Literature DB >> 16820064

Limited polymorphism in Plasmodium falciparum ookinete surface antigen, von Willebrand factor A domain-related protein from clinical isolates.

Jack S Richards1, Nicholas J MacDonald, Damon P Eisen.   

Abstract

BACKGROUND: As malaria becomes increasingly drug resistant and more costly to treat, there is increasing urgency to develop effective vaccines. In comparison to other stages of the malaria lifecycle, sexual stage antigens are under less immune selection pressure and hence are likely to have limited antigenic diversity.
METHODS: Clinical isolates from a wide range of geographical regions were collected. Direct sequencing of PCR products was then used to determine the extent of polymorphisms for the novel Plasmodium falciparum sexual stage antigen von Willebrand Factor A domain-related Protein (PfWARP). These isolates were also used to confirm the extent of diversity of sexual stage antigen Pfs28.
RESULTS: PfWARP was shown to have non-synonymous substitutions at 3 positions and Pfs28 was confirmed to have a single non-synonymous substitution as previously described.
CONCLUSION: This study demonstrates the limited antigenic diversity of two prospective P. falciparum sexual stage antigens, PfWARP and Pfs28. This provides further encouragement for the proceeding with vaccine trials based on these antigens.

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 16820064      PMCID: PMC1526741          DOI: 10.1186/1475-2875-5-55

Source DB:  PubMed          Journal:  Malar J        ISSN: 1475-2875            Impact factor:   2.979


Background

Development of effective Plasmodium falciparum vaccines is a global health priority with all stages of the malaria lifecycle being investigated for possible vaccine strategies [1]. Mosquito-stage vaccines aim to induce immunity to the forms of the parasite found in the mid-gut of mosquitoes: the sexual stage macro- and microgametes and the post-fertilization zygotes and ookinetes. Antibodies that target antigens in these stages prevent infection in the mosquito thus breaking the transmission cycle. Since malaria transmission is both highly localized and focal [2], such vaccines may form a useful element as part of integrated control programmes to locally eliminate or substantially reduce transmission. They may also have a useful role in conjunction with chemotherapeutic agents to prevent drug-resistant or vaccine-escape mutants. The P. falciparum, mosquito-stage vaccine candidate antigens include Pfs25, Pfs28, Pfs48/45, Pfs230 and the recently described, von Willebrand factor A domain-related protein (PfWARP) [3,4]. PfWARP (PF08_0136b) is located on chromosome 8 (GenBank: NC_004329 Region: 1221207...1222079) and encodes a 290 amino acid protein. On the basis of previous study of orthologues in Plasmodium berghei and Plasmodium gallinaceum, PfWARP is thought to be a soluble micronemal protein expressed in the late ookinete and early oocyst [5-7]. It is proposed that the von Willebrand factor A domains found in PfWARP and other malaria antigens, including circumsporozoite protein and thrombospondin-related anonymous protein have a role as an adhesive substrate and may assist in host cell invasion [7,8]. Pfs28 (PF10_0302) is a lead candidate for a transmission-blocking vaccine. It is a 28-kDa protein and is presumably anchored to parasite surface by glycosylphosphatidylinositol [9]. It is encoded on chromosome 10 and shares putative functional determinants with Pfs25. Pfs28 is expressed on the surface of late ookinetes of P. falciparum and it is proposed that it is involved in adherence to the mosquito's gut epithelium [10]. Previous studies have examined Pfs28 polymorphism in laboratory isolates Dd2, 2D11, CAMP, LE5, LF4, HB3, 7G8 [11] and from 32 field isolates from a geographically restricted region in the Philippines [12]. These have shown the presence of a single non-synonymous A274G base substitution, resulting in a conservative amino acid change from lysine to arginine (GenBank: L25843). As part of the assessment of PfWARP's suitability as a vaccine candidate, the diversity in this gene was assessed using P. falciparum field isolates from a range of geographic locations. In addition, Pfs28 was sequenced in the same isolates to extend previous observations of its' diversity.

Methods

Review and approval of the study was obtained from the Research Ethics Committee of the Royal Brisbane Hospital and the Melbourne Health Human Research Ethics Committee. Clinical samples from P. falciparum-infected patients were obtained from the Malaria Reference Laboratory at the Royal Brisbane Hospital, Queensland. Twenty-two samples were studied from unrelated travellers returning from Papua New Guinea, Solomon Islands, Pakistan, Kenya, Tanzania, Uganda, Zimbabwe, and Ghana. Whole blood specimens were stored in 8 M guanidine hydrochloride/0.1 M Na H2PO4. Genomic DNA was isolated from the samples using the QIAquick® PCR purification kit (Qiagen, Hilden, Germany). PfWARP and Pfs28 polymorphism was assessed using PCR conditions as outlined (Table 1). All PCR reactions used Amplitaq Gold® DNA polymerase (Roche Diagnostics, Mannheim, Germany). PCR products were detected after submarine electrophoresis using 1% agarose gel stained with ethidium bromide. PCR products were purified for direct sequencing using QIAquick® PCR purification kit (Qiagen, Hilden, Germany) or were agarose gel purified using MinElute Gel extraction kit® (Qiagen, Hilden, Germany) purification kit. DNA sequencing was performed utilising the automated 3100 Genetic Analyser capillary system. In addition, samples with multiple infections of P. falciparum were detected by merozoite surface protein 2 (MSP2) PCR as previously described [13]. Amplification of this highly polymorphic gene allowed rapid detection of size separable fragments by gel electrophoresis.
Table 1

Details of primers, primer and MgCl2 concentrations and cycle conditions for the amplification of PfWARP and Pfs28 genes. Oligonucleotide positions are based on NCBI Genebank sequence PfWARP (NC_004329) and Pfs28 (L25843).

OligonucleotideNucleotide sequenceDescriptionPrimer (μM)/MgCl2 (mM)Cycle conditions
PfWARP_USFGTTGTTGTATAATAAGAGAGAGAAAAATGWARP bases 1221181 to 12212090.6/2.094°C 10 min (94°C 30 sec, 52°C 30 sec, 72°C 60 sec) 40 cycles, 72°C 5 min
PfWARP_IRTACATCTTATGATTTATTCTTATCACATAWARP bases 1222057 to 1222085
PfWARP_IFGTGGTATTATGTTTGGGTATGATATCAGCWARP bases 1221222 to 12212500.6/1.594°C 10 min (94°C 30 sec, 52°C 30 sec, 72°C 60 sec) 25 cycles, 72°C 5 min
PfWARP_IRTACATCTTATGATTTATTCTTATCACATAWARP bases 1222057 to 1222085
Pfs28_F1ATGAATACATATTTTAAGGTACTTCTTPfs28 bases 60 to 861.0/2.594°C 10 min (94°C 60 sec, 46°C 60 sec, 72°C 45 sec) 40 cycles, 72°C 10 min
Pfs28_R650GAGCATACAATCAGAACGTGTGTTAGGPfs28 bases 680 to 709
Pfs28_F40CAACTTTACATAACGTTGAATAAGGCTCPfs28 bases 99 to 1261.0/2.594°C 10 min (94°C 60 sec, 50°C 60 sec, 72°C 45 sec) 34 cycles, 72°C 10 min
Pfs28_R630GCATACAATCAGAACGTGTGTTAGPfs28 bases 666 to 689
Details of primers, primer and MgCl2 concentrations and cycle conditions for the amplification of PfWARP and Pfs28 genes. Oligonucleotide positions are based on NCBI Genebank sequence PfWARP (NC_004329) and Pfs28 (L25843).

Results

PfWARP was amplified from 19 of the field samples and three laboratory strains (3D7, FC27, and FCR3). As judged by MSP2 genotyping, there were multiple infections in 7 of the 19 patient samples. These 7 patient samples had a minimum of 26 genetically different clones of P. falciparum. However, direct sequencing of PCR products from each of these samples showed only a single genotype of PfWARP with no mixed peaks in the sequencing traces. Non-synonymous nucleotide substitutions were found to occur in three positions amongst the variant sequences. No synonymous substitutions were identified. The predicted amino acid changes were conservative and contained within the single Von Willebrand factor domain (Table 2). Sample numbers were insufficient to determine whether there was any geographic distribution to the PfWARP alleles.
Table 2

Details of PfWARP and Pfs28 polymorphisms and geographic origin for each isolate

Isolate numberGeographic originaPfsWARP sequencebPfs28 sequencec

Nucleotide sequence 1221576–1221581Nucleotide sequence 1221645–1221650Nucleotide sequence 1221885–1221890Nucleotide sequence 270–275
3D7NetherlandsGTCTTTGTAGTCCAAACATTTAAA
FC27Papua New GuineaGTCCTTGTATTCCAAGCAXd
FCR3Central/South AmericaGTCCTTGTATTCCAAGCAXd
1UgandaGTCTTTGTACTCCAAACATTTAAA
2Papua New GuineaGTCCTTGTATTCCAAGCATTTAGA
3Papua New GuineaGTCCTTGTATTCCAAGCATTTAGA
4Ivory CoastGTCTTTGTATTGCAAACAXd
5Papua New GuineaGTCCTTGTATTCCAAGCATTTAGA
6Papua New GuineaGTCCTTGTATTCCAAGCAXd
7TanzaniaGTCCTTGTATTCCAAGCATTTAGA
8TanzaniaGTCCTTGTATTCCAAGCATTTAAA
9Papua New GuineaGTCCTTGTATTCCAAGCAXd
10Solomon IslandsGTCCTTGTATTCCAAGCATTTAGA
11GhanaGTCTTTGTATTGCAAACATTTAAA
12Papua New GuineaGTCCTTGTATTCCAAGCATTTAGA
13Papua New GuineaGTCTTTGTAGTCCAAACATTTAGA
14Papua New GuineaGTCTTTGTATTGCAAGCATTTAAA
15PakistanGTCCTTGTATTCCAAGCATTTAGA
16Papua New GuineaGTCCTTGTATTCCAAGCATTTAGA
17Papua New GuineaGTCCTTGTATTCCAAGCATTTAGA
18KenyaGTCTTTGTAGTCCAAACATTTAAA
19Papua New GuineaGTCCTTGTATTCCAAGCATTTAAA
20Papua New GuineaXdXdXdTTTAGA
21TogoXdXdXdTTTAAA
22Papua New GuineaXdXdXdTTTAAA
23TanzaniaXdXdXdTTTAAA
24ZimbabweXdXdXdTTTAAA
25GhanaXdXdXdTTTAAA
CAMPeSE AsiaXdXdXdTTTAAA
LE5eAfricaXdXdXdTTTAAA
LF4eAfricaXdXdXdTTTAAA
HB3eCentral/South AmericaXdXdXdTTTAAA
7G8eCentral/South AmericaXdXdXdTTTAAA
Dd2eSE AsiaXdXdXdTTTAGA
2D11eSE AsiaXdXdXdTTTAGA
2 Philippine isolateseSE AsiaXdXdXdTTTAAA
30 Philippine isolateseSE AsiaXdXdXdTTTAGA

a The precise geographic origin of laboratory parasite strains is unclear in some instances

b Variable nucleotide positions for PfWARP are indicated in bold (GenBank: NC_004329 Region: 1221207...1222079).

c Variable nucleotide positions for Pfs28 are indicated in bold (GenBank: L25843).

d The symbol "X" is used to indicate that the isolate was not tested.

e Theses isolates, laboratory strains and their geographic origin are cited as given in the paper by Hafalla et al [12].

Details of PfWARP and Pfs28 polymorphisms and geographic origin for each isolate a The precise geographic origin of laboratory parasite strains is unclear in some instances b Variable nucleotide positions for PfWARP are indicated in bold (GenBank: NC_004329 Region: 1221207...1222079). c Variable nucleotide positions for Pfs28 are indicated in bold (GenBank: L25843). d The symbol "X" is used to indicate that the isolate was not tested. e Theses isolates, laboratory strains and their geographic origin are cited as given in the paper by Hafalla et al [12]. Pfs28 was amplified in 22 field samples (representing at least 31 clones due to the existence of multiple MSP2 alleles in nine patients) and in 3D7. The A274G, non-synonymous, nucleotide substitution as previously described, was found with 11 of the 22 samples having the A274 allele (Table 2). No other nucleotide substitutions were present. This data was combined with that from Hafalla et al [12] to consider the geographic distribution of Pfs28 alleles. In Asia/Pacific isolates, 42 of 48 carried the G274 allele while only 1 of 14 of Africa/Americas isolates bore this allele (p < 0.001, Fisher's exact test). While recognizing the size limitations of this study, it is still striking that there is such a significant difference in the geographic distribution of these Pfs28 alleles (Table 2).

Discussion

For the first time, this study addresses the issue of antigenic diversity in PfWARP. This antigen appears to have restricted diversity with infrequent point mutations as defined. Additionally, by documenting the genotype of Pfs28 in field isolates from a larger cohort with wider geographic distribution than in previous studies, we confirm that there are only two alleles of this protein. Restricted antigenic diversity has been described in other sexual stage antigens and is explicable due to the absence of human immune selection pressure [14-16]. By contrast, asexual stage candidate antigens such as MSP2 are highly polymorphic due to P. falciparum's immune evasion mechanisms [17]. Pfs28, and its orthologues from other species, Pvs28 (Plasmodium vivax) and Pbs21 (P. berghei) clearly induce antibodies that block parasitic infection in mosquitoes and are thus candidate antigens for inducing transmission blocking immunity in humans either alone [18] or in combination with other mosquito-stage antigens. So far there have been two published vaccine trials in humans with Pfs25 [19] and with its P. vivax orthologue, Pvs25 [20], with other trials currently underway.

Conclusion

The demonstration of limited sequence variation in the newly described P. falciparum ookinete surface antigen PfWARP and the confirmed highly conserved nature of Pfs28 in clinical samples from a wide geographical distribution, increase the confidence that these proteins may also be suited for mosquito-stage vaccine development.

Authors' contributions

JSR carried out the genetic studies, sequence alignment and drafted the manuscript. NJM designed and supplied the primers. DPE designed a study of returned travellers with malaria and recruited the patients, assisted in the sequence alignment and helped draft the manuscript. All authors read and approved the final manuscript.
  20 in total

1.  Single amino acid variation in the ookinete vaccine antigen from field isolates of Plasmodium falciparum.

Authors:  Y P Shi; M P Alpers; M M Povoa; A A Lal
Journal:  Mol Biochem Parasitol       Date:  1992-01       Impact factor: 1.759

2.  Minimal variation in a vaccine candidate from the sexual stage of Plasmodium falciparum.

Authors:  D C Kaslow; I A Quakyi; D B Keister
Journal:  Mol Biochem Parasitol       Date:  1989-01-01       Impact factor: 1.759

3.  Minimal variation in the Pfs28 ookinete antigen from Philippine field isolates of Plasmodium falciparum.

Authors:  J C Hafalla; M L Santiago; M C Pasay; B L Ramirez; M M Gozar; A Saul; D C Kaslow
Journal:  Mol Biochem Parasitol       Date:  1997-07       Impact factor: 1.759

4.  A novel malaria protein, Pfs28, and Pfs25 are genetically linked and synergistic as falciparum malaria transmission-blocking vaccines.

Authors:  P E Duffy; D C Kaslow
Journal:  Infect Immun       Date:  1997-03       Impact factor: 3.441

5.  Phase 1 vaccine trial of Pvs25H: a transmission blocking vaccine for Plasmodium vivax malaria.

Authors:  Elissa M Malkin; Anna P Durbin; David J Diemert; Jetsumon Sattabongkot; Yimin Wu; Kazutoyo Miura; Carole A Long; Lynn Lambert; Aaron P Miles; Jin Wang; Anthony Stowers; Louis H Miller; Allan Saul
Journal:  Vaccine       Date:  2005-05-02       Impact factor: 3.641

6.  Transmission blocking malaria vaccines.

Authors:  R Carter
Journal:  Vaccine       Date:  2001-03-21       Impact factor: 3.641

7.  Saccharomyces cerevisiae-secreted fusion proteins Pfs25 and Pfs28 elicit potent Plasmodium falciparum transmission-blocking antibodies in mice.

Authors:  M M Gozar; V L Price; D C Kaslow
Journal:  Infect Immun       Date:  1998-01       Impact factor: 3.441

8.  Temporal variation of the merozoite surface protein-2 gene of Plasmodium falciparum.

Authors:  D Eisen; H Billman-Jacobe; V F Marshall; D Fryauff; R L Coppel
Journal:  Infect Immun       Date:  1998-01       Impact factor: 3.441

9.  Sequence polymorphism in two novel Plasmodium vivax ookinete surface proteins, Pvs25 and Pvs28, that are malaria transmission-blocking vaccine candidates.

Authors:  T Tsuboi; D C Kaslow; M M Gozar; M Tachibana; Y M Cao; M Torii
Journal:  Mol Med       Date:  1998-12       Impact factor: 6.354

10.  A vaccine candidate from the sexual stage of human malaria that contains EGF-like domains.

Authors:  D C Kaslow; I A Quakyi; C Syin; M G Raum; D B Keister; J E Coligan; T F McCutchan; L H Miller
Journal:  Nature       Date:  1988-05-05       Impact factor: 49.962

View more
  6 in total

1.  Worldwide sequence conservation of transmission-blocking vaccine candidate Pvs230 in Plasmodium vivax.

Authors:  Masanori Doi; Kazuyuki Tanabe; Shin-Ichiro Tachibana; Meiko Hamai; Mayumi Tachibana; Toshihiro Mita; Masanori Yagi; Fadile Yildiz Zeyrek; Marcelo U Ferreira; Hiroshi Ohmae; Akira Kaneko; Milijaona Randrianarivelojosia; Jetsumon Sattabongkot; Ya-Ming Cao; Toshihiro Horii; Motomi Torii; Takafumi Tsuboi
Journal:  Vaccine       Date:  2011-04-21       Impact factor: 3.641

2.  Malaria, mosquitoes and the legacy of Ronald Ross.

Authors:  Robert E Sinden
Journal:  Bull World Health Organ       Date:  2007-11       Impact factor: 9.408

3.  Cloning, expression and transmission-blocking activity of anti-PvWARP, malaria vaccine candidate, in Anopheles stephensi mysorensis.

Authors:  Saber Gholizadeh; Hamid Reza Basseri; Sedigheh Zakeri; Hossein Ladoni; Navid Dinparast Djadid
Journal:  Malar J       Date:  2010-06-11       Impact factor: 2.979

4.  Global diversity of the gene encoding the Pfs25 protein-a Plasmodium falciparum transmission-blocking vaccine candidate.

Authors:  Pornpawee Sookpongthai; Korawich Utayopas; Thassanai Sitthiyotha; Theerakamol Pengsakul; Morakot Kaewthamasorn; Kittikhun Wangkanont; Pongchai Harnyuttanakorn; Surasak Chunsrivirot; Sittiporn Pattaradilokrat
Journal:  Parasit Vectors       Date:  2021-11-08       Impact factor: 3.876

5.  Analysis of von Willebrand factor A domain-related protein (WARP) polymorphism in temperate and tropical Plasmodium vivax field isolates.

Authors:  Saber Gholizadeh; Navid Dinparast Djadid; Hamid Reza Basseri; Sedigheh Zakeri; Hossein Ladoni
Journal:  Malar J       Date:  2009-06-23       Impact factor: 2.979

6.  Limited sequence polymorphisms of four transmission-blocking vaccine candidate antigens in Plasmodium vivax Korean isolates.

Authors:  Jung-Mi Kang; Hye-Lim Ju; Sung-Ung Moon; Pyo-Yun Cho; Young-Yil Bahk; Woon-Mok Sohn; Yun-Kyu Park; Seok Ho Cha; Tong-Soo Kim; Byoung-Kuk Na
Journal:  Malar J       Date:  2013-04-30       Impact factor: 2.979

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.