Literature DB >> 16845542

A novel family of diversified immunoregulatory receptors in teleosts is homologous to both mammalian Fc receptors and molecules encoded within the leukocyte receptor complex.

James L Stafford1, Eva Bengtén, Louis Du Pasquier, Robin D McIntosh, Sylvie M Quiniou, L W Clem, Norman W Miller, Melanie Wilson.   

Abstract

Three novel and closely related leukocyte immune-type receptors (IpLITR) have been identified in <span class="Species">channel catfish (<span class="Species">Ictalurus punctatus). These receptors belong to a large polymorphic and polygenic subset of the Ig superfamily with members located on at least three independently segregating loci. Like mammalian and avian innate immune regulatory receptors, IpLITRs have both putative inhibitory and stimulatory forms, with multiple types coexpressed in various lymphoid tissues and clonal leukocyte cell lines. IpLITRs have an unusual and novel relationship to mammalian and avian innate immune receptors: the membrane distal Ig domains of an individual IpLITR are related to fragment crystallizable receptors (FcRs) and FcR-like proteins, whereas the membrane proximal Ig domains are related to several leukocyte receptor complex encoded receptors. This unique composition of Ig domains within individual receptors supports the hypothesis that functionally and genomically distinct immune receptor families found in tetrapods may have evolved from such ancestral genes by duplication and recombination events. Furthermore, the discovery of a large heterogeneous family of immunoregulatory receptors in teleosts, reminiscent of amphibian, avian, and mammalian Ig-like receptors, suggests that complex innate immune receptor networks have been conserved during vertebrate evolution.

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 16845542      PMCID: PMC1592254          DOI: 10.1007/s00251-006-0134-1

Source DB:  PubMed          Journal:  Immunogenetics        ISSN: 0093-7711            Impact factor:   2.846


Introduction

Immune receptors that bind similar ligands often form clusters that are encoded on distinct chromosomes in the <span class="Species">human genome. For example, receptors that bind to the Fc portion of Ig [f<span class="Species">ragment crystallizable receptors (FcRs)] are found on chromosome 1q21-23 and consist of the high-affinity IgG and IgE receptors (FcγRI and FcεRI) and the related low- or moderate-affinity Ig receptors (FcγRII, FcγRIII, and FcγRIV) (Hullet et al. 1991; Ravetch and Kinet 1991; Hullet and Hogarth 1994; Daeron 1997; Falk et al. 2005; Falk and Ravetch 2006). Alternatively, immune receptors involved in the recognition of major histocompatability class 1 (MHC I) antigens, such as killer cell Ig-like receptors (KIRs) and leukocyte Ig-like receptors (LILRs), are clustered together on chromosome 19q13.4 in a region known as the leukocyte receptor complex (LRC) (Kremer et al. 1992; Wagtmann et al. 1997; Wende et al. 1999; Martin et al. 2002). Recently, comparative studies have suggested that FcRs and LRC-encoded receptors, although genomically and functionally distinct, appeared to have evolved from a common ancestor. This contention is supported in part by recent attempts to find LRC regions in other species. <span class="Species">Mouse chromosome 7 is syntenic to the <span class="Species">human LRC and encodes the paired Ig-like receptors (PIRs) that were originally discovered in an attempt to find a murine IgA receptor ortholog (CD89; Kubagawa et al. 1997; Hayami et al. 1997). Subsequently, searches for PIR relatives resulted in the identification of the chicken Ig-like receptors (CHIRs) in birds (Dennis et al. 2000), representing a multigene family encoded within an avian LRC-like region (Nikolaidis et al. 2005a; Viertlboeck et al. 2005). More importantly, CHIR Ig domain sequences are not only related to the mammalian PIRs and KIRs, but also to various FcR Ig domains (Dennis et al. 2000). This previously unrecognized relationship was supported by phylogenetic and comparative structural analysis and was the first evidence suggesting that certain genomically and functionally diverse mammalian and avian immune receptor families probably evolved from a common ancestor (Dennis et al. 2000; Nikolaidis et al. 2005b). Compared to mammals and birds, bony fish are among the most phylogenetically distant vertebrates with cha<span class="Species">racteristic innate and adaptive immune systems that have mammalian-like B and T cells (Yoder 2004). Furthermore, due to the establishment of clonal lymphoid cell lines, catfish are known to also possess natural killer (NK)-like cells capable of killing xenogeneic targets by an antibody-dependent cell-mediated cytotoxicity (ADCC) process (Shen et al. 2002–2004). This functional evidence suggested that catfish NK cells possess a putative FcμR (Shen et al. 2003). Additionally, catfish NK cells can kill allogeneic targets in an ADCC-independent manner, indicating that target recognition may also involve KIR and/or LILR-like receptors (Shen et al. 2002, 2004). However, to date, FcR and/or KIR/LILR homologs have not been described in ectothermic vertebrates, making it difficult to elucidate the evolutionary history of these important receptor families. Large families of putative activatory and inhibitory novel immune-type receptors (NITRs) also belonging to the Ig superfamily (IgSF) have been described in teleosts. Pufferfish (Spheroides nephelus), zebrafish (Danio rerio), catfish, and rainbow trout (Oncorhynchus mykiss) all express NITRs (Strong et al. 1999; Yoder et al. 2001, 2002; Hawke et al. 2001). Because some NITRs are also expressed by catfish NK cells (Hawke et al. 2001), it has been suggested that these receptors may represent the “functional orthologs” of the mammalian KIRs and/or LILRs (Yoder et al. 2001; Hawke et al. 2001). However, NITRs do not exhibit any sequence identity or phylogenetic relationship to such receptors (Yoder et al. 2001) and have only been identified in bony fishes. Herein is described a novel set of IgSF receptors present in the <span class="Species">channel catfish, and possibly other <span class="Species">teleosts, that are composed of Ig domains related to functionally diverse immunoreceptor families present in mammals. Detailed sequence analysis supports that individual catfish leukocyte immune-type receptors (IpLITRs) contain a unique composition of Ig C2-like domains sharing homology with both FcRs and receptors encoded within the LRC. Thus, IpLITRs provide further evidence supporting the common evolutionary origins of genomically and functionally distinct immunoregulatory receptor families present in mammals.

Materials and methods

Experimental animals and cell lines

<span class="Species">Catfish (1–2 kg) were obtained from a commercial source (ConAg<span class="Species">ra, Isola, MS, USA) and maintained in individual tanks as described previously (van Ginkel et al. 1992). Catfish peripheral blood leukocytes (PBL) were isolated from heparinized blood by centrifugation on a cushion of Ficoll-Hypaque (Lymphoprep, Accurate Chemical, Westbury, NY, USA) as described previously (Miller et al. 1994a). Catfish cells lines were grown at 27°C in AL-3 medium consisting of equal parts AIM-V and L-15 (Life Technologies, Gaithersburg, MD, USA) adjusted to catfish tonicity with 10% (v/v) deionized water and supplemented with 1 μg/ml NaHCO3, 50 U/ml penicillin, 50 μg/ml streptomycin, 20 μg/ml gentamicin, 50 uM 2-ME, and 3% heat-inactivated, pooled, normal catfish serum (Miller et al. 1994a,b). 3B11 is a cloned autonomous B cell line generated from an outbred catfish by mitogen stimulation (Wilson et al. 1997). G14D is an automonous T cell line derived from a gynogenetic catfish (Hogan et al. 1999), whereas 42TA is a macrophage cell line derived from a different outbred fish (Miller et al. 1994b). TS32.15 and TS32.17 are clonal nonautonomous antigen-dependent cytotoxic T cell lines developed from an alloantigen immunized outbred fish (Stuge et al. 2000). 1F3 is a clonal nonautonmous NK-cell line developed from an alloantigen-stimulated culture of PBL from a naive outbred fish (Shen et al. 2004). The nonautonomous cytotoxic T cell and NK cell lines require weekly restimulation with irradiated allogeneic cells for continuous proliferation. The channel catfish ovary fibroblast cell line (CCO; Browser and Plumb 1980) was provided by Dr. V.G. Chinchar (University of Mississippi Medical Center). CCO cells were maintained in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% FCS.

Channel catfish LITRs and sequence analysis

In a search for IgSF receptors expressed by alloantigen stimulated <span class="Species">catfish PBL and various <span class="Species">catfish clonal cell lines, several expressed sequence tag (EST) libraries were analyzed. Subsequently, IpLITR1 and IpLITR3 cDNAs were identified by single pass sequencing of a cDNA library generated from a catfish 7-day-old mixed lymphocyte culture (MLC) enriched in NK-like cells, MLC52-1 (Shen et al. 2004; Stuge et al. 1997). IpLITR2 was obtained from the catfish 42TA macrophage cell line (Miller et al. 1994b) cDNA library. The cDNAs were sequenced on both strands using universal forward and reverse primers and gene-specific primers. Nucleotide and amino acid sequences were analyzed using DNASTAR software (Madison, WI, USA) and aligned using CLUSTALW (Thompson et al. 1997). Neighbor-joining (NJ) trees with pairwise gap deletions were drawn using MEGA v3.0 (Kumar et al. 2001). Maximum parsimony and maximum likelihood trees were drawn with essentially the same results (data not shown). Similarity searches were performed with the extracellular Ig domains of IpLITR1, IpLITR2, and IpLITR3 using position-specific iterative (PSI) and Basic Local Alignment Search Tool (BLAST) analysis (Altschul et al. 1990) against the National Center for Biotechnology Information (NCBI) nonredundant database. SOSUI (signal) beta version, Simple Modular Architecture Research Tool (SMART) (Letunic et al. 2004), Pfam databases (Bateman et al. 2004) and the three-dimensional position-specific scoring matrix server (Kelly et al. 2000) were used for predictions of signal peptides, Ig domains, transmembrane (TM) segments, and secondary structure. Sequence decorations were performed using GeneDoc (http://psc.edu/biomed/genedoc).

Southern and Northern blot analyses

Genomic DNA was prepared from erythrocytes of 16 <span class="Species">catfish siblings. These siblings were representatives of a 78-member family obtained from the <span class="Species">Catfish Genetics Research Unit, United States Department of Agriculture, Agricultural Research Service (Stoneville, MS, USA; designated family 1). The sibling catfish 1–16 used were A10, A5, A32, A22, A38, A36, A16, A29, A18, A49, A159, A15, A23, A25, A186, and A37, respectively (Quiniou et al. 2005). The DNA (10 μg) was digested to completion with Pst1 or EcoRI, separated on 1% agarose gels and transferred by capillary action onto Hybond-N+ membranes (Amersham Pharmacia Biotech, Arlington Heights, IL, USA) using standard techniques. Hybridizations were performed in Rapid-hyb buffer (Amersham Pharmacia Biotech) at 65°C and membranes were washed at high stringency (65°C with 0.1× saline-sodium citrate, 0.1% sodium dodecyl sulfate). Specific probes (Table 1) were amplified by PCR using IDPol DNA polymerase (ID Labs Biotechnology, London, Ontario, Canada) according to the manufacturer’s recommended protocol. Typical parameters were: 1 min 94°C, followed by 29 cycles of 94°C 30 s, 62°C 30 s, 72°C 1 min, then extension at 72°C for 10 min. Probes were random primed labeled with [32P] 2′-deoxycytidine 5′-triphosphate using a Megaprime labeling kit (Amersham Pharmacia Biotech).
Table 1

IpLITR PCR primers used for generating Ig domain-specific probes and gene-specific primers used in RT-PCR experiments

Primer  
IpLITR1 D1Forward5′ GTCGGACAAGGTCAAGTTCTG 3′
Reverse5′ GGCTTTTGGTCTCTCTATCAC 3′
IpLITR1 D4Forward5′ AATCCTGATGAACAGGTGTACC 3′
Reverse5′ GTGTTTACAGTGGTAGAAACC 3′
IpLITR2 D3Forward5′ AGTCGTGAAGGAGCTGTACTGA 3′
Reverse5′ TTCACTGCCAGAATGATGGTCAC 3′
IpLITR3 D6Forward5′ CTGAGGGACATCCTCTGACCTT 3′
Reverse5′ GTGTTTACAGTGGTAGAAACC 3′
IpLITR1 GSPForward5′ GTCGGACAAGGTCAAGTTCTG 3′
Reverse5′ CTGCAGACATGATGAACTTCT 3′
IpLITR2 GSPForward5′ GTCGGACAAGCTCAAGAGTTT 3′
Reverse5′ TGTGTAGTAGAGTGGGTTTCC 3′
IpLITR3 GSPForward5′ GTCGGACAAGGTCAAGTTCTG 3′
Reverse5′ GCTTTTGGGTGACTCTCCTCT 3′
IpEF1α GSPForward5′ GACTGCCACACTGCTCACATTG 3′
Reverse5′ TTAGTTACTCAGCAGCTTTCTTCC

GSP gene-specific primers

IpLITR PCR primers used for gene<span class="Species">rating Ig domain-specific probes and gene-specific primers used in RT-PCR experiments <span class="Gene">GSP gene-specific primers Total RNA from <span class="Species">catfish PBL and various tissues was prepared using RNA-Bee (Tel-test, Friendswood, TX, USA); 10 μg of each sample were electrophoresed on 1.5% <span class="Chemical">formaldehyde-agarose gels and transferred by capillary action onto Hybond-N+ (Amersham Pharmacia Biotech), hybridized, and washed as above.

Reverse transcription (RT)-PCR

Total RNA from PBL, MLC, various tissues, and <span class="Species">catfish clonal cell lines were prepared as described above, and treated with DNase I (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s recommended protocol. One μg RNA was reverse t<span class="Species">ranscribed using an oligo-T primer and 200 units of Superscript III reverse transcription (RT) (Invitrogen Life Technologies). RT-PCR was performed using specific primers for IpLITR and the housekeeping gene elongation factor 1 alpha (IpEF1α; Table 1). Typical parameters were: 3 min 94°C, followed by 30 cycles of 94°C 45 s, 58°C 45 s, 72°C 2 min, then extension at 72°C for 10 min. PCR products were visualized on 1.2% Tris-acetate-EDTA agarose gels. PCR products were also cloned into pCR4-TOPO® (Invitrogen Life Technologies) and verified by sequencing. The Genbank accession number for IpEF1α is CB938718.

Results

Catfish LITR sequences

In a search for IgSF receptors expressed by alloantigen-stimulated <span class="Species">catfish PBL and various <span class="Species">catfish clonal cell lines, several EST libraries were analyzed. Three IpLITR sequences were subsequently identified that encoded type I TM proteins with extracellular C2-like Ig domains, which were predicted using SMART (see Electronic Supplementary Material). Even though these sequences vary in length, they are highly similar (Fig. 1a,b). All three receptors have identical signal peptides and IpLITR1 and IpLITR3 have almost identically encoded Ig domains D1, D2, D3, and D4 (Fig. 1a). Comparatively, IpLITR2 D1 and D2 are 77.2 and 86.8% identical at the amino acid level to their IpLITR1 and IpLITR3 counterparts (Fig. 1c). IpLITR1 encodes a 346 amino acid extracellular region consisting of four Ig domains, a 23-amino acid TM segment and a 116-amino acid cytoplasmic tail (CYT). The IpLITR1 CYT contains two immunotyrosine-based inhibition motifs (ITIMs) centered at Y439 and Y461 and an ITIM-like motif (SEYTTE) centered at Y479 (Fig. 1b) (Daeron and Vivier 1999; Ravetch and Lanier 2000; Billadeau and Leibson 2002). An overlapping immunotyrosine-based switch motif (ITSM; TVYSQL) centered at Y465 is also present in the CYT of IpLITR1 (Shlapatska et al. 2001). In contrast, the smaller IpLITR2 and the longer IpLITR3 transcripts encode for molecules with identical 25-amino acid TMs containing a lysine residue and very similar charged CYTs (Fig. 1b). Overall, the individual IpLITRs are composed of a membrane distal to membrane proximal ordering of Ig domains, each containing similar D1s and D2s. However, the membrane proximal domains vary, i.e., IpLITR3 D5 and D6 are only 15.7–24.7% and 15.2–25% identical, respectively, to all other IpLITR Ig domains, and IpLITR2 D3 is only 17.9–39.3% identical to other IpLITR domains (Fig. 1c).
Fig. 1

Predicted amino acid sequence, domain comparisons, and schematic representation of IpLITR1, IpLITR2, and IpLITR3. a Alignment of the extracellular and b TM/CYT regions of IpLITR1, IpLITR2, and IpLITR3. Signal peptide (SP), and immunoglobulin (Ig) domains are labeled; cysteine residues predicted to be involved in intrachain disulfide bonds are marked with asterisks; gray shaded residues represent differences from IpLITR1 in a and differences from IpLITR2 in b. TMs are underlined, ITIM-like motifs are boxed, an overlapping ITSM within the CYT of IpLITR1 is indicated by a bracket, and TM charged residues are shaded black and marked (+). c Phylogenetic analysis of Ig domains in IpLITRs. NJ trees with pairwise gap deletions were drawn using MEGA v3.0 (Kumar et al. 2001) with 10,000 bootstrap replications, and bootstrap values >50% are shown. Branch lengths were measured in terms of amino acid substitutions and a scale bar are shown below the trees. The predicted SP, Ig domains, TM, and CYT are indicated. ITIM-like motifs are shown as boxes, N-linked glycosylation sites are marked as ballpoint lines. Individual IpLITR domains are shaded according to their relatedness between IpLITRs and percent amino acid identity with IpLITR1 Ig domains indicated to the left of IpLITR2 and IpLITR3. IpLITR2 D3 and IpLITR3 D5 and D6 are 15.2–39.3% identical to all IpLITR1 Ig domains

Predicted amino acid sequence, domain comparisons, and schematic representation of IpLITR1, IpLITR2, and IpLITR3. a Alignment of the extracellular and b TM/CYT regions of IpLITR1, IpLITR2, and IpLITR3. Signal peptide (<span class="Chemical">SP), and immunoglobulin (Ig) domains are labeled; cysteine residues predicted to be involved in intrachain disulfide bonds are marked with asterisks; gray shaded residues represent differences from IpLITR1 in a and differences from IpLITR2 in b. TMs are underlined, ITIM-like motifs are boxed, an overlapping ITSM within the CYT of IpLITR1 is indicated by a bracket, and TM charged residues are shaded black and marked (+). c Phylogenetic analysis of Ig domains in IpLITRs. NJ trees with pairwise gap deletions were drawn using MEGA v3.0 (Kumar et al. 2001) with 10,000 bootstrap replications, and bootstrap values >50% are shown. Branch lengths were measured in terms of amino acid substitutions and a scale bar are shown below the trees. The predicted SP, Ig domains, TM, and CYT are indicated. ITIM-like motifs are shown as boxes, N-linked glycosylation sites are marked as ballpoint lines. Individual IpLITR domains are shaded according to their relatedness between IpLITRs and percent amino acid identity with IpLITR1 Ig domains indicated to the left of IpLITR2 and IpLITR3. IpLITR2 D3 and IpLITR3 D5 and D6 are 15.2–39.3% identical to all IpLITR1 Ig domains

IpLITRs belong to polymorphic and polygenic gene families

Sibling restriction f<span class="Species">ragment length polymorphism (RFLP) patterns using domain-specific probes for the various IpLITRs show a large number of hybridizing bands with each probe used, as well as differences in the banding patterns among siblings (Fig. 2). These findings indicate that the IpLITR gene complex is both polygenic and polymorphic. However, it is presently unknown whether these polymorphic differences are due to variability within the exons encoding these receptors and/or within the introns. Some of the high-intensity bands found in each of the Southern blots may reflect multiple IpLITR copies, further increasing the possible number of genes. Importantly, the Southern blot segregation patterns show that there is more than one IpLITR locus. For example, among the 16 sibling fish used there are at least nine, perhaps more, different RFLP patterns for IpLITR D1 (Fig. 2b). If these genes were closely linked then only four RFLP patterns (barring cross-over events) would be observed, as shown for the <span class="Gene">MHC class IIβ RFLP patterns (Fig. 2a). When all Southern blots are compared, at least three distinct linkage groups (marked by ●, ▲, and ■ ) are observed, indicating the presence of multiple independently segregating loci, and none of these are linked to the MHC II RFLP (Fig. 2b–d). Similar results were also obtained using the IpLITR2 D3 probe (data not shown). Mining of the zebrafish genome for IpLITR relatives [whole genome shotgun database of the NCBI (Sanger Genomic Institute, Cambridge, UK)] further supports that these receptors are present on different chromosomes because five contigs were identified with IpLITR-like homologs on zebrafish chromosomes 3, 7, and 8 (Table 2).
Fig. 2

Southern blot analyses. Genomic DNA from 16 sibling catfish was digested, separated, transferred to nylon membranes, and hybridized with a MHCIIβ, b IpLITR1 D1, c IpLITR1 D4, and d IpLITR3 D6-specific probes. Letters a–i indicate different segregation patterns (b′, e′, and h′ represent variant segregation patterns that may be the result of recombination). Representative RFLP bands illustrating different linkage groups are indicated by ●, ▲, and ■. Kilobase size markers are indicated to the left of each blot

Table 2

Identification of IpLITR-like genes in the zebrafish genome

Accession numbersChromosome
BX0051568
BX0005248
BX5111763
BX6496273
CAAK01000490.17

Search (04/05) of the zebrafish whole genome shotgun database of the NCBI (Sanger Genomic Institute)

Southern blot analyses. Genomic DNA from 16 sibling <span class="Species">catfish was digested, sepa<span class="Species">rated, transferred to nylon membranes, and hybridized with a MHCIIβ, b IpLITR1 D1, c IpLITR1 D4, and d IpLITR3 D6-specific probes. Letters a–i indicate different segregation patterns (b′, e′, and h′ represent variant segregation patterns that may be the result of recombination). Representative RFLP bands illustrating different linkage groups are indicated by ●, ▲, and ■. Kilobase size markers are indicated to the left of each blot Identification of IpLITR-like genes in the <span class="Species">zebrafish genome Search (04/05) of the <span class="Species">zebrafish whole genome shotgun database of the NCBI (Sanger Genomic Institute)

IpLITR expression

Northern blot analyses using a cross hybridizing IpLITR1 D1 probe revealed that LITR message is highly expressed in the hematopoietic pronephros and mesonephros, with predominant t<span class="Species">ranscript sizes of ∼6.6, ∼4.0, and ∼3.8 Kb (Fig. 3a). Low levels of IpLITR D1 expression were detected in the spleen, with little to no message detected in the heart, liver, gill, or muscle. The use of the more specific IpLITR2 D3 probe revealed message expression not only in the pronephros and mesonephros, but also in the spleen, gill, and perhaps heart with t<span class="Species">ranscripts of ∼6.0, ∼3.7, ∼2.7, and ∼1.9 Kb (Fig. 3b). RNA load levels for each of the tissues tested were similar based upon hybridization with a catfish EF1α probe. RT-PCR, using primers specific for the putative inhibitory IpLITR1 and the putative activating IpLITR2 as representative IpLITRs, was also used to assess tissue expression. As shown in Fig. 3c, IpLITR1 and IpLITR2 are in most cases coordinately expressed in a variety of different tissues and confirm the Northern blot data. In addition, multiple PCR products were amplified using the IpLITR1 and IpLITR2 specific primers, which is reminiscent of the multiple transcripts observed following RNA blotting. Because the predicted sizes of PCR products for the prototype IpLITR1 and IpLITR2 are 1,461 and 780 bp, respectively, at least two additional IpLITR1 products (1,545 and 2,392 bp) and one additional IpLITR2 product (1,298 bp) were amplified (Fig. 3c).
Fig. 3

Northern blot and RT-PCR analyses of IpLITR tissue expression. Catfish LITR tissue expression was performed by Northern blot analysis using a an IpLITR1 D1-specific probe, and b an IpLITR2 D3-specific probe. Total RNA from pronephros (head kidney), mesonephros (trunk kidney), spleen, heart, liver, gill, and muscle were examined. Kilobase markers are on the left margin and arrows indicate the major hybridizing bands observed. RNA integrity and load levels were determined by hybridization using a catfish EF1α probe as a housekeeping gene. c RT-PCR analyses of IpLITR1 and IpLITR2 in various catfish tissues. The sizes of the IpLITR bands verified by sequencing are indicated at the right margin and base pair sizes are at the left margin

Northern blot and RT-PCR analyses of IpLITR tissue expression. <span class="Species">Catfish LITR tissue expression was performed by Northern blot analysis using a an IpLITR1 D1-specific probe, and b an IpLITR2 D3-specific probe. Total RNA from pronephros (head kidney), mesonephros (trunk kidney), spleen, heart, liver, gill, and muscle were examined. Kilobase markers are on the left margin and arrows indicate the major hybridizing bands observed. RNA integrity and load levels were determined by hybridization using a <span class="Species">catfish EF1α probe as a housekeeping gene. c RT-PCR analyses of IpLITR1 and IpLITR2 in various catfish tissues. The sizes of the IpLITR bands verified by sequencing are indicated at the right margin and base pair sizes are at the left margin To further examine the expression of IpLITR1 and IpLITR2, RT-PCR was performed using RNA from <span class="Species">catfish clonal macrophage, B, T, and NK-like cell lines, as well as a MLC (Fig. 4a). RT-PCR products of 1,461, 1,545, and 2,392 bp were obtained using IpLITR1-specific primers, and these products were detected variably among the cell lines examined. It was also found that three RT-PCR products were also variably amplified from the different <span class="Species">catfish leukocyte cell lines using IpLITR2-specific primers, the expected 780-bp product, a 1,298-bp product (previously observed in tissues; see Fig. 3c), and an additional 1,060-bp product (Fig. 4a). In contrast, no IpLITR message was detected in the fibroblast CCO cell line (data not shown), indicating that these genes are primarily expressed in cells of immune function.
Fig. 4

a RT-PCR analyses of IpLITR1 and IpLITR2 expression in various catfish clonal cell lines and a polyclonal MLC. Total RNA was obtained from the catfish 42TA macrophages, 3B11 B cells, TS32.15 and TS32.17 nonautonomous cytotoxic T cells, autonomous G14D T cells, a MLC, and 1F3 NK-like cells. RT-PCR was performed using primers specific for IpLITR1, IpLITR2, and IpEF1α. The sizes of the IpLITR bands verified by sequencing are indicated at the right margin and base pair sizes are at the left margin. b Schematic representation of IpLITR-types identified by sequencing of RT-PCR products obtained using IpLITR1 and IpLITR2-specific primers. The originally identified prototype IpLITRs are boxed, and arrows indicate the relative positions of the primer pairs used in RT-PCR reactions. Sizes in base pairs corresponding to the bands observed in a are indicated above each schematic. The predicted SP, Ig domains, TM, and CYT are indicated. ITIM-like motifs are shown as hatched boxes and noncanonical immunotyrosine-based activation motif-like motifs shown as white boxes within the CYT. Individual Ig domains are shaded according to relatedness as described for Fig. 1, and percentages above each receptor represent percentage of amino acid identities of the predicted extracellular region of the IpLITR-like sequences when compared with the prototype IpLITRs

a RT-PCR analyses of IpLITR1 and IpLITR2 expression in various <span class="Species">catfish clonal cell lines and a polyclonal MLC. Total RNA was obtained from the <span class="Species">catfish 42TA macrophages, 3B11 B cells, TS32.15 and TS32.17 nonautonomous cytotoxic T cells, autonomous G14D T cells, a MLC, and 1F3 NK-like cells. RT-PCR was performed using primers specific for IpLITR1, IpLITR2, and IpEF1α. The sizes of the IpLITR bands verified by sequencing are indicated at the right margin and base pair sizes are at the left margin. b Schematic representation of IpLITR-types identified by sequencing of RT-PCR products obtained using IpLITR1 and IpLITR2-specific primers. The originally identified prototype IpLITRs are boxed, and arrows indicate the relative positions of the primer pairs used in RT-PCR reactions. Sizes in base pairs corresponding to the bands observed in a are indicated above each schematic. The predicted SP, Ig domains, TM, and CYT are indicated. ITIM-like motifs are shown as hatched boxes and noncanonical immunotyrosine-based activation motif-like motifs shown as white boxes within the CYT. Individual Ig domains are shaded according to relatedness as described for Fig. 1, and percentages above each receptor represent percentage of amino acid identities of the predicted extracellular region of the IpLITR-like sequences when compared with the prototype IpLITRs The sequencing of the various IpLITR1 and IpLITR2 RT-PCR products from all sources (both tissues and cell lines) resulted in the identification of multiple different IpLITR-related sequences (Stafford et al. manuscript in prepa<span class="Species">ration). Schematic diag<span class="Species">rams of representative IpLITR1 and IpLITR2 variant forms are shown in Fig. 4b. These highly related IpLITR1- and IpLITR2-like sequences differed in the number of Ig-like domains present, and in the case of some IpLITR1-variants, also differed in the length of the CYT.

Homology between IpLITRs, LRC, and FcR genes

When the extracellular region of IpLITR1 was used in BLASTP analysis, various adhesion molecules, FcRs, FcR-like proteins (FCRLs), LILRs, and KIR gene family members were identified with significant homology (i.e., E values <10−7), albeit with moderate amino acid identities ranging from ∼25–30% (Table 3). Examples include the adhesion molecules CD22 and carcinoembryonic antigen-related cell adhesion molecule 5, Xenopus leukocyte FCRLs, XFL, PIRA1, LILRA2, CHIRA2, KIR3DL1, FCRL5, and FcγRIIB. When the Ig domains of IpLITR2 were used for screening, most matches were members of the FcR gene family, e.g., FcγRI, FcγRII, FcγRIII, and FcεRIα, from humans, primates, and rodents, as well as various FCRL proteins (Table 3). Searches using the extracellular region of IpLITR3 were essentially the same as the IpLITR1 BLASTP results, and PSI-BLAST analysis further reinforced the evolutionary relationships between IpLITRs and mammalian FcRs, FCRLs, KIRs, and LILRs, as well as avian CHIRs (data not shown).
Table 3

Representative IpLITR BLASTP results

Receptor AccessionScoreE-valueChromosome
IpLITR1
CD22HumanNP_001762884e-1619q13.1
XFL1.4XenopusAAQ56585845e-15?
CEACAM5HumanCAA34474845e-1519q13.1
PIRA1RatAAD50905731e-11?
LILRA2 (ILT1)ChimpanzeeNP_001009044722e-1119
FCRL5 (FcRH5)MouseNP_899045716e-113
XFL1.3XenopusAAQ63874716e-11?
LILRA2 (ILT1)HumanAAD50364701e-1019q13.4
KIR3DL1HumanAAC83928693e-1019q13.4
KIRChimpanzeeAAF86243684e-1019
CHIRA2ChickenCAG33731661e-9?
KIR3DL1OrangutanAAM78465661e-919
FCRL5 (FcRH5)HumanCAH71428662e-91q21
KIR3DS1HumanAAV32446662e-919q13.4
FcγRIIBRatAAL29888631e-813q24
XFL1.6XenopusAAQ63873631e-8?
XFL1.2XenopusAAQ56587622e-8?
CHIRB3ChickenCAG25957623e-8?
LILRA3 (ILT6)HumanAAB87661608e-819q13.4
LIRBovineXP_586587601e-7?
PIRA2MouseAAC53213592e-77
IpLITR2
IRTA2BovineXP_595289761e-12?
FcγRIIGuinea pigA34636613e-8?
FCRL5 (FcRH5)MouseNP_899045606e-83
FCRL3 (FcRH3)MouseAAS91578606e-83
FcγRIMacaqueAAL92095591e-7?
FCRL5 (FcRH5)HumanNP_112571574e-71q21
FcγRIαHumanCAI12557575e-71q21
FcγRIIBMouseAAH19758569e-71
XFL1.4XenopusAAQ56585569e-7?
IRTA1BovineXP_614632552e-6?
FcεRIαHumanAAH05912538e-61q23
FREB2HumanAAX11390538e-61q23.3
FcγRIHumanAAA58414538e-61q21.2

Similarity search (BLASTP) of the NCBI’s nonredundant protein database using the four Ig domains of IpLITR1 and the three Ig domains of IpLITR2

CEACAM5 carcinoembryonic antigen-related cell adhesion molecule, XFLXenopus leukocyte FCRL

Representative IpLITR BLASTP results Similarity search (BLASTP) of the NCBI’s nonredundant protein database using the four Ig domains of IpLITR1 and the three Ig domains of IpLITR2 <span class="Gene">CEACAM5 carcinoembryonic antigen-related cell adhesion molecule, XFL<span class="Species">Xenopus leukocyte FCRL

Phylogenetic analyses and alignments

The IpLITR D1 and D2 Ig domains are related to those of <span class="Species">mammalian FcRs and FCRLs (Fig. 5a) in that these domains clustered with the FcR/FCRLs and away from catfish NITRs and from representative LRC members in a phylogenetic tree. In contrast to the D1/D2 sequence analyses, the membrane proximal D3 and D4 sequences of IpLITR1 and IpLITR3 resulted in a significant shift within the phylogenetic tree; IpLITRs now clustered with the LRC-encoded genes (Fig. 5b). The LRC relationship is supported by high bootstrap values when comparing IpLITR1 and IpLITR3 D3 and D4 sequences with D2 and D3 sequences of representative LILRs and KIRs, as well as with D1 and D2 sequences of NKp46 and CHIRs. The D5 and D6 sequences of IpLITR3 are related to the D1 and D2 domains of the FcR family (Fig. 5c). Thus, IpLITR3 is the best example of the unique domain structure of these teleost receptors, as it encodes for combinations of Ig domains that are phylogenetically related to the FcRs and FCRLs (D1 and D2; D5 and D6), as well as LRC encoded receptors (D3 and D4).
Fig. 5

Phylogenetic analyses reveal unique Ig domain composition within individual IpLITRs. The Ig domains compared are indicated by gray shading in the schematics to the left of each phylogenetic tree. a Comparisons of IpLITR, representative FcR and FCRL, and human LRC D1 and D2 sequences. b Comparisons of IpLITR1 D3 and D4 with representative FcR, FCRL, KIR, LILR, and PIRA1 D2 and D3 sequences, as well as NKp46 and CHIRA2 D1 and D2 sequences. c Comparison of IpLITR3 D5 and D6 with D1 and D2 of representative mammalian FcRs, FCRLs, and LILRs/KIRs. The accession numbers for the various Ig domain sequences used are: human (hu)FcγRI(CAI12557), huFcγRII (CAA35642), huFcγRIII (CAA36870), huFcεRI (AAH05912), huFCRL3 (AAH28933), huFCRL4 (AAK93970), huFCRL5 (NP_112571), huFcαR/CD89 (AAH27953), huLILRB1 (AAH15731), huLILRB2 (AAB87662), huKIR3DL1 (AAC83928), huKIR3DS1 (AAV32446), huSIRP (CAA71404), human NKp46 (AJ001383), mouse (mo)FcγRI (AAD34931), moFcγRII (AAA37608), moFcγRIII (NP_034318), moFcεRI (NP_034314), moFCRL3 (AAS91578), moNKp46 (AJ223765), rat (ra) FcγRIII (AAA42050), raPIRA1 (XP_341773), raNKp46 (AF082533), guinea pig (gp) FcγRII (D13692), macaque (mac)FcγRI (AAL92095), bovine (bo)FCRL5 (XP_595289), boKIR3DS1 (AAP33626), boSIRP (CAA71943) chimpanzee (cp)LILRA2 (NP_001009044), orangutan (or)KIR (AAM78473), monkey (mk)KIR3DL20 (AAU50562), CHIRA2 (CAG33731), catfish (Ip)NITR1 (AF397454), and IpNITR2 (AF397455). For all analyses, SIRPs and/or IpNITRs were included as outgroups to root the trees. NJ trees with pairwise gap deletions were drawn using MEGA v3.0 (Kumar et al. 2001) with 10,000 bootstrap replications, and bootstrap values >50% are shown. Branch lengths were measured in terms of amino acid substitutions, and scale bars are shown below the trees

Phylogenetic analyses reveal unique Ig domain composition within individual IpLITRs. The Ig domains compared are indicated by gray shading in the schematics to the left of each phylogenetic tree. a Comparisons of IpLITR, representative <span class="Gene">FcR and FCRL, and human LRC D1 and D2 sequences. b Comparisons of IpLITR1 D3 and D4 with representative FcR, FCRL, KIR, LILR, and PIRA1 D2 and D3 sequences, as well as NKp46 and CHIRA2 D1 and D2 sequences. c Comparison of IpLITR3 D5 and D6 with D1 and D2 of representative mammalian FcRs, FCRLs, and LILRs/KIRs. The accession numbers for the various Ig domain sequences used are: human (hu)FcγRI(CAI12557), huFcγRII (CAA35642), huFcγRIII (CAA36870), huFcεRI (AAH05912), huFCRL3 (AAH28933), huFCRL4 (AAK93970), huFCRL5 (NP_112571), huFcαR/CD89 (AAH27953), huLILRB1 (AAH15731), huLILRB2 (AAB87662), huKIR3DL1 (AAC83928), huKIR3DS1 (AAV32446), huSIRP (CAA71404), human NKp46 (AJ001383), mouse (mo)FcγRI (AAD34931), moFcγRII (AAA37608), moFcγRIII (NP_034318), moFcεRI (NP_034314), moFCRL3 (AAS91578), moNKp46 (AJ223765), rat (ra) FcγRIII (AAA42050), raPIRA1 (XP_341773), raNKp46 (AF082533), guinea pig (gp) FcγRII (D13692), macaque (mac)FcγRI (AAL92095), bovine (bo)FCRL5 (XP_595289), boKIR3DS1 (AAP33626), boSIRP (CAA71943) chimpanzee (cp)LILRA2 (NP_001009044), orangutan (or)KIR (AAM78473), monkey (mk)KIR3DL20 (AAU50562), CHIRA2 (CAG33731), catfish (Ip)NITR1 (AF397454), and IpNITR2 (AF397455). For all analyses, SIRPs and/or IpNITRs were included as outgroups to root the trees. NJ trees with pairwise gap deletions were drawn using MEGA v3.0 (Kumar et al. 2001) with 10,000 bootstrap replications, and bootstrap values >50% are shown. Branch lengths were measured in terms of amino acid substitutions, and scale bars are shown below the trees Subsequently, the D1 and D2 Ig domain sequences of IpLITR2 (as a representative) were aligned with various <span class="Species">mouse and <span class="Species">human FcRs and three representative human FCRLs. A majority of the predicted β-strands in IpLITR2 is present in similar positions as the β-strands found in FcR/FCRL family members (Fig. 6a), indicating a predicted degree of secondary structural conservation between IpLITRs and these mammalian immune receptors. In most cases, the predicted IpLITR2 β-strands were present in regions of high amino acid identity/similarity; however, none of the FcR residues known to contact the Fc portion of Ig were present (Fig. 6a). The D3 of IpLITR2, a domain specific to this IpLITR type, appears to be related to the membrane distal domain (D1) of several CHIRs (Fig. 6b), and alignment of IpLITR2 D3 with representative CHIR D1s indicated a degree of amino acid identity/conservation between these Ig domains (Fig. 6c). To reinforce the unique nature of domains present within this receptor, IpLITR2 D1 did not cluster with the CHIRs but was related to mammalian FcR D1 domains (Fig. 6b).
Fig. 6

IpLITR2 contains Ig domains related to both FcRs/FCRLs and CHIRs. a Amino acid alignment of IpLITR2 D1 and D2 sequences with representative mammalian FcRs and FCRLs. Accession numbers are as in Fig. 5. Gray shading: residues similar/identical to IpLITR2. Boxed residues: contacts for Ig Fc in huFcεRI. Black and gray arrows represent the predicted β-strands for IpLITR2 and huFcεRI, respectively. Hatched boxes indicate conserved cyteines and dashes represent gaps. b Phylogenetic analysis of IpLITR2 D1 and D3 sequences (gray shaded) compared with representative mammalian FcR sequences (as in Fig. 5) and D1 sequences of representative CHIRs. The accession numbers for the various Ig domain sequences used are: CHIRB2 (XP_422905), CHIRB1 (CAH55757), CHIRAB2 (CAG33733), CHIRA2 (CAG33731), CHIRB5 (AJ879908), CHIR A1 (AF306851), CHIRB4 (XP_428342), CHIRB6 (CAI53861), and CHIRAB3 (AJ879909). NJ trees with pairwise gap deletions were drawn using MEGA v3.0 (Kumar et al. 2001) with 10,000 bootstrap replications, and bootstrap values >50% are shown. Branch lengths were measured in terms of amino acid substitutions, and scale bars are shown below the trees. c Alignment of IpLITR2 D3 and CHIR D1. Gray shading indicates residues that are similar/identical to IpLITR2, black and gray arrows represent predicted β-strands for IpLITR2 and CHIRA2, respectively; “dotted” lines indicate predicted helices and hatched boxes indicate conserved cyteines. Gaps in alignment are indicated by dashes

IpLITR2 contains Ig domains related to both FcRs/<span class="Gene">FCRLs and CHIRs. a Amino acid alignment of IpLITR2 D1 and D2 sequences with representative mammalian FcRs and FCRLs. Accession numbers are as in Fig. 5. Gray shading: residues similar/identical to IpLITR2. Boxed residues: contacts for Ig Fc in huFcεRI. Black and gray arrows represent the predicted β-strands for IpLITR2 and huFcεRI, respectively. Hatched boxes indicate conserved cyteines and dashes represent gaps. b Phylogenetic analysis of IpLITR2 D1 and D3 sequences (gray shaded) compared with representative mammalian FcR sequences (as in Fig. 5) and D1 sequences of representative CHIRs. The accession numbers for the various Ig domain sequences used are: CHIRB2 (XP_422905), CHIRB1 (CAH55757), CHIRAB2 (CAG33733), CHIRA2 (CAG33731), CHIRB5 (AJ879908), CHIR A1 (AF306851), CHIRB4 (XP_428342), CHIRB6 (CAI53861), and CHIRAB3 (AJ879909). NJ trees with pairwise gap deletions were drawn using MEGA v3.0 (Kumar et al. 2001) with 10,000 bootstrap replications, and bootstrap values >50% are shown. Branch lengths were measured in terms of amino acid substitutions, and scale bars are shown below the trees. c Alignment of IpLITR2 D3 and CHIR D1. Gray shading indicates residues that are similar/identical to IpLITR2, black and gray arrows represent predicted β-strands for IpLITR2 and CHIRA2, respectively; “dotted” lines indicate predicted helices and hatched boxes indicate conserved cyteines. Gaps in alignment are indicated by dashes Attempts to model IpLITR Ig domains were unsuccessful as no sufficient modeling templates were identified using SWISS-Model. However, similarity searches against the NCBI’s protein data bank (PDB) indicated a significant match between D1 and D2 of IpLITRs and the Ig domains of human FcεRIα (E value <10−8). Conversely, the membrane proximal D3 and D4 Ig domains of IpLITR1 and IpLITR3 had significant alignment scores (E value <10−7) with the first two Ig domains of the human natural cytotoxicity receptor NKp46. Taken together, these PDB search results further support that IpLITRs D1 and D2 Ig domain sequences are related to mammalian FcRs and FCRLs, and that the D3 and D4 Ig domains are related to LRC encoded receptors. Mining of the <span class="Species">zebrafish genome identified five contigs (Table 2) containing sequences encoding IpLITR-like proteins predicted to contain seve<span class="Species">ral Ig domains and, in some cases, signal peptides, TM segments, and CYTs with signaling motifs (Fig. 7). These findings indicate that IpLITR-like molecules are not unique to the catfish, but are likely common in other teleost species. Because IpLITR3 was identified as the closest match from the NCBI’s database to the zebrafish (Zf) LITR-like proteins, it was used for further comparisons. Phylogenetic analysis of the various Ig domain sequences indicated that the ZfLITR-like proteins were closely related to those of IpLITRs (Fig. 7a). In most cases, the membrane proximal domains of ZfLITRs are highly related to their IpLITR3 counterparts with >60% amino acid identity (Fig. 7b). However, one of the ZfLITRs (XP_692267) contains two Ig domains similar to IpLITR3 D6 in the membrane distal region. This zebrafish receptor also contains three Ig domains that are phylogentically related (Fig. 7a) with high amino acid identity (∼50%) to IpLITR3 D4 (Fig. 7b). The other ZfLITR-like proteins are also composed of combinations of Ig domains that are related to IpLITR3 Ig domains with varying degrees of amino acid identities (e.g., 25–66%). However, none of the predicted ZfLITR-like molecules contained membrane distal Ig domains that were related to IpLITR D1 and D2, which are shared among all the IpLITRs identified to date. This suggests either that LITR membrane distal domains may have coevolved with distinct ligands within individual fish species or that ZfLITRs with D1 and D2 domains similar to IpLITRs have yet to be identified. It should be noted, however, that these zebrafish domains were obtained from genomic sequence and that they do not accurately represent the precise organization of the Ig domains likely to be present in encoded ZfLITRs, which will only be determined from cDNA sequences. Nonetheless, the genomic segments are useful for domain-to-domain comparisons and reinforced the presence of IpLITR-like sequences in another teleost species.
Fig. 7

Annotation of zebrafish LITR-like proteins. a Phylogenetic analysis of ZfLITR and IpLITR3 Ig domains. Ig domains were predicted using SMART (Letunic et al. 2004) and the amino acid sequences aligned using CLUSTALW (Thompson et al. 1997). NJ trees with pairwise gap deletions were drawn using MEGA v3.0 (Kumar et al. 2001). Only branch values >50 are shown, and the major Ig domain groups are designated by brackets and shaded according to their relatedness with IpLTR3 Ig domain. b Schematic representation of ZfLITR-like proteins compared with IpLITR3. Domains are shaded according to their phylogenetic relationship with IpLITR3 domains. Hatched bars on IpLITR3 and Zf XP_692267 indicate signal peptides, TM segments are solid black lines, and ITIMs are shown as gray boxes for XP_694305. Amino acid identity vs corresponding IpLITR3 Ig domains are indicated as percentage value above each domain, and only IpLITR3 D3, D4, D5, and D6 were related to the Ig domains of the representative ZfLITR analyzed, as indicated by the dashed box. Predicted size in amino acids for each molecule is indicated on the left

Annotation of <span class="Species">zebrafish LITR-like proteins. a Phylogenetic analysis of ZfLITR and IpLITR3 Ig domains. Ig domains were predicted using SMART (Letunic et al. 2004) and the amino acid sequences aligned using CLUSTALW (Thompson et al. 1997). NJ trees with pairwise gap deletions were drawn using MEGA v3.0 (Kumar et al. 2001). Only branch values >50 are shown, and the major Ig domain groups are designated by brackets and shaded according to their relatedness with IpLTR3 Ig domain. b Schematic representation of ZfLITR-like proteins compared with IpLITR3. Domains are shaded according to their phylogenetic relationship with IpLITR3 domains. Hatched bars on IpLITR3 and Zf XP_692267 indicate signal peptides, TM segments are solid black lines, and ITIMs are shown as gray boxes for XP_694305. Amino acid identity vs corresponding IpLITR3 Ig domains are indicated as percentage value above each domain, and only IpLITR3 D3, D4, D5, and D6 were related to the Ig domains of the representative ZfLITR analyzed, as indicated by the dashed box. Predicted size in amino acids for each molecule is indicated on the left

Discussion

The novel IpLITRs described herein represent a polymorphic and polygenic gene complex that are primarily expressed in hematopoietic tissues. The polymorphic nature of this gene complex was indicated by RFLP analysis, which revealed differences in where various restriction enzymes cut the genomic DNA among the sibling catfish. However, it should be noted that only detailed sequence analyses of these IpLITR genes in a number of individuals would be required to determine if any polymorphic differences are also found within the coding regions. In addition, segregation analyses suggested that IpLITR genes are encoded within multiple independently segregating but homologous loci, similar to the situation seen with the ZfLITR homologs identified by genome mining. These paralagous relationships strongly suggest that IpLITRs are products of multiple gene duplication and translocation events from a common ancestoral gene. Whether or not the receptors encoded by the different IpLITR loci are functionally redundant remains to be determined. However, IpLITRs are related to functionally and genomically distinct mammalian FcRs and LRC encoded receptors, suggesting that such paralogous loci could have evolved to give rise to an array of immunoregulatory receptors with different functions. The coordinate expression of IpLITRs by myeloid and lymphoid cell lines in combination with their potential activating and inhibitory signaling capabilities suggests that they play an important role in immune cell function(s). This possible importance of IpLITRs in immune responses is highlighted by the RT-PCR expression studies where a large number of highly related, but unique, IpLITR sequences were identified. These variant IpLITR sequences differed in the number of Ig domains present, and in some cases in the length of the CYT. Therefore, in addition to the prototype IpLITR1, IpLITR2, and IpLITR3 described here, other IpLITR family members are coexpressed by <span class="Species">catfish myeloid and lymphoid cells. Whether or not some of the variously sized t<span class="Species">ranscripts represent messages from different IpLITR genes or are the result of alternative splicing is unknown. However, the large number of unique IpLITRs found expressed suggests that IpLITRs represent a complex immune receptor family that can potentially generate a large number of IpLITR types. The prototypical IpLITR1, IpLITR2, and IpLITR3 encode receptors with four, three, and six Ig domains, respectively. Pairwise comparisons and phylogenetic analysis of these domains suggest a high degree of conservation and a conserved memb<span class="Species">rane distal to memb<span class="Species">rane proximal ordering. Each of these three receptors has very similar D1 and D2 sequences, and IpLITR1 and IpLITR3 have almost identical D3 and D4s. However, variation does occur between predicted membrane proximal Ig domains. The IpLITR2 D3 sequence is unique to this receptor and IpLITR3 D5 and D6 are not similar to any other of the prototypical IpLITR Ig domain sequences. Identification of LITR-like sequences on different zebrafish chromosomes and comparisons with IpLITRs supports the notion that these polymorphic and polygenic immune receptors are not unique to catfish. Like IpLITRs, the predicted ZfLITRs are also composed of unique combinations of Ig domains. Such differences in the Ig domain compositions of IpLITRs and ZfLITRs may influence their ligand binding capabilities, formation of homo- or heterodimers and overall immunomodulatory functions. IpLITR1 has a long CYT with two consensus ITIMs and a third ITIM-like motif, whereas both IpLITR2 and IpLITR3 have shorter CYTs devoid of recognizable signaling motifs. However, these latter two receptors each contain a lysine residue within their TM segments, indicating that associations with an adaptor molecule(s) would be necessary for them to initiate int<span class="Species">racellular signaling (Daeron and Vivier 1999; Ravetch and Lanier 2000; Billadeau and Leibson 2002). Within the CYT of IpLITRI was also an overlapping ITSM suggesting that multiple motifs (ITIMs and ITSM) within the CYT of this receptor may participate in downstream signaling cascades through recruitment of various adaptor molecules (Sidorenko and Clark 2003). Similarly, predicted ZfLITR family members were shown to either contain long CYTs with ITIM motifs or short CYTs with charged TM segments. Genes for immunotyrosine-based-activation-motif-bearing adaptor molecules (e.g., FcRγ chain, CD3ζ, and DAP) have been identified in several ectothermic vertebrates, including frogs and fish (Guselnikov et al. 2003a,b). Hence, it seems likely that IpLITR2 and IpLITR3 would each associate with such molecules and function in a similar manner as mammalian receptors with charged TM segments. Thus, the paired expression pattern of IpLITRs with activatory and inhibitory signaling potential is very similar to that shown for several mammalian and avian families of immune receptors, including PIRs, LILRs, KIRs, FcRs, and CHIRs. Similarity searches for IpLITR relatives revealed a striking dichotomy. The majority of matches were members of two distinct <span class="Species">mammalian receptor families. While IpLITR2 appeared to be more closely related to FcRs and FCRLs, IpLITR1 and IpLITR3, exhibiting very similar D1–D4 sequences, were related to both FcR/FCRLs and LRC-encoded receptors. Thus, it is postulated that the D1 and D2 domains common to all IpLITRs are evolutionarily more closely related to domains encoded by the mammalian FcR and FCRLs, a contention supported by the retrieval of the human FcεRI alpha chain as the most similar structure from a PDB search. Phylogenetic analyses also supported this hypothesis because the IpLITR D1 and D2 clustered with members of the FcR and FCRL receptor families and away from representative LRC gene family members. Although the D1D2 of IpLITRs are phylogenetically related to FcR and FcRLs, there is no evidence to support that IpLITRs bind Ig. It appears more likely that the relatedness of these membrane distal Ig domains, as also demonstrated for FCRLs, PIRs, and CHIRs, are only evident at the phylogenetic level and that they are not functional homologs. Furthermore, during the preparation of this manuscript, a “bona fide” Ig-binding catfish FcR homolog, which is not a member of the IpLITR receptor family, was identified and characterized (Stafford et al. 2006). In contrast to the D1 and D2 domains, IpLITR1 and IpLITR3 D3 and D4 Ig domains are related to several members of the LRC (human chromosome 19q13.4). As above, these two domains clustered with one family of receptors (the LRC) and not the other (i.e., FcR/FcRLs). The identification of NKp46 as a structural relative from the PDB also supports this notion. Interestingly, D5 and D6 of IpLITR3 are related to FcR and FCRLs, but their membrane proximal location suggests that they are unlikely to be involved in ligand recognition (i.e., Ig). Finally, the third domain of IpLITR2 clustered with the Ig domains of several representative CHIRs. Taken together, IpLITR extracellular domain sequences appear reminiscent of both FcR/FCRLs and members of the mammalian and avian LRC, implying that catfish LITRs are distant relatives to each of these genomically and functionally diverse receptor gene families. At present, the functional significance of these novel teleost immune receptors is unknown. Recently, key insights into the evolution of the <span class="Gene">FcR and LRC gene families and their potential common origin has been presented: (1) <span class="Species">human chromosomes 1 and 19 are believed to be in paralogous regions of the genome due to an entire genome duplication event (Kasahara 1999; Shiina et al. 2001); (2) attempts at cloning rodent FcαR (CD89) orthologs identified the PIR gene family located on a mouse chromosome, which is syntenic to the human LRC (Kubagawa et al. 1997; Hayami et al. 1997); (3) the subsequent search for distant PIR relatives resulted in the discovery of the CHIRs, providing the first molecular evidence for a common ancestor of LRC and FcR gene families (Dennis et al. 2000); (4) sequencing of genomic segments encoding the CHIR gene family identified the chicken equivalent of an LRC that appears to have also been expanded by gene duplication events (Nikolaidis et al. 2005a); and (5) the identification of Ig-like domains in chickens, Xenopus, and bony fish that are related to Ig domains of mammalian FcRs and members of the LRC (Nikolaidis et al. 2005b). Taken together, these findings suggest that immune receptors encoded by human chromosome 1q21 and 19q13 most likely evolved from a common ancestor that has since undergone multiple rounds of duplication and homologous recombination events. Although there is functional evidence for the existence of FcR- or <span class="Gene">KIR/LILR-like homologs in ectothermic vertebrates (Coosemans and Hadji-Azimi 1986; Shen et al. 2003, 2004), their genetic identification has not been previously reported and the inability to clone these receptors has made it difficult to elucidate their evolutionary history. The recent discovery of mammalian FCRL genes located on chromosome 1q21-22, however, has expanded the view of immune receptor evolution (Davis et al. 2001; Hatzivassiliou et al. 2001; Miller et al. 2002; Guselnikov et al. 2002). For example, FCRL3, FCRL4, and FCRL5 not only encode D1, D2, and D3 Ig domains homologous to the corresponding domains of FcγRI, but also contain variable numbers of unique membrane proximal Ig domains (Davis et al. 2001; Hatzivassiliou et al. 2001). Homology searches demonstrated that the FCRLs, also termed IFGP (for IgSF, FcR, and gp42) exhibited a “chimeric” Ig domain compositions and consequently these receptors were proposed to be a phylogenetic link between the FcRs, rat NK cell-specific gp42 antigen, and adhesion molecules (Guselnikov et al. 2002). This feature of similar Ig domains encountered in homologous but functionally diverse receptors is also a striking feature of the IpLITRs and supports the hypothesis that certain mammalian immune receptor families (i.e., FcRs and KIRs) have evolved from a common ancestor. Notably, although the IpLITRs D1 and D2 domains are phylogenetically and structurally similar to the mammalian FcRs and FCRLs, the IpLITR ligand(s) is unknown. This is similar to the situation with mammalian FCRL molecules, whose membrane distal Ig domains are clearly related to the classic FcRs, but are unlikely to be functional homologs because they do not bind Ig (Hatzivassiliou et al. 2001; Davis et al. 2005). Therefore, although certain Ig domains encoded by several receptor gene families identified in humans, rodents, birds, and fish (i.e., FCRLs, PIRs, CHIRs, and IpLITRs, respectively) are related to FcRs, they appear to have evolved to recognize different ligands. Recently, it was shown that rodent PIRs recognized MHC class 1 and β2M (Takai 2005), raising the possibility that related immunoregulatory receptors in other species (i.e., CHIRs and IpLITRs) could also be involved in MHC recognition. In summary, the discovery of individual <span class="Species">catfish receptors that encode Ig domains related to both <span class="Gene">FcR and LRC gene families provides further support for the common origin of these important mammalian immune receptors. Identification of LITR-like sequences in the zebrafish genome also demonstrates that these receptors are likely found in all teleosts. Annotation of these genomic segments will be necessary to determine if zebrafish LITR homologs exhibit conserved genomic features and syntenic genomic location with mammalian 1q21-23 and/or 19q13. Thus, the discovery of IpLITRs is an important step towards further understanding the common origin and evolutionary history of the different families of mammalian immunoregulatory receptors. The investigation of the functional significance of these novel teleost receptors is underway and will be aided by the availability of channel catfish cell lines that coordinately express IpLITRs and the eventual production of IpLITR specific antibodies. Below is the link to the electronic supplementary material. 52 kb
  55 in total

Review 1.  Immune inhibitory receptors.

Authors:  J V Ravetch; L L Lanier
Journal:  Science       Date:  2000-10-06       Impact factor: 47.728

Review 2.  ITAMs versus ITIMs: striking a balance during cell regulation.

Authors:  Daniel D Billadeau; Paul J Leibson
Journal:  J Clin Invest       Date:  2002-01       Impact factor: 14.808

3.  Origin and evolution of the chicken leukocyte receptor complex.

Authors:  Nikolas Nikolaidis; Izabela Makalowska; Dimitra Chalkia; Wojciech Makalowski; Jan Klein; Masatoshi Nei
Journal:  Proc Natl Acad Sci U S A       Date:  2005-03-07       Impact factor: 11.205

4.  MHC RFLP analyses in channel catfish full-sibling families: identification of the role of MHC molecules in spontaneous allogeneic cytotoxic responses.

Authors:  Sylvie M-A Quiniou; Melanie Wilson; Eva Bengtén; Geoffrey C Waldbieser; L William Clem; Norman W Miller
Journal:  Dev Comp Immunol       Date:  2004-11-18       Impact factor: 3.636

5.  The gene for the human IgA Fc receptor maps to 19q13.4.

Authors:  E J Kremer; V Kalatzis; E Baker; D F Callen; G R Sutherland; C R Maliszewski
Journal:  Hum Genet       Date:  1992-04       Impact factor: 4.132

6.  The chicken leukocyte receptor complex: a highly diverse multigene family encoding at least six structurally distinct receptor types.

Authors:  Birgit C Viertlboeck; Felix A Habermann; Ramona Schmitt; Martien A M Groenen; Louis Du Pasquier; Thomas W Göbel
Journal:  J Immunol       Date:  2005-07-01       Impact factor: 5.422

7.  Cytotoxic activity generated from channel catfish peripheral blood leukocytes in mixed leukocyte cultures.

Authors:  T B Stuge; S H Yoshida; V G Chinchar; N W Miller; L W Clem
Journal:  Cell Immunol       Date:  1997-05-01       Impact factor: 4.868

8.  Identification and characterization of clonal NK-like cells from channel catfish (Ictalurus punctatus).

Authors:  Linling Shen; Tor B Stuge; Eva Bengtén; Melanie Wilson; V Gregory Chinchar; John P Naftel; Jayne M Bernanke; L William Clem; Norman W Miller
Journal:  Dev Comp Immunol       Date:  2004-02       Impact factor: 3.636

9.  Fish cell lines: establishment of a line from ovaries of channel catfish.

Authors:  P R Bowser; J A Plumb
Journal:  In Vitro       Date:  1980-05

10.  Channel catfish NK-like cells are armed with IgM via a putative FcmicroR.

Authors:  Linling Shen; Tor B Stuge; Jason P Evenhuis; Eva Bengtén; Melanie Wilson; V Gregory Chinchar; L William Clem; Norman W Miller
Journal:  Dev Comp Immunol       Date:  2003-09       Impact factor: 3.636

View more
  23 in total

1.  Origin and evolution of the vertebrate leukocyte receptors: the lesson from tunicates.

Authors:  Ivana Zucchetti; Rosaria De Santis; Simona Grusea; Pierre Pontarotti; Louis Du Pasquier
Journal:  Immunogenetics       Date:  2009-04-30       Impact factor: 2.846

2.  A bony fish immunological receptor of the NITR multigene family mediates allogeneic recognition.

Authors:  John P Cannon; Robert N Haire; Andrew T Magis; Donna D Eason; Kelley N Winfrey; Jose A Hernandez Prada; Kate M Bailey; Jean Jakoncic; Gary W Litman; David A Ostrov
Journal:  Immunity       Date:  2008-07-31       Impact factor: 31.745

3.  Diversity of CD2 subfamily receptors in cyprinid fishes.

Authors:  Shiro Sameshima; Miki Nakao; Tomonori Somamoto
Journal:  Results Immunol       Date:  2012-02-01

Review 4.  Identification of distinct LRC- and Fc receptor complex-like chromosomal regions in fish supports that teleost leukocyte immune-type receptors are distant relatives of mammalian Fc receptor-like molecules.

Authors:  Jiahui Wang; Miodrag Belosevic; James L Stafford
Journal:  Immunogenetics       Date:  2021-01-07       Impact factor: 2.846

5.  Channel catfish leukocyte immune-type receptors contain a putative MHC class I binding site.

Authors:  James L Stafford; Eva Bengtén; Louis Du Pasquier; Norman W Miller; Melanie Wilson
Journal:  Immunogenetics       Date:  2006-12-06       Impact factor: 2.846

Review 6.  The phylogenetic origins of natural killer receptors and recognition: relationships, possibilities, and realities.

Authors:  Jeffrey A Yoder; Gary W Litman
Journal:  Immunogenetics       Date:  2010-12-30       Impact factor: 2.846

Review 7.  Multigene families of immunoglobulin domain-containing innate immune receptors in zebrafish: deciphering the differences.

Authors:  Iván Rodríguez-Nunez; Dustin J Wcisel; Gary W Litman; Jeffrey A Yoder
Journal:  Dev Comp Immunol       Date:  2014-02-15       Impact factor: 3.636

8.  The amphibians Xenopus laevis and Silurana tropicalis possess a family of activating KIR-related Immunoglobulin-like receptors.

Authors:  Sergey V Guselnikov; Evdokiya S Reshetnikova; Alexander M Najakshin; Ludmila V Mechetina; Jacques Robert; Alexander V Taranin
Journal:  Dev Comp Immunol       Date:  2009-11-17       Impact factor: 3.636

9.  The identification of additional zebrafish DICP genes reveals haplotype variation and linkage to MHC class I genes.

Authors:  Ivan Rodriguez-Nunez; Dustin J Wcisel; Ronda T Litman; Gary W Litman; Jeffrey A Yoder
Journal:  Immunogenetics       Date:  2016-01-22       Impact factor: 2.846

10.  Characterization of additional novel immune type receptors in channel catfish, Ictalurus punctatus.

Authors:  Jason Evenhuis; Eva Bengtén; Cecile Snell; Sylvie M Quiniou; Norman W Miller; Melanie Wilson
Journal:  Immunogenetics       Date:  2007-05-30       Impact factor: 2.846

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.