Literature DB >> 16928278

An expressed sequence tag (EST) library from developing fruits of an Hawaiian endemic mint (Stenogyne rugosa, Lamiaceae): characterization and microsatellite markers.

Charlotte Lindqvist1, Anne-Cathrine Scheen, Mi-Jeong Yoo, Paris Grey, David G Oppenheimer, James H Leebens-Mack, Douglas E Soltis, Pamela S Soltis, Victor A Albert.   

Abstract

BACKGROUND: The endemic Hawaiian mints represent a major island radiation that likely originated from hybridization between two North American polyploid lineages. In contrast with the extensive morphological and ecological diversity among taxa, ribosomal DNA sequence variation has been found to be remarkably low. In the past few years, expressed sequence tag (EST) projects on plant species have generated a vast amount of publicly available sequence data that can be mined for simple sequence repeats (SSRs). However, these EST projects have largely focused on crop or otherwise economically important plants, and so far only few studies have been published on the use of intragenic SSRs in natural plant populations. We constructed an EST library from developing fleshy nutlets of Stenogyne rugosa principally to identify genetic markers for the Hawaiian endemic mints.
RESULTS: The Stenogyne fruit EST library consisted of 628 unique transcripts derived from 942 high quality ESTs, with 68% of unigenes matching Arabidopsis genes. Relative frequencies of Gene Ontology functional categories were broadly representative of the Arabidopsis proteome. Many unigenes were identified as putative homologs of genes that are active during plant reproductive development. A comparison between unigenes from Stenogyne and tomato (both asterid angiosperms) revealed many homologs that may be relevant for fruit development. Among the 628 unigenes, a total of 44 potentially useful microsatellite loci were predicted. Several of these were successfully tested for cross-transferability to other Hawaiian mint species, and at least five of these demonstrated interesting patterns of polymorphism across a large sample of Hawaiian mints as well as close North American relatives in the genus Stachys.
CONCLUSION: Analysis of this relatively small EST library illustrated a broad GO functional representation. Many unigenes could be annotated to involvement in reproductive development. Furthermore, first tests of microsatellite primer pairs have proven promising for the use of Stenogyne rugosa EST SSRs for evolutionary and phylogeographic studies of the Hawaiian endemic mints and their close relatives. Given that allelic repeat length variation in developmental genes of other organisms has been linked with morphological evolution, these SSRs may also prove useful for analyses of phenotypic differences among Hawaiian mints.

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 16928278      PMCID: PMC1560379          DOI: 10.1186/1471-2229-6-16

Source DB:  PubMed          Journal:  BMC Plant Biol        ISSN: 1471-2229            Impact factor:   4.215


Background

It has frequently been noted that many island plant lineages show little genetic sequence divergence compared with their continental relatives [e.g., [1,2]]. This phenomenon can be associated with recent radiations and/or extensive gene flow, and in the case of young plant lineages, as in the Hawaiian Islands, it is often contrasted with considerable morphological and ecological diversity. An example is the native Hawaiian mints (Lamiaceae), which represent a major island radiation that likely originated from polyploid ancestors in North American Stachys (Fig. 1) [3]. Stachys is a large (ca. 300 species) and widespread genus belonging to the subfamily Lamioideae. Based on sequence variation in the rapidly-evolving nuclear ribosomal 5S non-transcribed spacer (5S-NTS), the Hawaiian mints are most closely related to temperate North American Stachys, whereas with chloroplast (cpDNA) sequence data, they group with a largely Mesoamerican Stachys lineage (see Fig. 1). This phylogenetic incongruence between nuclear and organellar DNA data probably indicates a reticulate ancestry for the Hawaiian mints. Their closest relatives appear to be bird-pollinated Stachys chamissonis and insect-pollinated S. quercetorum.
Figure 1

Simplified phylogenetic tree of the Hawaiian mint relationships. Phylogenetic analyses based on (a) 5S-NTS nuclear ribosomal DNA (nrDNA) and (b) chloroplast DNA (cpDNA) show the position of the endemic Hawaiian mints within the Stachys lineage [3]. The cross, likely indicative of an interlineage reticulation event [3], shows the different positions of Mesoamerican and temperate North American Stachys species with respect to one another and the Hawaiian mints. Taxa marked with an asterix (*) are those with fleshy nutlets (excluding the Hawaiian genus Haplostachys). These, including the monotypic genus Bostrychanthera, are the only taxa with fleshy fruits in the entire subfamily Lamioideae.

The Hawaiian mints comprise a total of 58 species in three genera. Dry-fruited Haplostachys and fleshy-fruited Phyllostegia and Stenogyne exhibit broad morphological and ecological variation. The sole extant member of Haplostachys (a genus of 5 species total), H. haplostachya, has fragrant white flowers typical of insect-pollination and is found in the xerophytic shrubland of Hawai'i. The flowers of Phyllostegia resemble those of Haplostachys. The 32 species of Hawaiian Phyllostegia are herbs, lianas or subshrubs and are mainly found in mesic to wet forest habitats. In Stenogyne the flowers are axillary and the tubular corollas, displaying a range of sizes and colors, usually have a reduced lower lip, suggestive of bird-pollination. The 21 species of Stenogyne are mainly perennial vines found in lower elevation, mesic-wet forests to higher elevation, subalpine woodland. In contrast to this extensive morphological and ecological diversity among the Hawaiian taxa, DNA sequence variation has been found to be remarkably low, resulting in a lack of phylogenetic resolution among accessions of Phyllostegia and Stenogyne [4]. It is apparent that faster evolving markers are necessary to study the presumed hybrid origin and adaptive evolutionary aspects, such as development of fleshy fruits, of the Hawaiian endemic mints. In the search for suitable molecular markers to elucidate recent radiations, non-coding regions of chloroplast and nuclear gene sequences and sometimes variation within DNA fragment data, e.g., from restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP), have been used in a diverse array of plants. Genomic microsatellites or simple sequence repeats (SSRs) have only had limited use for studies of natural plant populations, since they have to be developed each time in different plant species, which can be time consuming and expensive. However, among the advantages of microsatellite markers are their high reproducibility, multiallelic nature, codominant inheritance, relative abundance, that they usually have good genome coverage, and that only a small amount of DNA template is required [5]. In the past few years, expressed sequence tag (EST) projects have generated a vast amount of publicly available sequence data from plant species. These data are not only useful for gene discovery and comparative genomic investigation of transcriptomes and certain developmental processes, but they can also be mined for SSRs (typically referred to as EST or intragenic SSRs). These EST SSRs are useful as molecular markers in plant genetic and evolutionary studies because (i) they represent transcribed genes, (ii) a putative function can often be deduced by a homology search, and (iii) since they are derived from transcripts, they are useful for assaying functional diversity in natural populations [6]. Another important feature of EST-SSR markers is their expected higher levels of transferability to related species than genomic SSR markers. Several studies have now demonstrated not only high rates of infra-generic transferability but also transferability to other closely related genera [see [6]], which is also very promising for comparative mapping and genomic investigations of natural populations. However, EST projects have largely focused on crop or otherwise economically important plants, although EST data from other plants are emerging [7-9]. One example is the Floral Genome Project [10], which as part of a comparative genomic investigation of the floral transcriptome, has constructed a large set of ESTs from phylogenetically basal angiosperms specifically selected to bridge the evolutionary gaps between model plants [11]. We constructed an EST library from developing fleshy fruits (nutlets) of Stenogyne rugosa (Fig. 2). Fleshy fruits are rare in the mint family and are only found in few other genera within the entire subfamily Lamioideae (Fig. 1). However, studies of fruit pericarp structure have shown that the fleshy nutlets of the Hawaiian mints are not anatomically homologous to other fleshy-fruited genera in the subfamily [12]. It is possible that fixation of this novel feature after the colonization of the Hawaiian Islands along with sorting out of floral morphotypes ensuring greater pollinator specialization has had a major adaptive impact on the evolution of the Hawaiian mint lineage [4].
Figure 2

Flowers and fruits of Hawaiian mints. (a) Stenogyne rugosa flowers, and (b) fruits of Phyllostegia ambigua comprising four fleshy nutlets.

By constructing a Hawaiian mint fruit EST library we primarily wished to search for and develop genetic markers for our Hawaiian endemic mint research. Furthermore, we wished to enable comparative reproductive transcriptome studies, e.g., with unigene sets from the Floral Genome Project and tomato (also an asterid angiosperm) [13]. In this paper we describe the EST library and show how a relatively small fruit EST data set can cover a broad functional representation of the general angiosperm transcriptome. Furthermore, we discuss several potential uses of this database, in particular as related to our search for genetic markers.

Results

EST library characterization

Average insert size in our cDNA library was 1500 bp. Random 5' sequencing of cDNAs from developing fruits generated a total of 1273 ESTs, resulting in 942 sequences (74%) passing quality check (see Table 1). Assembling the EST sequences into contigs gave a total of 628 unique gene sequences (unigenes), consisting of 352 singletons (56%) and 276 assemblies, most of which (92%) contained two ESTs per contig. The unigenes had an average length of 480 base pairs. Each unigene was given a numeric identifier (260504-261131). The EST data is available through the Plant Genome Network (PGN) website [14] as well as GenBank.
Table 1

Stenogyne rugosa EST library and sequencing statistics.

Primary titre (pfu)1,5 × 106
Amplified titre (pfu/ml)2,4 × 106
Avg cDNA insert size1500 bp
Avg good sequence length494 bp
Total sequences1273
Sequences passed quality check942 (74%)
unique gene sequences (unigenes)628
Avg unigene length653 bp
Observed redundancya50%

aObserved redundancy: (EST# after quality check – Unigene #)/Unigene#.

Annotation and functional classification of unigenes

Using BLASTX to annotate the Stenogyne unigene sequences, 68% of unigenes matched Arabidopsis genes with an expectation value of 1e-10 or better. To get a better overview of the annotated unigenes, we used the Gene Ontology (GO) annotation [15] search on the TAIR website [16] to classify the unigenes into functional category. Relative frequencies of GO hits for Stenogyne rugosa unigenes assigned to the functional categories Biological Process, Molecular Function, and Cellular Component (as defined for the Arabidopsis proteome) are presented in Fig. 3. Comparison of frequencies with Arabidopsis (using whole Arabidopsis genome annotation on the TAIR website) within the Biological Processes and Molecular Function GO categories showed overall consistency in terms of representation within the functional classes (Fig. 4). Some of the unigenes could be identified as putative homologs of genes that are active during plant reproductive development (Table 2).
Figure 3

Gene Ontology (GO) classification of the . The relative frequencies of GO hits for Stenogyne rugosa unigenes assigned to the GO functional categories Biological Process, Molecular Function, and Cellular Component, as defined for the Arabidopsis proteome.

Figure 4

Comparison of GO classification frequences for . Relative frequences assigned to the GO categories Biological Processes and Molecular Function are shown.

Table 2

Stenogyne (Ste) unigenes and best BLAST hits to Arabidopsis (Ath) floral developmental and flowering time genes.

AnnotationGene IDSteAthb
AFO, ABNORMAL FLORAL ORGANS/YABBY1At2g4519015
ANL2, ANTHOCYANINLESS2 (Homeobox-leucine zipper)At4g00730117
ATCa, ARABIDOPSIS THALIANA CENTRORADIALISAt2g2755016
ARF4, AUXIN RESPONSE FACTOR 4At5g60450123
ATEXPA10, ARABIDOPSIS THALIANA EXPANSIN A10At1g26770130
DCL3, DICER-LIKE 3 (CAF-like DEAD Box)At3g4392016
FCAa, FCA-like RNA bindingAt2g4731013
GIa, GIGANTEAAt1g2277011
LDa, LUMINIDEPENDENS-like HomeodomainAt4g0256011
NAM, NO APICAL MERISTEM (similar to NAC2)At3g10500183
PAT1, PHYTOCHROME A SIGNAL TRANSDUCTION 1 (member of GRAS family)At5g48150127

a Flowering time genes.

b Gene family size is represented by the number of Arabidopsis (Ath) genes in each medium stringency tribe [see 11].

Comparison with a tomato unigene set

The Stenogyne fruit EST library was compared with tomato unigene sets to identify genes essential for development, fruit development in particular. First, Stenogyne and tomato unigenes (downloaded from the Solanaceae Genomics Network; [13,17]) were annotated by best-matched hits (BLASTX e-value < 1e-10) to the Arabidopsis genome giving a total of 3276 and 12648 hits, respectively. Among these, 1745 hits were shared between Stenogyne and tomato. Using the GO Slim functional classification scheme [15,18], 121 loci were identified within Developmental Processes. As a result, many genes shared between the Stenogyne and tomato unigene sets may be relevant for fruit/embryo/seed development.

Microsatellite discovery and preliminary results

A total of 42 unigenes (7%), comprising ca. 5% of the total EST sequences, contained 44 potentially useful microsatellite loci. Two of the unigenes contained two microsatellite loci each. Trinucleotide repeats were the most abundant (>50%) followed by tetra- (16%), penta- (16%), and dinucleotide (11%) repeats (see Table 3). Sequences for nine SSRs could be annotated to transcription factor or other nucleotide binding activity. Seven SSRs could be annotated to developmental processes (including the flowering time gene FCA).
Table 3

A list of 44 microsatellite markers identified in a total of 42 unigenes showing the motif of the repeat unit and the annotation of the unigenes as defined by best-matched Arabidopsis protein (BLASTX E-value < 1e-10).

Unigene IDRepeatArabidopsis proteome hit
260553GGCGGCGGCGGCGGAt3g19760.1 – eukaryotic translation initiation factor 4A/DEAD box RNA helicase, putative
260567ACAACACAACACAACACAAno hit
260570AGCAGCAGCAGCAGCAGCAGAt4g16280.1 – flowering time control protein/FCA gamma (FCA)
260579TGCTGCTGCTGCTAt2g41900.1 – zinc finger (CCCH-type) family protein
260619ATATATATATAAt3g48860.2 – expressed protein
260625GATGATGATGATGAt4g16630.1 – DEAD/DEAH box helicase, putative (RH28)
260641TCATCATCATCAno hit
260657CTGCTGCTGCTGCTGCTno hit
260658TCGTCGTCGTCGAt5g27540.1 – GTP-binding protein-related
260658GCCGCCGCCGCCGAt5g27540.1 – GTP-binding protein-related
260664TTATTATTATTATAt3g04770.1 – 40S ribosomal protein SA (RPSaB)
260670ACCACCACCACCAt2g26510.1 – xanthine/uracil permease family protein
260691TATATATATATATno hit
260708AGAAGAAGAAGAAGAAGAAno hit
260711TTCTTCTTCTTCTTCAt2g38410.1 – VHS domain-containing protein/GAT domain-containing protein
260714AAATAAATAAATAAAno hit
260715TGCTTGCTTGCTTAt1g73660.1 – protein kinase family protein
260720ATACATACATACAAt5g49720.1 – endo-1,4-beta-glucanase KORRIGAN (KOR)/cellulase (OR16pep)
260754ATTATTATTATTAt1g48600.1 – phosphoethanolamine N-methyltransferase 2, putative (NMT2)
260776ATATATATATATATATATATATATATATATATATATAt5g08380.1 – alpha-galactosidase, putative
260779CGACCCGACCCGACno hit
260781TTATTATTATTAno hit
260802ACAACACAACACAACACAACACAACACAAno hit
260810ATCATCATCATCAAt5g56350.1 – pyruvate kinase, putative
260811CTCTCTCTCTCAt5g48150.2 – phytochrome A signal transduction 1 (PAT1)
260853CCGCCGCCGCCGAt5g13440.1 – ubiquinol-cytochrome C reductase iron-sulfur subunit
260883CCTCCCCTCCCCTCAt5g46250.1 – RNA recognition motif (RRM)-containing protein
260903CACCACCACCACAt3g11400.1 – eukaryotic translation initiation factor 3G/eIF3g
260907GCTGCTGCTGCTAt5g17920.1 – 5-methyltetrahydropteroyltriglutamate – homocysteine methyltransferase
260915CCAAACCAAACCAAACCAAACCAAAAt3g12020.1 – kinesin motor protein-related
260925GCAGCAGCAGCAAt1g03880.1 – 12S seed storage protein (CRB)
260939GCTGCTGCTGCTGCAt1g80490.2 – WD-40 repeat family protein
260940ACGAACGAACGAAno hit
260971GGCGGCGGCGGCno hit
260986AGAAGAAGAAGAAGAAAt1g10040.1 – expressed protein
260996GCTGCTGCTGCTAt5g17920.1 – 5-ethyltetrahydropteroyltriglutamate – homocysteine methyltransferase
261018ATTTTATTTTATTTTAt3g29160.3 – Snf1-related protein kinase (KIN11)
261039TTAATTAATTAATTAt2g45190.1 – axial regulator YABBY1/AFO
261062GCTGCTGCTGCTGCTGCTGAt2g28000.1 – RuBisCO subunit binding-protein alpha subunit/CHAPERONIN-60ALPHA
261064ATACATACATACAAt4g23400.1 – major intrinsic family protein/MIP family protein
261094GAGAGAGAGAGAt1g48410.2 – argonaute protein (AGO1)
261109ATTCATTCATTCATAt3g15880.1 – WD-40 repeat family protein
261109ACCACCACCACCAt3g15880.1 – WD-40 repeat family protein
261131TAATATAATATAATAno hit
Of the 35 SSR primer sets initially evaluated with homologous genomic DNA from Stenogyne rugosa, 30 primers gave clear PCR bands within the approximate range of expected product size. These were further tested for cross-transferability to other Hawaiian mints using the species Stenogyne calaminthoides, Phyllostegia warshaueri, and Haplostachys haplostachya. Amplification gave positive results for 24 primer pairs in all four taxa (see Table 4), and five primer pairs were further tested for variation among a total of 88 individual accessions, including 84 Hawaiian mint accessions and four North American relatives in the genus Stachys. Results from these five SSR loci are presented in Table 5 and Fig. 5. Two of the five loci proved to be highly variable, with a total number of alleles of 12 and 25, respectively, whereas the three remaining loci showed relative homogeneity among 1, 2 or 3 alleles, with some rare alleles also present (Fig. 5).
Table 4

A list of primer sets for 44 EST microsatellite markers in the Stenogyne EST library. 35 primer sets were tested initially with Stenogyne rugosa (unigene IDs with bold text), 30 of which gave clear PCR products. Of these 30 primer pairs, 24 (marked with an asterix) gave positive amplification for four Hawaiian mint accessions.

Unigene IDForward primer sequence (5'-3')Reverse primer sequence (5'-3')Expd. product size (bp)
260553*CCCTCCGACGACACTAAACGACAATCTGGCAAACAG322
260567*GAAAGTGAAAGCAGCAGATACATGTGGAGGAATGATGACAC275
260570*GTGGGAGAAACCTGAAGAGTGTATTGACTGCCCTGATG109
260579TTTCTCTTCTCTCACTCACTTTCTGATTACACCACTTCTATTGTT226
260619*ATCTTCCCTTCCTCAAATCTCATCATCGTCGTCTTCTTC325
260625GGAAGTAGAAGCAGAAGAAGGGAGTTAGCATTGAAGGAAACA345
260641*CAAGAATCAAACAGACCAGACCAGGGAAGGTAAAGCAATC375
260657*TAAGTCTCATAGCAAGCGAACTATTCTACATCCCTCACACCC128
260658CACACCAAATCGTCAAATCCTTCCCTCTATTCTCCAAACT239
260658CACACCAAATCGTCAAATCCTTCCCTCTATTCTCCAAACT239
260664*AACATTCACCAACCACCTTGTCCCAGAGCACCTTCTT186
260670*AAGAAAGAGAAGAAGGATGGTAGAAGGGTTTGAGTGGATG169
260691*TCCGAAATCATACTCATAAAGGGCGATGTGCTTAGTTC258
260708*ACCAGGAGGAAGATTGGATATGATTGGAGAGGTGAGATG217
260711GCACGAGGCAGTAATCTTTGCAAATAATCACCACAGTTCTT395
260714*AATAGAGATTGGAGAGAAGCACGACACAAACGAAACATC321
260715*AAATCTGGGCTACTCAAACAGGTCAGTCTTCTGTGAACCA190
260720*ACGAGGTTTAGAAGCAAAGTGTTGGAGTATCTGGGAAGAAG159
260754*CACGAGGATTTACTGCTTCAACAAGGACATAGTTGGAGGTT314
260776*ACTGTTGTTGATGTTCCCTCATTCTTCCACCATTTGA257
260779CCTTCACCTGCTCTTCATACTCTTTACTCTTCTCTTTCTGACC219
260781GCACGAGGACAAGAAATAGACGCTGCCTGAAGATGAGA226
260802*GAAAGTGAAAGCAGCAGATACGATGTGGAGGATGATGACAC270
260810*GCTTCCTTCTCTTCCCAAACTGGTTCCGATTCTGTATG220
260811*CAGTTGGGAAAGATAAACAGAGGAACACAAGGAGAGGATAAA380
260853CGGATTGCTGATTTACTGAGAGATTCAAACGAACACGA174
260883*AGAAGGAGCGGGAGGTTTTAATAATCTTGCGTCGGAG278
260903ACGAGAATGGGATAAAGAAACATCGGTCGGTTGAGTAAGA362
260907CATTGGCTGGTCATAAGGTAGTAGTGTTTGGGAGGATTG210
260915*CATCGGTTAGAAACACAAGAACAAACAAAGAGAAGCCTACC305
260925ATAAATCTCTCCCTCCTCTCCTTCTTCGTCGTTCCTCCT400
260939*CGAATGTAGAAAGATAAAGGAGCTGGACAAGTAAACGGTAGG221
260940*GTTACATACCGTTCCCACCTACCCTCTCTCATCCTCAAC394
260971TGTTGGAGTGTAAAGTTGGTTGAGTTGTTGTTGCTGACGA380
260986AGAGACTGTGAGTGAGCAGGCCATAACATCAATACCATCCA374
260996CCAGGGTGAACAATGAAGTTCTACGGTTTGAGGGAAG165
261018ACTGGAGGAAGAAAGCAATACTTTACCAAATGAACCAATCC236
261039*CATAGTAACAGATGAACCCTAAATCAACCCGTGAAGAAACC220
261062TTCTCTCACTCAATCCTGAAATACAACGCAATGACCGATAC299
261064*CAACGCACACACTATGCTTCTATTCTGGGTAGGACCATTC228
261094GCAGTGATGGCACAGTTAGCGAGAAGTCGGCAGTTCA317
261109ATTCATTCATTCCGCTACACCAGAGGGCTGCTAAGATG157
261109ATTCATTCCGCTACACAAAGGTTTATCCGCTGGTGGT366
261131ACGGATGGACTTAGGACTTTTTTGAGATTTGAGTAGTTTGAGA241
Table 5

Results from five EST SSR loci tested for variation among a total of 88 individual accessions, including 84 Hawaiian mint accessions and four North American relatives in the genus Stachys.

Unigene IDGenomic location of SSRAllele size rangeTotal no. of allelesAlleles per individualAvg. no. of alleles per individualPIC
260553coding region (5' of gene)315–33161–31.30.334
260708no hit173–259251–82.50.844
2607153'-UTR176–18841–42.00.458
2610393'-UTR312–33151–42.90.773
2610643'-UTR221–263121–62.90.872
Figure 5

Allele frequency distributions of five EST SSR markers. SSR markers (a) 260708, (b) 261064, (c) 261039, (d) 260715, and (e) 260553. See also Tables 3–5 for more information on these loci.

Discussion

The Hawaiian endemic mints represent one of the largest plant lineages in the archipelago, exhibiting extensive vegetative, habit and reproductive diversity. Targeting single genes and comparing DNA sequences of already developed phylogenetic markers have proven very limited for understanding the molecular basis for this fascinating morphological radiation. Recent efforts have demonstrated that expressed sequence tag (EST) sequencing can be used as an efficient and relatively economical approach for large-scale gene discovery and comparative genomics research. Great potential for addressing many questions in evolutionary biology will be afforded as more data from non-model organisms emerge and are mined for functional information. We constructed a fruit EST library from an Hawaiian endemic mint as a further step toward understanding the molecular basis for the radiative evolution of the Hawaiian mint lineage and to provide resources for comparative genomics investigations of plant reproductive development.

EST library annotation

A relatively high frequency (68%) of Arabidopsis genes were identified with our small fruit EST library. Also, analysis of GO annotations for the Stenogyne unigenes showed a fairly consistent sampling of functional classes as defined for the Arabidopsis proteome (Fig. 3). As similarly discovered by the Floral Genome Project [11], this suggests that a limited EST data set can provide a broad functional representation relative to the entire Arabidopsis transcriptome. For example, within the GO categories Biological Processes and Molecular Function, relatively even representation of the different functional classes is evident between the Stenogyne unigene set and the inferred Arabidopsis proteome (Fig. 4). In Biological Processes, the three most represented functional classes for the two transcriptomes are 'other physiological processes', 'other metabolic processes', and 'other cellular processes'. In the case of Molecular Function, the predominant functional classes belong to enzyme activity. The class 'nucleotide binding' is particularly well represented in the Stenogyne EST set. Unknown processes or functions are underrepresented in our EST data set relative to Arabidopsis. This was also seen with the comparison of the Floral Genome Project EST sets to the Arabidopsis proteome [see Fig. 2 in [11]]. One possible reason for this result is that many, perhaps rare, unidentified transcripts from the entire Arabidopsis proteome are not discovered using an EST library approach. Concerning our 'positive' unigene identifications, it should be borne in mind that BLAST-based annotation of short EST unigenes can be misleading if best BLAST hits are more representative of domain homologies rather than homology to particular orthologs. However, at least among the five loci for which we analyzed microsatellite variation in depth, the four with putative counterparts in Arabidopsis could be annotated to specific orthologs in the Arabidopsis genome (see below).

Reproductive developmental genes

Some of the unigenes from our EST library could be identified as putative homologs of Arabidopsis genes that are active during plant reproductive development (Table 2). Among these are ABNORMAL FLORAL ORGANS (AFO), ARABIDOPSIS THALIANA CENTRORADIALIS (ATC), FCA, GIGANTEA (GI), and LUMINIDEPENDENS (LD). AFO, which has also been named FILAMENTOUS FLOWER (FIL) or YABBY1, belongs to a small family of genes encoding transcription factors. The primary function of the YABBY gene family members is to specify abaxial cell fates in lateral organs produced by apical and flower meristems [19]. Homologs of YABBY gene family members have also been found in many other EST library sets, e.g., in developing tomato fruits [20], developing reproductive tissues of a variety of basal angiosperms [11], and in young cycad leaves [7]. A microsatellite repeat found within our AFO homolog was analyzed for variation among a large number of individual accessions (see below). FCA, GI, and LD are flowering time genes. Flowering time control is a complex process and molecular genetic analyses in Arabidopsis have identified many genes, as well as a variety of environmental factors, that regulate the transition to flowering [e.g., [21]]. Interestingly, although FCA, GI, and LD are genes that promote flowering, EST homologs are found expressed in developing tomato fruits [20]. ATC belongs to a small gene family that also includes TERMINAL FLOWER1 (TFL1), a key gene in regulating flowering time and maintaining the inflorescence meristem [e.g., [22-24]]. If ATC acts similarly to TFL1 it would be a flowering inhibitor. Whereas TFL1 is expressed in both the inflorescence meristem and during the vegetative phase, ATC was found to be expressed in the hypocotyl of young Arabidopsis plants [25]. Although overexpression experiments with ATC showed a phenotype similarly to constitutively expressed TFL1, it was suggested that ATC and TFL1 may have different roles in endogenous development. The Antirrhinum homolog CENTRORADIALIS (CEN), which is the closest BLASTP hit to our Stenogyne uniprotein in the GenBank non-redundant database, is only involved in inflorescence meristem maintenance [26], while the SELF-PRUNING (SP) homolog of tomato has no effect on the architecture or timing of the inflorescence. Instead, overexpression of SP results in an extended vegetative phase of sympodial shoots and in the replacement of flowers by leaves in the inflorescence [27]. If our Stenogyne ATC/TFL1 homolog is a flowering time repressor, it is surprising to find it expressed in developing fruit tissue. Indeed, no homolog of this gene family has been found in any tomato EST library [28]. Generally, flowering repressor genes are expected to be expressed during the vegetative phase of the plant. However, analyses of expression profiles of transcription factor genes during silique development in Arabidopsis revealed substantial expression of two flowering supressor genes, MADS AFFECTING FLOWERING 1 & 2 (MAF1 and MAF2) [29]. It is not known what function flowering supressor genes have during silique development, but it was suggested that they may be required to prevent precocious flowering at the embryo stage. Full length sequencing and in situ hybridization analysis of Stenogyne ATC homolog transcripts, as well as overexpression of the gene in Arabidopsis, would be helpful for establishing whether or not it has a flowering time function. Another potential use for our EST resources is for further research on single or low-copy genes. Perhaps these genes could serve as markers for phylogenetic studies. AFO, FCA, and ATC/TFL1 each belong to small gene families, whereas GI and LD are single-copy genes. For example, the GI homolog in our EST library contains three introns, and preliminary studies with GI intron sequence variation have shown promising nucleotide and indel (insertion/deletion) variation among a small number of Stenogyne and Phyllostegia species (unpublished data). Further studies of GI intron sequence variation not only among Hawaiian mints but also among other lamioid mint genera may demonstrate utility of the locus for phylogeny reconstruction.

Comparative fruit development studies

A comparison between Stenogyne and tomato unigenes revealed many homologs that may be relevant for fruit development. When annotating loci identified within Developmental Processes using the GO functional classification scheme [15], several finer-scale GO terms were identified that are important in fruit development as well as reproductive development in general. Among the homologs shared by Stenogyne and tomato that may be particularly relevant for fruit development (annotated below by Arabidopsis homolog) are ARABIDOPSIS DYNAMIN-LIKE PROTEIN (ADL1; AT5G42080), CBL-INTERACTING PROTEIN KINASE 3 (CIPK3; AT2G26980), CHAPERONIN-60ALPHA (CPN60A; AT2G28000), CRUCIFERIN 3 (CRU3, a 12S seed storage protein; AT4G28520), CYTOCHROME P450 78A9 (CYP78A9; AT3G61880), and DEFECTIVE KERNEL 1 (DEK1; AT1G55350). Further analysis and comparative mapping of these and other important genes could aid in future fruit development studies. Particularly interesting in the case of the Hawaiian mints would be to compare the fruit transcriptomes of fleshy-fruited Stenogyne and dry-fruited Haplostachys.

EST microsatellite markers

The overall frequencies of SSRs in expressed regions vary significantly in different studies depending on the minimum length of the repeat motif and the criteria used to identify the SSRs [6]. In a number of plant EST data sets, SSRs greater than 18 bp are present in ca. 2–7% of EST sequences [30]. In our data set repeats greater than 18 bp were present in 1% of the ESTs. When all of our SSRs are considered, they represented ca. 5% of ESTs, or 7% of the unigenes. The bias toward discovery of triplet SSRs in our EST set concurs with many previous studies [31,32] in matching the expectation of non-interruption of reading frames. Hexanucleotide repeats also preserve reading frames, but we did not discover any of these among our Stenogyne ESTs. Dinucleotide repeats are more common than tetra- or pentanucleotides in Arabidopsis, accounting for 28%, 14%, and 3% of total repeats, respectively [32]. In comparison, Stenogyne di- and pentanucleotides are under- and overrepresented, respectively, but this could be attributed to our small EST sample size. Our first preliminary tests of microsatellite primer pairs have proven promising for the use of Stenogyne rugosa EST SSRs among the Hawaiian endemic mints and their close relatives. At least 24 primer pairs gave positive amplification among four Hawaiian mint taxa, Stenogyne rugosa, S. calaminthoides, Phyllostegia warshaueri and Haplostachys haplostachya, and at least five of these also worked for close relatives in the genus Stachys. These findings corroborate other studies that suggest EST SSR markers have great potential for genetic mapping and evolutionary research among closely related taxa, and also that they can be cross-transferable between genera. With regard to the latter point, it should be noted that previous studies based on ribosomal DNA sequence data demonstrated very little variation among the Hawaiian mints, and a close relationship to taxa in the genus Stachys [3,4]. Therefore, it was expected that primers developed from Stenogyne rugosa EST sequences would be transferable to these close relatives and that amplicons would likely represent orthologous genes (also see below). The five SSR markers we tested for variation among a large sample of Hawaiian mints and a small number of Stachys accessions showed different patterns of allelic polymorphism (Fig. 5). To illustrate both potential and challenges with our EST SSRs, we discuss these repeat patterns and provide preliminary interpretations in detail below. One of the five unigenes containing SSRs (260708) received no significant match from BLAST searches. Consequently, we cannot exclude the possibility that the entire sequence is UTR, or even intron or other non-coding DNA. However, this SSR marker showed the largest number of alleles and variation among individuals for the five loci examined, as well as a high PIC score (Table 5). The broad distribution of allelic lengths suggests that this locus is not under particularly strong selection pressure for an optimal length. The repeat is a triplet motif, and if it occurs within a protein-coding sequence, it would stand for either arginine (Arg), lysine (Lys) or glutamine (Glu). Among plants studied in detail, the most common codon repeats are those for Lys in Arabidopsis or Arg in sugarcane [31], both of which are hydrophilic and positively charged amino acids. The allele frequencies at this locus show an interesting pattern (Fig. 5a) resembling a normal distribution around an optimum at ca. 212 bp, with five alleles (of 25 total) together receiving a frequency of ca. 70%. The two tails of the frequency distribution (i.e., alleles of <209 bp and >246 bp, respectively) represent Hawaiian mint accessions occurring only on the island of Hawai'i, the geologically youngest island of the Hawaiian island chain. If representing a functional locus, it is possible that these low-frequency alleles are slightly deleterious alleles fixed because of founder effect and drift in the ecologically open environments of the volcanically active youngest island. Since we have no information on the genomic location of the repeat, nor of its annotation, we cannot exclude either that the polymorphic pattern represents amplification of paralogous loci in these polyploid (likely octoploid) organisms. However, the singly-modal allele distribution does follow an almost perfect trinucleotide repeat pattern, which suggests that this variation probably occurs among homeologous loci. For the four remaining markers it was possible to annotate the unigenes and locate the corresponding SSR sequences in the Arabidopsis genome. Best hits from BLAST searches of the 261064 unigene identified it as a major intrinsic family protein (an aquaporin, Table 3) and comparisons with the Arabidopsis best hit located the tetranucleotide repeat to the 3'-UTR. Investigation of other proteins with high BLAST scores gave very poor alignment of the primers and no fragments of similar lengths to the observed SSR fragment patterns. Although this does not exclude the possibility of primers annealing to potential gene duplicates in the studied plants' genomes, our results are consistent with the alleles representing only one gene in Arabidopsis, not having derived from paralogous loci. Similarly to the previous SSR marker, 260708, the allele frequency distribution suggests relatively moderate selection around an optimum, although with only one tail representing repeat expansions (Fig. 5b). The last four alleles (from 251 bp and up) occur in accessions of one species (Stenogyne bifida) found only on the islands of the Maui Nui complex. It has been observed in several systems that SSRs in 3'-UTRs can lead to transcription slippage and therefore SSR expansions [see [31]], and it is possible that this mechanism could explain the pattern seen here. The tetranucleotide repeats in markers 261039 and 260715 were found in the 3'-UTRs of single Arabidopsis genes. The fact that three of the five repeat loci examined here were found in 3'-UTRs follows the general observation that UTRs harbor more SSRs than protein coding regions [32]. Unigene 261039 was annotated as a putative homolog of the axial regulator AFO (see above). One of our SSR primers was in the next-to-last exon, i.e., the primers span an intron, which explains the difference in the expected and the observed fragment lengths (see Table 4 and 5). Since AFO is a member of a small gene family, other closely related proteins were found with BLAST searches. However, these gave only very poor matches to our SSR primers, and no potential fragments of similar lengths to the observed SSR fragment pattern. Therefore, again we propose that the alleles represent variation among homeologs. The average number of alleles per individual was 2.9 with 93% of individuals sharing all three alleles, suggesting the action of strong purifying selection on each. This pattern suggests that the three peaks (Fig. 5c) could have been derived from two different ancestral polyploid genomes, one with two copies, the other with a single one. As in the three cases above, no primer match could be found for other proteins closely related to SSR marker 260715, which was annotated as a protein kinase family protein. Like marker 261039, there is evidence for strong purifying selection, with two major alleles following a tetranucleotide pattern (Fig. 5d). Likely explanations are that the two alleles derived from ancestral homologs or perhaps represent fixed heterozygosity, assuming they do not derive from gene duplication. In the fifth marker we examined in detail, 260553, the repeat was found in the 5' end of gene, i.e., directly at the translation start site (i.e., in the N-terminus of protein). As in the above cases, no primer match was found to other proteins closely related to this putative eukaryotic translation initiation factor 4A homolog. As expected, the observed allele frequency pattern suggests strong purifying selection, with over 80% of accessions harboring only one allele (Fig. 5e). Consequently, on average we find a lower number of alleles per individual in this locus than in the above examples. However, an interesting finding is that there are more and longer alleles per individual on Kaua'i, the oldest island in the Hawaiian chain (results not shown), which suggests that repeat expansion has been more tolerated than contraction over time. This triplet repeat encodes a glycine, a small, aliphatic residue that may be able to fit more easily into an N-terminal protein structure. Interestingly, the last three loci discussed (261039, 260715, and 260553) show the presence of rare alleles that have presumably 'escaped' from strong purifying selection. It is possible that these presumably deleterious alleles have been fixed by chance in colonizing polyploids. It is clear from the limited examples presented here that although SSR markers in transcribed regions may exhibit useful variability, their different evolutionary histories (selection pressures, genic locations, etc.) can lead to markedly different patterns of polymorphism. As a consequence, when all five loci combined are analyzed hierarchically with parsimony or non-hierarchically as with PCA analyses, only little or no significant structure is found (results not shown). These results corroborate previous evidence for poor phylogenetic hierarchy in this island radiation [4], further suggesting that the Hawaiian mints could perhaps be best considered a metapopulation with only little (emerging) phylogenetic structure among taxa. Conceivably, genomic-derived SSRs representing a higher proportion of non-transcribed and presumably neutral regions might show more variable and more easily interpretable data. However, the advantage of high cross-transferability with EST derived SSRs, and in many cases the greater stability of scoring [33], makes these markers highly suitable for our Hawaiian mint research. It is possible that a larger number of EST SSR markers would outperform the disadvantages of different gene histories, but this may require deeper EST sampling to discover more SSR loci. Finally, it is well known that tandem repeats are associated with a number of diseases and phenotypic conditions, and that allelic repeat length variation in protein-coding sequences has been linked with morphological evolution [e.g., [31,34]]. For example, considerable variation in tandem repeats within developmental regulatory genes among different breeds of dog was associated with significant differences in limb and skull morphology [35]. Some of our SSRs, not discussed here, are found in unigenes identified as putative homologs of genes that are active during plant reproductive development, e.g., FCA, ARGONAUTE, CRU3, and CHAPERONIN-60ALPHA (see Table 3). Further studies of these microsatellites and others annotated to transcription factor or other developmental processes may prove useful for analyses of phenotypic and ecological differences among the Hawaiian mints.

Conclusion

The Hawaiian endemic mints are a conspicuous example of an island radiation within which morphological and ecological diversity outweighs known genetic diversity. The Arabidopsis-annotated unigenes assembled from our Hawaiian mint EST library were broadly distributed in terms of GO Biological Processes and Molecular Function categories when compared with the Arabidopsis transcriptome. Many genes were annotated to reproductive development, and several to flowering time function. A comparison of Hawaiian mint and tomato ESTs suggests that the new library may be useful for comparative fruit developmental research. Particularly, further studies of the SSR resources described here will permit more detailed genetic research on the Hawaiian mints, and possibly, the role that particular repeat sequences may play in their morphological or ecological evolution.

Methods

Tissue collection and library construction

Developing fruits from Stenogyne rugosa were collected in the field and stored by instant freezing in liquid nitrogen for later RNA extraction and EST library construction. Total RNA was extracted using a phenolchloroform protocol: two grams of frozen material were ground to a fine powder in liquid nitrogen before 5 mL of RNA extraction buffer (100 mM TrisHCl, pH 8.8, 10 mM EDTA, 2 % SDS) and 5 mL phenol were added. The thawed mixture was transferred to a polypropylene Oakridge tube and centrifuged at 7000 rpm and 4°C for 15 min. The upper phase was extracted twice, once using an equal volume of phenol and a second time using an equal volume of chloroform, both times centrifuging at 7000 rpm and 4°C for 15 min. The upper phase was transferred to a new tube and 1/10 volume of 3 M NaOAc (pH 6–7) and three volumes of 100% EtOH were added, mixed, and stored at -20°C over night to allow nucleic acids to precipitate. Nucleic acids were pelleted by centrifugation at 7000 rpm and 4°C for 10 min. The pellet was dissolved in 2 mL of DEPC-treated ddH2O. To precipitate total RNA, 0.7 mL of 8 M LiCl was added and the mixture was stored at 4°C for 4 hrs. The mixture was then centrifuged at 7000 rpm and 4°C for 30 min. The pellet was dissolved in 300 μL of DEPC-treated ddH2O. For final precipitation of RNA, 30 μL 3 M NaOAc (pH 6–7) and 900 μL 100% EtOH was added and the mixture stored at 4°C for one hour before centrifugation at 10000 rpm and 4°C for 10 min. The pellet was then dissolved in ddH2O. The concentration of total RNA was measured using a Bio-Rad Fluorometer (Bio-Rad, Hercules, California, USA) and RiboGreen Dye (Invitrogen Corp., Carlsbad, California, USA), and mRNA was extracted from 0.4 mg of total RNA using the Poly (A) Purist mRNA purification Kit (Ambion Inc., Austin, Texas, USA) following the manufacturer's instructions. The concentration of mRNA was measured as above. cDNA was synthesized from 5 μg of mRNA and a cDNA library generated using the ZAP-cDNA Gigapack III Gold Cloning Kit (Stratagene Inc, La Jolla, CA, USA) following the manufacturer's instructions. The cDNA library was constructed using SOLR as host, with pBluescript as vector and cloning sites EcoRI/XhoI.

Sequencing and unigene building

Random 5' sequencing of cDNAs was done at the University of Florida ICBR Core Facility using ET Terminator (Amersham Inc, Schaumburg, IL, USA). Sequence quality screening and assembling of ESTs into unique gene sequences (unigenes) was done as described in [11]. See also Table 1 for more details.

Functional characterization

A first annotation of the unigene sequences was done using BLAST in the GenBank NR database, and in the complete coding sequences from Arabidopsis [36]. As a further annotation and classification of the unigenes, we used the Gene Ontology (GO) system [15]. All Arabidopsis hits with an expectation value of 1e-10 or better were submitted to the GO annotation search tool at the TAIR website [16,37], and relative frequencies of gene counts assigned to the different GO functional classes were displayed as pie charts using Microsoft Excel. Comparison of frequencies with Arabidopsis within the Biological Processes and Molecular Function GO categories was done using the whole Arabidopsis genome annotation tool on the TAIR website. Comparison of the Stenogyne fruit EST library with the tomato unigene set (downloaded from the Solanaceae Genomics Network; [13,17]) was performed with a first annotation by best-matched hits (BLASTX e-value < 1e-10) to the Arabidopsis genome and using Nick's Venn Selector Tool [38]. The GO Slim functional classification scheme [15,18] was used to identify loci within Developmental Processes, and the GO annotation search tool at the TAIR website [16] was used to produce a list of finer-scale GO terms.

Identification and testing of microsatellite loci

Each of the unigenes was analyzed for long microsatellite repeats using the free online tool SSR Primer [39], which integrates SPUTNIK [40], an SSR repeat finder, with Primer3 [41], a PCR primer prediction program. For testing of the SSR loci, DNA from individual accessions was extracted using the DNeasy Plant Mini kit (Qiagen Inc., Valencia, California, USA). Using homologous genomic DNA from Stenogyne rugosa PCR amplifications were optimized by testing different PCR reagents and annealing temperatures. The following protocol proved successful: 10 μL reaction volume using the AmpliTaq Gold DNA Polymerase kit (Applied Biosystems Foster City, California, USA), 0.2 mmol/L of a dNTP blend, 1 μmol/L of each primer, and 1 μL DNA and a PCR touch-down protocol with the following profile: 1) initial denaturation 95°C 10 min, 2) 10 cycles of 95°C 1 min, 60°C 1 min, decreasing annealing temperature 1°C/cycle, 72°C 1 min 30 sec, 3) 35 cycles of 95°C 1 min, 50°C 1 min, 72°C 1 min 30 sec, and 4) a final extension 72°C 10 min. Analysis of SSR variation was done using flourescently labeled forward primers, size standard ROX500, and an ABI3100 automated sequencer (Applied Biosystems). After a close investigation of the 44 primer pairs and their possible location in intron/exon junctions (using the SGN Intron Finder tool [42]), a set of 35 primers was selected for a first evaluation with homologous genomic DNA from Stenogyne rugosa (see Table 4 for primer sequences). For a preliminary test of cross-transferability to other Hawaiian mints, 30 of these primer sets were tested for the species Stenogyne calaminthoides, Phyllostegia warshaueri, and Haplostachys haplostachya. Furthermore, five of these primer pairs were tested for variation among a total of 88 individual accessions, including 84 Hawaiian accessions and four North American relatives in the genus Stachys. The amplification profile for each of the five loci was scored using the ABI PRISM® GeneMapper® Software v3.7 (Applied Biosystems). The polymorphic information content (PIC) was calculated using the Polymorphism Information Content Calculator [43]. Frequency distributions of alleles in each locus were calculated using the software SPSS v. 13.0 (SPSS Inc.). To investigate the genomic locations of the five microsatellites, including determination of potential for paralogous PCR amplification, comparisons with the Arabidopsis proteome were performed at the TAIR website [37]. Each EST sequence was translated using six-frame translation [44], and both DNA and protein sequences were compared to the corresponding best hits in Arabidopsis, respectively (see Table 3 for best hits), using CLUSTALW [45]. If this approach did not provide a location for the EST SSR, the EST SSR primer sequences (Table 4) were aligned to various portions of the best hits in Arabidopsis (i.e., 5' UTR, exons, introns, or 3' UTR) using CLUSTALW. If the primers could be aligned equally well in several locations along Arabidopsis sequences, the locations that would give a product of expected size based on particular Stenogyne unigenes were regarded as most parsimonious. This procedure was repeated for next best BLAST hits (especially if unigenes were annotated to gene families) until paralogy could or could not be excluded.

Authors' contributions

CL, ACS, and VAA carried out tissue collection in situ. ACS constructed the cDNA library under the supervision of PG, DGO, DES, and PSS. MJY participated in preparation of the library for sequencing. DES and PSS were responsible for producing the sequence data, and CL, ACS, JHLM, and VAA for the bioinformatic analyses. ACS acquired the GIGANTEA intron sequence data and CL performed the testing of microsatellite loci. CL and VAA conceived of the study, were responsible for its design and coordination, and drafted the manuscript. All authors read and approved the final draft.
  25 in total

Review 1.  The YABBY gene family and abaxial cell fate.

Authors:  J L Bowman
Journal:  Curr Opin Plant Biol       Date:  2000-02       Impact factor: 7.834

2.  Functional annotation of the Arabidopsis genome using controlled vocabularies.

Authors:  Tanya Z Berardini; Suparna Mundodi; Leonore Reiser; Eva Huala; Margarita Garcia-Hernandez; Peifen Zhang; Lukas A Mueller; Jungwoon Yoon; Aisling Doyle; Gabriel Lander; Nick Moseyko; Danny Yoo; Iris Xu; Brandon Zoeckler; Mary Montoya; Neil Miller; Dan Weems; Seung Y Rhee
Journal:  Plant Physiol       Date:  2004-06-01       Impact factor: 8.340

3.  Comparative analysis of population genetic structure in Athyrium distentifolium (Pteridophyta) using AFLPs and SSRs from anonymous and transcribed gene regions.

Authors:  M Woodhead; J Russell; J Squirrell; P M Hollingsworth; K Mackenzie; M Gibby; W Powell
Journal:  Mol Ecol       Date:  2005-05       Impact factor: 6.185

4.  A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. The Huntington's Disease Collaborative Research Group.

Authors: 
Journal:  Cell       Date:  1993-03-26       Impact factor: 41.582

5.  Control of inflorescence architecture in Antirrhinum.

Authors:  D Bradley; R Carpenter; L Copsey; C Vincent; S Rothstein; E Coen
Journal:  Nature       Date:  1996-02-29       Impact factor: 49.962

6.  The SELF-PRUNING gene family in tomato.

Authors:  Lea Carmel-Goren; Yong Sheng Liu; Eliezer Lifschitz; Dani Zamir
Journal:  Plant Mol Biol       Date:  2003-08       Impact factor: 4.076

7.  The SELF-PRUNING gene of tomato regulates vegetative to reproductive switching of sympodial meristems and is the ortholog of CEN and TFL1.

Authors:  L Pnueli; L Carmel-Goren; D Hareven; T Gutfinger; J Alvarez; M Ganal; D Zamir; E Lifschitz
Journal:  Development       Date:  1998-06       Impact factor: 6.868

8.  Functional analysis and comparative genomics of expressed sequence tags from the lycophyte Selaginella moellendorffii.

Authors:  Jing-Ke Weng; Milos Tanurdzic; Clint Chapple
Journal:  BMC Genomics       Date:  2005-06-06       Impact factor: 3.969

9.  EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes.

Authors:  Eric D Brenner; Manpreet S Katari; Dennis W Stevenson; Stephen A Rudd; Andrew W Douglas; Walter N Moss; Richard W Twigg; Suzan J Runko; Giulia M Stellari; W R McCombie; Gloria M Coruzzi
Journal:  BMC Genomics       Date:  2005-10-15       Impact factor: 3.969

10.  Expressed sequence tag analysis in Cycas, the most primitive living seed plant.

Authors:  Eric D Brenner; Dennis W Stevenson; Richard W McCombie; Manpreet S Katari; Stephen A Rudd; Klaus F X Mayer; Peter M Palenchar; Suzan J Runko; Richard W Twigg; Guangwei Dai; Rob A Martienssen; Phillip N Benfey; Gloria M Coruzzi
Journal:  Genome Biol       Date:  2003-11-18       Impact factor: 13.583

View more
  13 in total

1.  Development of expressed sequence tag resources for Vanda Mimi Palmer and data mining for EST-SSR.

Authors:  Seow-Ling Teh; Wai-Sun Chan; Janna Ong Abdullah; Parameswari Namasivayam
Journal:  Mol Biol Rep       Date:  2010-11-30       Impact factor: 2.316

2.  Next-generation phage display: integrating and comparing available molecular tools to enable cost-effective high-throughput analysis.

Authors:  Emmanuel Dias-Neto; Diana N Nunes; Ricardo J Giordano; Jessica Sun; Gregory H Botz; Kuan Yang; João C Setubal; Renata Pasqualini; Wadih Arap
Journal:  PLoS One       Date:  2009-12-17       Impact factor: 3.240

3.  Generation, functional analysis and utility of Citrus grandis EST from a flower-derived cDNA library.

Authors:  Manosh Kumar Biswas; Lijun Chai; Xu Qiang; Xiuxin Deng
Journal:  Mol Biol Rep       Date:  2012-04-05       Impact factor: 2.316

4.  Generation and analysis of expressed sequence tags from leaf and root of Withania somnifera (Ashwgandha).

Authors:  Kalaiselvi Senthil; Neha G Wasnik; Yu-Jin Kim; Deok-Chun Yang
Journal:  Mol Biol Rep       Date:  2009-08-09       Impact factor: 2.316

5.  Dioecious Silene latifolia plants show sexual dimorphism in the vegetative stage.

Authors:  Jitka Zluvova; Jiri Zak; Bohuslav Janousek; Boris Vyskot
Journal:  BMC Plant Biol       Date:  2010-09-20       Impact factor: 4.215

6.  Next-generation sequencing of the Chrysanthemum nankingense (Asteraceae) transcriptome permits large-scale unigene assembly and SSR marker discovery.

Authors:  Haibin Wang; Jiafu Jiang; Sumei Chen; Xiangyu Qi; Hui Peng; Pirui Li; Aiping Song; Zhiyong Guan; Weimin Fang; Yuan Liao; Fadi Chen
Journal:  PLoS One       Date:  2013-04-23       Impact factor: 3.240

7.  Generation of ESTs for flowering gene discovery and SSR marker development in upland cotton.

Authors:  Deyong Lai; Huaizhu Li; Shuli Fan; Meizhen Song; Chaoyou Pang; Hengling Wei; Junjie Liu; Dong Wu; Wenfang Gong; Shuxun Yu
Journal:  PLoS One       Date:  2011-12-06       Impact factor: 3.240

8.  Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

Authors:  Min Lin; Deyong Lai; Chaoyou Pang; Shuli Fan; Meizhen Song; Shuxun Yu
Journal:  PLoS One       Date:  2013-10-11       Impact factor: 3.240

9.  A White Campion (Silene latifolia) floral expressed sequence tag (EST) library: annotation, EST-SSR characterization, transferability, and utility for comparative mapping.

Authors:  Maria Domenica Moccia; Christine Oger-Desfeux; Gabriel Ab Marais; Alex Widmer
Journal:  BMC Genomics       Date:  2009-05-25       Impact factor: 3.969

10.  Polyglutamine variation in a flowering time protein correlates with island age in a Hawaiian plant radiation.

Authors:  Charlotte Lindqvist; Liisa Laakkonen; Victor A Albert
Journal:  BMC Evol Biol       Date:  2007-07-02       Impact factor: 3.260

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.