values increased for the eryR mutants of the classical Brucella strains, the increases were only 2 to 6-fold compared to 15 to > 256-fold for the marine Brucella. Over half of the marine eryR mutants had erythromycin MIC values of 128 μg/ml or higher, and all the dolphin mutants had MIC values greater than 256 μg/ml. The clindamycin MIC values of the eryR mutants were similar to those of the parental strains except for porpoise b which had a mutation in 23S rrn and the seal isolates a and c. Mutations among the marine eryR mutants were found in two ribosomal associated loci, 23S rrn and rplD. Only a single mutation was identified in 23S rrn. Porpoise isolate b had a mutation within the peptidyl transferase center of 23S rrn, nt 2058 (Ec), but all three 23S rrn copies were not mutated, as the signal was mixed. This mutant was resistant to both erythromycin and clindamycin, MIC values >256 μg/ml. Most ribosomal associated mutations occurred in rplD (Table 4), and these were only found among the marine isolates. The mutations were not random. Several eryR isolates had mutations at nt 209 or nt 217. At nt 209, porpoise isolates a and d and dolphin isolates a and c had an A instead of a G, substituting an Asp for a Gly. Dolphin eryR mutants isolates b and d had a T instead of a C at nt 217 of rplD, resulting in the incorporation a Cys of rather than an Arg. Seal eryR isolate c had an A instead of a C at nt 217 which resulted in the incorporation of a Ser rather than an Arg. Two of the porpoise eryR isolates c and e had deletions in rplD, resulting in the loss of 18 or 30 codons. The deletion of 18 aa in L4 of porpoise c is consistent with recombination between two copies of 5'GGG-CCG-CGC-3' occurring between nt 153–161 and 207–215. Only one ribosomal associated loci mutation was identified among the B. suis, B. canis, and B. neotomae eryR mutants by analyzes of 23S rrn, rplD, and rplV. A duplication of a six-bp repeat in the β-hairpin loop of L22 of B. neotomae isolate d expanded the number of Gly-Arg aa repeats from three to four (Fig. 2, Table 4). This mutant had a slightly higher MIC value for erythromycin.

Efflux

Erythromycin and clindamycin MIC values of the reference strains and the eryR mutants were analyzed in the presence of the efflux inhibitor PAβN (Tables 4 and 5). Using Etest strips, a decrease in MIC values could only be detected if the MIC values >256 μg/ml fell to or below 256 μg/ml. MIC values of the reference strains decreased variably in the presence of the inhibitor (Table 5). Though PAβN affected the erythromycin MIC value for B. suis biovar 1, reducing it two-fold or by two dilutions as per the Etest, the MIC values for the B. suis biovar 1 eryR mutants were not affected. In the case of B. abortus biovar 5, even though its erythromycin MIC value was lowered in the presence of PAβN, the clindamycin MIC value was unaffected.
Table 5

Effect of efflux on MICs of Brucella reference strains for erythromycin and clindamycin.

Brucella MIC

EryEry + PAβNCLCL + PAβN
B. ab b1>25696>25696
B. ab b20.190.027530.25
B. ab b312864192128
B. ab b41286419264
B. ab b5>256192128128
B. ab b6>256256>25696
B. ab b9>256>256>256>256
B. mel b11642416
B. mel b2>256486412
B. mel b3256486432
B. suis b11.50.7584
B. suis b20.1250.03230.047
B. suis b31.51.02448
B. suis b421.52432
B. suis b50.0940.04762
B. canis0.500.09480.50
B. ovis0.064<0.0163<0.016
B. neo0.750.04730.75
Porpoise1.50.25163
Seal61.5>25648
Dolphin30.3820.75

Brucella strains are as listed in Table 1; MIC, minimum inhibitory concentration; Ery, erythromycin; CL, clindamycin; PAβN, efflux inhibitor L-phenylalanine-L-arginine β-naphthylamide; b, biovar; ab, abortus; mel, melitensis; neo, neotomae.

Efflux inhibition among the eryR mutants by PAβN (Table 4) was variable among the strains. The B. canis and B. neotomae eryR mutants had decreases in their erythromycin and clindamycin MIC values in the presence of PAβN. The seal eryR mutants had increased erythromycin MIC values that were variably reduced in the presence of PAβN. For example, isolate a had an erythromycin MIC value of 24 μg/ml which was reduced to 12 μg/ml by PAβN, but isolate d had a MIC value of 128 μg/ml which was reduced to 16 μg/ml. Only the seal eryR clindamycin MIC values were either identical to (>256 μg/ml) or lower than (96 and 16 μg/ml) that of the parental strain, and none were affected by PAβN. The dolphin eryR mutants differed from all the other eryR mutants in that they had uniform erythromycin MIC increases and the highest MIC increases of any of the other groups. Though all the dolphin eryR mutants' erythromycin MIC values increased from 3 μg/ml to >256 μg/ml, their erythromycin MIC values were differentially affected by PAβN. In the presence of PAβN, two dolphin eryR mutants had MIC values equal to or greater than 128 μg/ml while the rest had MIC values of 8 μg/ml or less. Like the porpoise isolates, except isolate b, all the dolphin isolates had lower clindamycin MIC values than the parental strain and the clindamycin MIC values were only slightly affected by PAβN.

Phylogenetic tree

A phylogenetic tree was constructed using concatenated 23S rrn, rplV, tuf-1, and tuf-2 (Fig. 4). Brucella formed a node with the closest clades being other α-Proteobacteria, Agrobacterium, Mesorhizobium, and Caulobacter followed by Leptospira and γ-Proteobacteria, Xylella, Acinetobacter, and the facultative intracellular animal pathogen Legionella. The cluster containing the Brucella species is robustly formed (high bootstrap values) into a distinct clade separate from the outgroups and forming four nodes subclustering: (1) B. abortus and B. ovis; (2) B. suis and B. canis;(3)B. melitensis, B. neotomae and the marine Brucella; and (4) B. suis biovar 5.
Figure 4

Phylogeny of . Shown is the single optimization alignment tree based on rplV, tuf-1, tuf-2, and 23S rrn sequences from 28 taxa consisting of the 21 Brucella strains (see Table 1), which included the 18 classical Brucella reference strains and three marine Brucella, and seven outgroups of known genomic sequences. Branch lengths (mean number of differences per residue along each branch) are given as well as bootstrap values (percentage of bootstrap support based on 100 replicates). Legionella pneumophila subspecies Pneumophila strain Philadelphia [GenBank:NC_002942] was used to root the tree. Other bacterial outgroups include: Acinetobacter species ADP1 [GenBank:NC_005966], Caulobacter crescentus CB15 [GenBank:NC_002696], Leptospira interrogans serovar Copenhagen strain Fiocruz L1-130 [GenBank:NC_005823], Mesorhizobium loti MAFF303099 [GenBank:BA000012], Agrobacterium tumefaciens C58 circular [GenBank:NC_003062] and linear chromosomes [GenBank:NC_003063], and Xylella fastidosa 9a5c [GenBank:NC_002488].

The tree constructed from a concatenated sequence, i.e. a supergene or supermatrix, was consistent with a concatenated tree calculated from individual loci (data not shown). Both trees supported classical classification, clustered the marine isolates with B. melitensis, and indicated intrinsic differences among marine Brucella. Bootstrap numbers (Fig. 4) were robust for all nodes (99 or 100) except B. ovis, which clustered with B. abortus; in the additive tree, B. ovis formed a unique branch. Though B. suis and B. canis composed a node, B. suis biovars 1 and 4 were on one branch and B. suis biovars 2 and 3 on another branch with B. canis. Shared 23S rrn polymorphisms divided the Brucella into three groups, placing B. melitensis between B. abortus and B. suis (Table 2). The tuf-1 and tuf-2 sequences (Table 3) separated B. abortus and B. suis and placed B. neotomae and the marine isolates intermediate between B. abortus and B. suis and B. melitensis. The rplV from B. abortus and B. melitensis were identical. Indels in rplV split B. suis biovars into two groups.

Discussion

The Etest was used to determine MIC values of the classical reference Brucella spp., their biovars, and three marine isolates to macrolides and a lincosamide. Our results differed somewhat from those reported by Meyer [17] using antibiotic discs containing low or high concentrations of erythromycin. Meyer found B. ovis and B. canis more resistant than B. suis to erythromycin, but Etest MIC values for B. ovis and B. canis were less than those of the reference strains of B. suis. The MIC values for the marine isolates were low and more similar to those of B. suis than to those of either B. melitensis or B. abortus. The patterns of relative sensitivity to macrolides of the reference Brucella were similar for erythromycin, clarithromycin, and azithromycin but differed from that for clindamycin. The susceptibility of B. suis to relatively low concentrations of the macrolide azithromycin suggests that this antibiotic may be a beneficial treatment for B. suis infections as it has a long in vivo half-life (50 hours), concentrates in macrophages, and lacks uptake saturation [35]. Ribosomal associated loci 23S rrn, rplD, rplV, tuf-1, and tuf-2 were analyzed for polymorphisms. Three monomorphisms were identified among rplD loci, but only one of them resulted in a difference among the putative L4 sequences. Although polymorphism was high among the tuf-1 and tuf-2 loci, all were silent. Sequences among 23S rrn and rplV loci were polymorphic. The three polymorphic sites identified among the Brucella 23S rrn loci separated them into three groups (Table 2). The only sequence difference among the 23S rrn peptidyl transferase centers of the reference Brucella strains was at nt 2610 (Ec), where there was either a T or a C. Many nucleotides in the peptidyl transferase center are conserved among bacteria and other organisms, but nt 2610 (Ec) is not. Either a T or C is common in bacteria. In any case, a T2610C (Ec) mutation in 23S rrn from S. pneumonia only slight affected its MIC values for macrolides and clindamycin [36]. Mutation of the peptidyl transferase center of 23S RNA (A2058G, Ec) of porpoise eryR mutant isolate b increased the erythromycin and clindamycin MIC values from 1.5 and 16 μg/ml, respectively, to >256 μg/ml. These MIC values were unaffected by the presence of efflux inhibitor PAβN. Concurrent appearance of resistance to erythromycin and clindamycin by mutation of nt 2058 (Ec) is observed in other bacteria [23]. Methylation of either nt 2059 or 2058 (Ec) of the peptidyl transferase center reduces the sensitivities of bacteria to macrolides and lincosamides [26]. We were unable to identify homologs of any 23S erm methylation genes by BLAST [37], but, then, methylation of ribosomal rRNA is much more widely described in Gram-positive clinical isolates [26]. The rplV sequences of the reference Brucella strains and marine Brucella were polymorphic, resulting in the differences among their putative L22 peptide sequences and lengths of the L22 β-hairpin loops. This was unexpected because L22 peptide sequence is conserved within a bacterial species [18,38] and the length of the L22 β-hairpin loop is highly conserved across biological kingdoms [38]. Differences in β-hairpin loop lengths among the Brucella L22 peptides were due to variable numbers of Gly-Arg repeats (Fig. 2). Though B. neotomae eryR isolate d had four Gly-Arg repeats, due to a six base insertion, the mutant's erythromycin and clindamycin MIC values were only slightly increased. The single amino acid difference found among the putative L4 sequences of the reference and marine strains could not be correlated with a difference in MIC values. Among the eryR mutants, all but two of the mutations were identified in rplD, and, interestingly, they only occurred among the marine eryR isolates. All erythromycin MIC values that increased among the eryR marine isolates were lowered by the efflux inhibitor PAβN. Nevertheless, some of the MIC values remained relatively high in the presence of PAβN. The L4 peptides of these mutants may work in conjunction with or be dependent on specific efflux RND pumps as shown for Haemophilus influenza HMC-C [32,33]. The tuf-1 and tuf-2 loci were the most polymorphic of the ribosomal associated loci examined, yet their putative peptide sequences were identical. Strain sequence differences between tuf-1 and tuf-2 were confined to the borders. This is consistent with gene conversion occurring more efficiently within conserved sequences rather than near the borders. Given that B. melitensis and B. abortus genomes have fewer single nucleotide polymorphisms (SNP) between them than either has with B. suis, tuf-1 and tuf-2 from B. abortus and B. melitensis were expected to be highly similar. This was not the case. Brucella abortus and B. suis tuf-1 and tuf-2 had few sequence differences (Table 3). The tuf-1 and tuf-2 sequences from the marine isolates were intermediate between B. abortus/B. suis and B. melitensis/B. neotomae. The tuf-1 and tuf-2 genes encode a core metabolic product and the apparent selective pressure on conserving EF-Tu sequences in the face of tuf-1 and tuf-2 polymorphism supports different evolutionary paths [39] for B. abortus and B. melitensis. MIC values and sequences of ribosomal related loci did not correlate with antibiotic susceptibility. To determine if efflux played a part in Brucella differential antibiotic resistance, we studied the effect of an RDF efflux inhibitor on MIC values. With the possible exception of B. abortus biovar 9, erythromycin MIC values of all the reference strains were reduced by the inhibitor PAβN though MIC values decreases were variable. Even low erythromycin MIC values decreased further in the presence of PAβN, demonstrating that efflux afforded the Brucella a low level of intrinsic antibiotic resistance similar to that reported for Campylobacter [40]. Many clinical isolates are resistant to antibiotics due to increased efflux as a result of mutations of efflux promoters and global and physically linked regulator genes or mobilization of insertion sequences (for a review see [28]). Most of the eryR strains had increased antibiotic efflux, though the marine eryR strains had larger increases in efflux than those of the classical reference strains of B. suis biovar 1, B. canis, and B. neotomae (Table 4). This suggests a fundamental biological difference between these groups. It is known that the marine Brucella have a high copy number [41] of the insertion sequence IS711 [42]. IS711 has been shown to mobilize in Brucella under stress or selective pressure [43,44] and could be a source of instability [42] in marine Brucella. Brucella phylogenetic trees and dendrograms have been constructed based on genomics maps [3,5,6], amplified fragment length polymorphisms (AFLP) [45], multilocus enzyme electrophoresis (MLEE) [6], and outer membrane proteins omp2a/omp2b [3]. Now, other universally conserved loci, especially 23S rrn, EF-Tu, rpoB, and gyrase, are increasingly being used to establish relationships among highly similar bacteria with important phenotypic differences to determine their relationships [16]. We constructed a phylogenetic tree based on concatenated sequences of ribosomal associated loci. Most phylogenetic trees and dendrograms, including ours, place B. abortus, B. suis/B. canis, and B. melitensis on separate branches, supporting alternative evolutionary paths. Recently, it was shown that Brucella isolates could be identified at the species level using 21 variable number tandem repeats (VNTR) [46]. The neighbor joining tree based on VNTR data produced major clusters that encompassed the classical Brucella spp. On this tree, the reference B. suis biovar 5 strain, which appears as a unique branch on our tree, was shown to be only distantly related to all other reference strains and isolates by VNTR analyses [46]. Though B. ovis formed a single cluster by VNTR analyses, it clustered, albeit with a low bootstrap value, with B. abortus on our tree. Significant sequence differences have been reported between B. ovis and other classical Brucella spp. reference strains [47,48]. Brucella neotomae grouped with B. melitensis here but was on a separate node. Based on VNTR data, B. neotomae occurs on a unique branch but groups with B. abortus on a AFLP generated dendrogram [45]. Marine isolates are not found on many Brucella phylogenetic trees. Ours grouped the marine Brucella and B. neotomae with B. melitensis but on separate branches. This is in agreement with the genetic diversity observed among the marine isolates and proposals that marine isolates may comprise more than one species [3,41].

Conclusion

Ribosomal associated polymorphisms among the reference Brucella spp. did not correlate with differential intrinsic antibiotic resistance to erythromycin or clindamycin. Efflux is an important mechanism of resistance to macrolides and the lincosamide clindamycin in Brucella and can be inhibited by the RND efflux inhibitor PAβN. A phylogenetic tree constructed based on concatenated ribosomal associated loci supports alternative evolutionary paths for B. melitensis, B. abortus, and B. suis, and clustered the marine Brucella with B. melitensis, and B. canis with B. suis. It also supports the doubtful close relationship of B. suis biovar 5 with B. suis.

Methods

Bacterial strains and growth conditions

Bacterial strains (Table 1) were obtained from our laboratory collection for this study. Bacteria were grown at 37°C on tryptose agar (DIFCO Laboratories, Detroit, MI) containing 5% bovine serum in the presence of 7.5% CO2. Cells were suspended in saline (1010 CFU/ml), mixed with two volumes of methanol, and stored at 4°C until needed.

Etest

In vitro activities of azithromycin, clarithromycin, erythromycin, and clindamycin were determined by the Etest (AB Biodisk, Piscataway, NJ). The highest MIC determination for these antibiotics using the Etest is 256 μg/ml. The preformed gradient of the Etest strips covers a continuous MIC range corresponding to 15 two-fold dilutions with a precision of 0.5 dilution. Bacterial inocula were prepared by adjusting the turbidity of a 48 h culture to a 0.5 McFarland standard (5 × 108 CFU/ml). The suspension was streaked onto Difco™ Mueller Hinton agar (Becton, Dickinson and Company, Sparks, MD) in the presence or absence of 25 μg/ml of efflux inhibitor PAβN [49] (Sigma Chemical Co., St. Louis, MO) using a cotton swab, and the Etest strips applied. Plates were incubated (37°C) in 7.5% CO2. Results were read after 48 h.

Selection of erythromycin mutants

Brucella strains having erythromycin MIC values <5 μg/ml were suspended in saline and plated (108 cfu) in triplicate onto Difco™ Mueller Hinton agar containing 5, 10, or 20 μg/ml of erythromycin (Sigma Chemical Co.) and incubated at 37°C in the presence of CO2. Five colonies were selected from plates with the highest concentration of erythromycin supporting growth, and subsequently streaked onto tryptose serum agar and Difco™ Mueller Hinton agar containing erythromycin.

PCR amplification

Master mixes for PCR reactions were prepared by use of the Fast Start Taq DNA polymerase kit (Roche Molecular Biochemicals, Indianapolis, IN) according to manufacturer's instructions. Methanol treated cells were diluted 1/10 in water and used immediately or stored at 4°C up to 2 months. One μL was added per 25 μL of reaction mixture. Reactions were 50 or 100 μL. Cells were disrupted and amplification initiated by heating the reactions to 95°C for 5 min. Melting, annealing, and elongation temperatures and times were 95°C for 15 sec, 60°C for 30 sec, and 72°C for 90 sec, respectively. After amplification for 35 or 40 cycles, elongation was extended by 4 min.

Primers

The primer sets for amplification and sequencing of 23S rrn genes annealed to rrnA from B. abortus 9–941 [GenBank:AE17223, BruAb1_rrna_0005]: nt 37–62 (CAT-GCA-CAG-GCG-ATG-AAG-GAC-GTG-AT) and nt 540–518 (GGA-TTT-CAC-GTG-TCC-CGC-CCT-ACT-CA) (note that this set amplified intervening sequence); nt 455–481 (AGT-TGG-AAA-ACT-CGA-CCG-AAG-TGG-GTG) and nt 1153-1127 (CCT-TAG-ATG-GTG-GTC-AGG-GTT-GTT-GCC); nt 1013–1039 (GAG-CAC-TGG-ATG-GGC-TAT-GGG-GAC-TCA) and nt 1732-1707 (GTG-CAT-TTT-GCC-GAG-TTC-CTT-CAA-CG); nt 1868–1894 (CCG-GTG-CTG-GAA-GGT-TAA-GAG-GAG-AGG) and nt 2605-2579 (CCC-AAC-TCA-CGT-ACC-GCT-TTA-AAT-GGC); and nt 2505–2529 (CGG-GGT-TGT-TTG-GCA-CCT-CGA-TAT-C) and nt 2850-2825 (CCC-GGC-CTA-TCA-ACG-TGG-TGG-TCT-TC). Primers used in PCR reactions to amplify the 3' end based on the genomic sequence of rrnC from B. suis [GenBank:NC_004311, Bs23SC] were forward (GGT-TTC-CCG-CTT-AGA-TGC-CTT-CAG-GA) and reverse 1 (CTT-CAG-AGA-TTA-TCC-CGT-CCG-TAT-ATA-TCT-ACC) and reverse 2 (ATA-GTG-ATC-CGG-TGG-TCC-CGC-GTG). Primers based on 23S B. suis rrnC unique sequences and B. suis sequences flanking rrnC, respectively, were: (GGG-TCC-AGG-ACC-GTG-TAT-GGT-GGG-TAG) and (CTT-CCA-TCC-ATG-AGC-GGC-AAA-GGA-AAT-G). Primers for amplification of L4, L22, EF-Tu1, and EF-Tu2 were: L4 forward 1, (ACG-ACC-ACG-ATC-TGC-CGA-AGA-AGG-TTC), and reverse, (GCC-ACG-TTG-AAG-ACG-ACC-TGG-TG); L4 forward 2, (GTG-TTC-AAG-GGC-AAG-AAG-ATG-GCT-GGT-C) and reverse 2, (GAT-CTC-CGC-ACC-GCC-GAT-AAG-AAG-TG); L22 forward, (GCG-GAT-CTT-GAC-ATC-TTC-ATG-CAG-CAG), and reverse, (TTG-TCG-GTC-TGA-CTT-TCG-GCG-TCT-ACA); EF-Tu1, forward, (TCA-AGG-CGA-ATG-CGG-ATG-TTT-TGA-CC) and reverse (GCG-GTC-GCA-CAG-GAA-ATC-CAG-AAG-AAG); and EF-Tu2 forward, (GCG-GGG-AAT-TAT-CTC-GGC-AGC-ACT), and reverse, (CGA-GCG-GTA-TGG-CGT-GTA-AGG-AAT-CAT). Primers internal to the PCR products were synthesized as necessary to obtain sequences of the products.

Sequence determination and comparisons

Amplified products were purified (QIAquick PCR Purification Kit, Qiagen, Valencia, CA) and sequenced at the Genomics Center at the National Animal Disease Center, Ames, IA (ABI Prism 3700 DNA Analyzer) using primers as listed above. For large products, internal primers were synthesized as needed to obtain coding sequences. Sequences were assembled and aligned, and polymorphisms were identified by use of Sequencer 3.1.2 (Genes Codes Corp., Ann Arbor, MI). In some cases, MacVector (ClustalW) was used for sequence comparisons.

Protein folding

The Swiss-Pdb viewer software version 3.7 [50,51] was used to predict folding of L22 based on the coordinates determined for L22 from Thermus thermophilus [52].

23S rrn base numbering

The numbering for Brucella 23S rrn is based on rrnA from B. abortus 9–941 [GenBank:NC_006932, Gene ID: 3339965]. When the nts refer to E. coli 23S rRNA rrnG [GenBank:U00096, GI:48994873], the nts are followed by (Ec).

Accession numbers

Genome and genomic sequences referred to in this study: B. suis 1330 [GenBank:AE014291 and AE014292], B. melitensis 16 M [GenBank:AE008917 and AE008918], B. abortus 9–941 [GenBank:AE017223 and AE017224], B. abortus 2308 [GenBank:AM040264], and B. abortus rrnA sequence [GenBank:NC_006932, Gene ID: 3339965]. Genomic sequences determined in this study: L4 (rplD) [GenBank:DQ289557 to DQ289577], L22 (rplV) [GenBank:DQ227901 to DQ227921], EF-Tu1 (tuf-1) [GenBank:DQ227922 to DQ227942], EF-Tu2 (tuf-2) [DQ227943 to DQ227963], 23S rrn region 1 (nt 69 to 1678) [GenBank:DQ287886–DQ287906], and 23S rrn region 2 (nt 1920–2807) [GenBank:DQ287865–DQ287885]. EryR mutant strain ribosomal associated sequences: B. neotomae (rplV) [GenBank:DQ659536], porpoise b (23S rrn) [GenBank:DQ659537], dolphin a-d (rplD) [GenBank:DQ660399–DQ660402], porpoise a, c-e (rplD) [GenBank:DQ6600403–DQ6600406], and seal c (rplD) [GenBank:DQ660407].

Dendrogram

Data sets consisted of concatenated genes (rplV, tuf-1, tuf-2) and sequences from 23S rrn from 28 taxa consisting of the 18 Brucella reference strains, three marine isolates, and seven outgroups of known genomic sequences (see Table 1 and Fig. 4). 23S rrn intervening sequences were eliminated from the comparison. Assembled sequences were aligned using ClustalW v1.83 [53]. Each nucleotide data set was then analyzed under the optimal criteria of maximum likelihood using MrBayes v3.1.2 Baysian analysis and Markov Chain Monte Carlo methods to search tree space and infer posterior distribution of topologies [54]. Settings for MrBayes were the general time reversible substitution model with sites drawn from a gamma distribution. The outgroup for MrBayes was Legionella pneumophila subspecies Pneumophila strain Philadelphia [GenBank:NC_002942]. The number of generations was set at 1,000,000, number of chains at 4, print frequencies at 10,000, and sample frequencies at 100. Branch lengths were saved and all other settings were default. The evolutionary tree was displayed using Tree Explorer [55] based on options used to compute or display the phylogeny.

Abbreviations

Standard three letter code was used for amino acids and standard one letter code for DNA bases.

Authors' contributions

SH identified the loci for study; designed primers, amplified loci, prepared templates for sequencing, analyzed sequence data and drafted the manuscript. AJ cultured the Brucella, determined MIC values, prepared L22 predicted structures, and edited the manuscript. SH and AJ prepared graphs, tables, dendograms, and analyzed data. Both authors have read the manuscript and approved the final version.
  49 in total

Review 1.  Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants.

Authors:  M C Roberts; J Sutcliffe; P Courvalin; L B Jensen; J Rood; H Seppala
Journal:  Antimicrob Agents Chemother       Date:  1999-12       Impact factor: 5.191

Review 2.  Macrolide resistance conferred by base substitutions in 23S rRNA.

Authors:  B Vester; S Douthwaite
Journal:  Antimicrob Agents Chemother       Date:  2001-01       Impact factor: 5.191

Review 3.  Multidrug resistance mechanisms: drug efflux across two membranes.

Authors:  H I Zgurskaya; H Nikaido
Journal:  Mol Microbiol       Date:  2000-07       Impact factor: 3.501

4.  The structural basis of ribosome activity in peptide bond synthesis.

Authors:  P Nissen; J Hansen; N Ban; P B Moore; T A Steitz
Journal:  Science       Date:  2000-08-11       Impact factor: 47.728

5.  Identification and characterization of variable-number tandem-repeat markers for typing of Brucella spp.

Authors:  Adrian M Whatmore; Stephen J Shankster; Lorraine L Perrett; Terry J Murphy; Simon D Brew; Rachel E Thirlwall; Sally J Cutler; Alastair P MacMillan
Journal:  J Clin Microbiol       Date:  2006-06       Impact factor: 5.948

6.  Limited genetic diversity of Brucella spp.

Authors:  B Gándara; A L Merino; M A Rogel; E Martínez-Romero
Journal:  J Clin Microbiol       Date:  2001-01       Impact factor: 5.948

7.  Characterization of the three ribosomal RNA operons rrnA, rrnB, and rrnC, from Brucella melitensis.

Authors:  B J Bricker
Journal:  Gene       Date:  2000-09-05       Impact factor: 3.688

8.  Identification and characterization of inhibitors of multidrug resistance efflux pumps in Pseudomonas aeruginosa: novel agents for combination therapy.

Authors:  O Lomovskaya; M S Warren; A Lee; J Galazzo; R Fronko; M Lee; J Blais; D Cho; S Chamberland; T Renau; R Leger; S Hecker; W Watkins; K Hoshino; H Ishida; V J Lee
Journal:  Antimicrob Agents Chemother       Date:  2001-01       Impact factor: 5.191

9.  Molecular markers for rapidly identifying candidate genes in Chlamydomonas reinhardtii. Ery1 and ery2 encode chloroplast ribosomal proteins.

Authors:  Amber K Bowers; Jennifer A Keller; Susan K Dutcher
Journal:  Genetics       Date:  2003-08       Impact factor: 4.562

Review 10.  Rationale for single and high dose treatment regimens with azithromycin.

Authors:  Emma M Gordon; Jeffrey L Blumer
Journal:  Pediatr Infect Dis J       Date:  2004-02       Impact factor: 2.129

View more
  4 in total

Review 1.  Efflux-mediated drug resistance in bacteria: an update.

Authors:  Xian-Zhi Li; Hiroshi Nikaido
Journal:  Drugs       Date:  2009-08-20       Impact factor: 9.546

Review 2.  The challenge of efflux-mediated antibiotic resistance in Gram-negative bacteria.

Authors:  Xian-Zhi Li; Patrick Plésiat; Hiroshi Nikaido
Journal:  Clin Microbiol Rev       Date:  2015-04       Impact factor: 26.132

3.  Peptide nucleic acids inhibit growth of Brucella suis in pure culture and in infected murine macrophages.

Authors:  Parthiban Rajasekaran; Jeffry C Alexander; Mohamed N Seleem; Neeta Jain; Nammalwar Sriranganathan; Alice R Wattam; João C Setubal; Stephen M Boyle
Journal:  Int J Antimicrob Agents       Date:  2013-01-08       Impact factor: 5.283

4.  Evidence of Horizontal Gene Transfer of 50S Ribosomal Genes rplB, rplD, and rplY in Neisseria gonorrhoeae.

Authors:  Sheeba Santhini Manoharan-Basil; Jolein Gyonne Elise Laumen; Christophe Van Dijck; Tessa De Block; Irith De Baetselier; Chris Kenyon
Journal:  Front Microbiol       Date:  2021-06-10       Impact factor: 5.640

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.