RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.